98 samples of Muscovy ducks (Cairina moschata) suspected of N-MDPV infection were collected in Fujian Province. RNA and DNA extraction was performed using the Animal Total RNA/DNA Isolation Kit from TianLong (Suzhou, China). The LbCas12a protein (a member of the Cas family of proteins and comes from Lachnospiraceae bacteria), EcoRI, and XbaI endonucleases were purchased from New England Biolabs (MA, United States). The RPA kit and LFS was obtained from EZassay Ltd. (Shenzhen, China). The VP3 gene was amplified from N-MDPV genome DNA (strain FJM3, GenBank No. KR075690.1) and inserted into pcDNA3.1 with a Flag tag. A constant temperature metal bath, purchased from Gingko Biotech (Beijing, China), was set at 37°C for the experiments. Gel imaging was carried out using equipment from Gene Company Limited (MA, United States). DNA and RNA concentrations were measured with the Nanodrop ND-2000 spectrophotometer (NanoDrop Technologies, DE), and fluorescence intensity was measured using the Tecan Infinite M200 plