The concentrations of cytokines, including IL-1, IL-6, IL-8, IL-10, TNF-α, IFN-γ, CCL-2, and GM-CSF, were determined using an Ella automated microfluidic immunoassay system (ProteinSimple, USA). Serum separator tubes were left at room temperature for 30 min, followed by centrifugation at 1,500 rpm for 15 min to separate the serum. We pipetted 150 µL of serum sample into a 2-ml tube and added an equal volume of sample diluent. The mixture was vortexed for 10 s on medium intensity and then centrifuged at room temperature with 16,000g for 4 min to remove visible particulate/flocculent precipitate. We transferred 50 µL of the diluted samples into sample wells. The cytokine concentrations were measured using the default parameters of Ella-220401004 Analyzer version 4.1.0.22.

We collected serum samples from suspected cases of severe fever with thrombocytopenia syndrome in Suzhou City from April 2023 to August 2024. The 200-μL serum samples were added into the sample hole, and the total nucleic acid of the serum samples was extracted by using the EZ2 Connect automatic nucleic acid extraction instrument (Qiagen, Germany) according to the instructions of the Virus Mini Kit v2.0 kit (Qiagen, Germany). The nucleic acid of Dabie bandavirus was detected by one-step RT-qPCR assay using a commercial test kit (BioPerfectus, China). The primers (forward: GGGTCCCTGAAGGAGTTGTAAA, reverse: TGCCTTCACCAAGACTATCAATGT) and probe (FAM-TTCTGTCTTGCTGGCTCCGCGC-BHQ1) were employed to detect the conserved nucleic acid sequences in the S segment (26, 27). The reaction system of every sample was composed of 3.5 μL RNase free water, 7.5 μL RT-PCR reaction mix, 5 μL enzyme mixture, 4 μL specific primer and probe mixture, and 5 μL total nucleic acid and was prepared according to the kit instructions. The reaction procedure was 50°C for 30 min, 95°C for 5 min, 45 cycles of 95°C for 10 s, and 55°C for 40 s; fluorescence detection was performed at 55°C in the cyclic amplification step.

The complete viral genomes were amplified using the Dabie bandavirus whole-genome high-fidelity capture kit (Baiyi-tech, China). The amplified products were purified using 1.8-fold AMPure XP magnetic beads (Beckman, USA) and quantified using Qubit dsDNA HS Assay Kit (Thermofisher, USA). The sequencing library was prepared using Native Barcoding Kit 24 V14 (SQK-NBD114.24) (Oxford Nanopore Technologies, UK) according to the instructions provided in the sequencing library construction kit. The library preparation process required an input of 300 ng for each amplification product. Sequencing was performed on a GridION X5 instrument (Oxford Nanopore Technologies, UK) using FLO-MINI 114 chip.

The sequencing reads of the Dabie bandavirus were subjected to quality control and underwent whole-genome assembly using a microbial analysis platform (Baiyi-tech, China). Initially, we mapped the filtered sequencing reads to the reference genome (HB29) using the Minimap2 v2.24 software (28). Next, we eliminated duplicate reads from the BAM file with the aid of Picard v2.25.5 software. Subsequently, single-nucleotide variant (SNV) analysis was conducted using the Clair3 v1.0.4 software. Finally, we extracted the consensus sequences from the BAM file, which had already removed duplicate reads in the previous step, employing the bcftools software. Genome annotation was executed using the prokka v1.14.6 software (29), and the results were manually validated against the gbk file of the reference genome (HB29), which was sourced from the database of the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/). Multiple sequence alignment was conducted using MAFFT online version (30). MEGA 11 software (31) was utilized to find the best DNA model for the subsequent construction of maximum likelihood (ML) phylogenetic trees. The nucleotide substitution model with the lowest score of Bayesian information criterion (BIC) was selected for the following phylogenetic analysis. The model, general time reversible (GTR) with gamma-distributed substitution rate heterogeneity (G) and proportion of invariable sites (I), was selected for ML analysis for segment L. The model “GTR+G” was selected for ML analysis for both segment M and segment S. Maximum likelihood (ML) phylogenetic trees for L, M, and S segments of Dabie bandavirus were constructed using MEGA 11 software (31), with a bootstrap value of 1,000. ChiPlot online software (32) (https://www.chiplot.online/) was utilized for the visualization of phylogenetic trees. Jalview version 2.11.4.0 software (33) was used for amino acid substitutions visualization. The regression of root-to-tip distances (RTT) method with a strict molecular clock model in Treetime software (34) was utilized to estimate nucleotide substitution rates. The Nei–Gojobori method, as implemented in MEGA 11 software, was employed to compute the values of dN (non-synonymous substitution rate) and dS (synonymous substitution rate), thereby determining the dN/dS ratio. Reference sequences of A–F genotypes were downloaded from the GeneBank.

The recombination analysis of the L, M, and S segments was conducted by employing the bootscan method as implemented in the SimPlot v3.5.1 software. The parameters were set as follows: window size of 300 bp, step size of 20 bp, gap strip, 100 replicates, Kimura (two-parameter), and neighbor-joining method. Potential recombination events were validated using RDP, GENECONV, Bootscan, and 3Seq methods as provided by the recombination detection program version 4.10.1 (RDP4) (35).

The difference in the proportion of hypertensive individuals between the recovered and fatal groups was statistically analyzed using Fisher’s exact test. The concentration of cytokines in serum exhibits a normal distribution subsequent to logarithmic transformation. The differences between the two groups (fatal and recovered) were statistically analyzed using the t-test method. All statistical calculations were performed using GraphPad Prism version 9.0 software, and p <0.05 was considered significant.

From April 2023 to August 2024, real-time RT-qPCR assay was conducted for nucleic acid detection of Dabie bandavirus in serum samples from 45 individuals suspected of having severe fever with thrombocytopenia syndrome (SFTS) in Suzhou Center for Disease Control and Prevention. Ten patients, including three men and seven women, were confirmed to be infected with Dabie bandavirus. All of the 10 patients self-reported experiencing a tick bite within 2 weeks before symptom onset. Three fatalities were recorded, resulting in a case fatality rate of 30% (3/10). The basic data of the 10 cases are presented in Table 1 . The mean Ct values of the fatal group and the recovered group were 13.5 and 24.0, respectively. It is significantly different between the fatal and the recovered groups (p = 0.0049). Nine of the 10 patients had visited places where SFTS cases had been previously reported prior to the onset of their illness. The remaining case SZ05 had not departed from Suzhou in the 2 weeks before the symptoms onset, and there was no epidemiological association with other patients. She was the first recorded case in Changshu, Suzhou City, an area where no cases had been documented. The ages of the 10 patients ranged from 53 to 77, with a mean age of 66.8 years old. Three individuals suffered from hypertension in the recovered group (3/7), and all of the fatal cases had hypertension (3/3). However, the difference between the two groups did not show statistical significance by Fisher’s exact test (p = 0.20). The samples of each patient used for RT-PCR and cytokine detection were in the range of 7–10 days since the disease onset.

We categorized the Dabie bandavirus patients in this study into recovered and fatal groups. The cytokine concentrations were log-transformed, and the results are shown in Table 2 . The concentrations of CCL2, GM-CSF, IFN-γ, IL-1β, IL-6, IL-8, and TNF-α were significantly elevated in the fatal patients compared with the recovered cases, with all p-values for analyses being under 0.05. The concentration of IL-10 exhibited no statistically significant difference between the two groups (p > 0.05).

Using the HB29 Dabie bandavirus as a reference sequence, the raw data were filtered and the complete genomes were assembled. The minimum average sequencing depths for the L, M, and S segments of the 10 strains were 3,220.71, 1,557.64, and 316.28, respectively ( Table 1 ), suggesting that the assembled sequences were credible. The nucleotide identities for the L, M, and S segments were in the ranges of 95.65%–99.76%, 93.73%–99.81%, and 94.62%–99.88%, respectively. Compared with the reference strain HB29, the nucleotide identities of the three segments were in the ranges of 95.56%–96.34%, 93.61%–95.65%, and 94.50%–95.46%, respectively. The source data for the accession numbers of the reference A–F genotypes are provided in Supplementary Table S1 . The topological structures of the three phylogenetic trees were similar ( Figure 1 ). Sequences of the same genotype clustered together in the phylogenetic trees. The phylogenetic trees of the L, M, and S segments all support that SZ02, SZ04, and SZ05 Suzhou strains belong to A genotype of Dabie bandavirus; SZ06 clustered with B genotype. The SZ01, SZ03, SZ07, SZ08, SZ09, and SZ10 strains were classified within F genotype. The L, M, and S segments of each virus were genotyped identically, suggesting the absence of reassortment in the 10 Dabie bandavirus strains.

The RdRP protein was encoded by the 17–6,271 bp in the coding sequences (CDS) of the L segment. The RdRP protein of the Suzhou strains consisted of a total of 2,084 amino acids, with sequence identities ranging from 99.33% to 100%. Compared to the reference strain HB29, the RdRP protein of the 10 Suzhou strains exhibited substitutions at 32 amino acid sites, seven of which were shared (F566Y, V651I, N719S, K835R, T1038S, V1447I, and K1648R) ( Figure 2 ). All F genotype strains possessed substitution V479I in RdRP protein. The amino acid sequences of SZ02-ZXB and SZ05-YLH were identical and possessed substitution E161G. SZ04-XSF possessed an equal number of substitutions as SZ02-ZXB and SZ05-YLH, yet it exhibited differences at two distinct loci, namely, E161G was absent in SZ04-XSF but carried C1178S instead. The amino acid identity of the membrane protein encoded by the CDS region of 19–3,240 bp in the M segment ranged from 98.23% to 99.81%. R924W in the membrane protein was not observed in the 10 Suzhou strains; however, R962S substitution was identified in the 10 strains ( Figure 2 ). All of the F genotypes of the Suzhou strains (SZ01-YYL, SZ03-TXF, SZ07-DFM, SZ08-XYL, SZ09-QAY, and SZ10-ZTQ) carried characteristic substitution sites L13F, V479I, and G562S. The S segment is a double-sense RNA segment. The amino acid identities of the nucleocapsid protein encoded by the CDS region of 43–780 bp ranges from 99.19% to 100%, and the amino acid identity of the nonstructural protein encoded by the complementary strand 835–1,716 bp was in the range of 97.62%–100%. Compared with the HB29 reference strain ( Figure 2 ), a total of 12 substitutions were identified in the nonstructural proteins of the 10 Suzhou strains, of which five were common substitution sites (L197M, P207S, V223I, H245Q, and H249Y). SZ06-FLF carries two additional substitutions (M16V and N276S). The amino acid sequences of SZ04-XSF and SZ05-YLH were consistent, and no other substitutions were carried except for common substitutions. Compared with SZ04-XSF and SZ05-YLH, SZ02-ZXB carries an additional L147P mutation. The nonstructural protein of F genotype strains had identical amino acid sequences and carried additional substitutions of Q144R, K145R, E171D, and L289P.

In this study, the evolutionary rates for the L, M, and S segments were determined to be 2.67 × 10^-5 (substitutions/site/year), 1.35 × 10^-4 (substitutions/site/year), and 2.60 × 10^-4 (substitutions/site/year), respectively. At the amino acid level, the selective pressure can be described using the ratio of the rates of non-synonymous to synonymous substitutions (dN/dS). The ratio of dN/dS in the membrane protein was 0.12. The dN/dS ratio values for RNA polymerase, NP, and NS were 0.059, 0.030, and 0.10, respectively. The ratio value for the membrane protein was the highest, followed by the values of RdRP protein, NP, and NSs.

No potential recombination events were detected in segments M and S of the 10 viruses in this study. However, a potential recombination event was present in the L segment of the SZ03-TXF strain ( Figure 3 ). The finding was confirmed by RDP, GENECONV, Bootscan, and 3Seq methods as implemented in RDP4 software and supported by significant p-values of 6.66 × 10^-13, 2.87 × 10^-9, 2.16 × 10^-12, and 3.13 × 10^-12, respectively. The location of possible breakpoints were at nucleotides 795 and 1,432 in the CDS region. We extracted three fragments of 1–795 bp (L1), 796–1,431 (L2), and 1,432–6,255 bp (L3) from the CDS region of the L segment of A and F genotypes. ML phylogenetic trees were constructed for L full-length, L1, L2, and L3 fragments, respectively. In the ML trees of L, L1, and L3, SZ03 clustered with F genotype viral strains. However, in the ML tree of L2, SZ03-TXF clustered with A genotype viral strains ( Figure 4 ). The ML trees supported the results of the recombination analysis. It may be a recombinant virus with the L segment of the virus having a genotype F virus as the backbone and a genotype A fragment as the internal insertion.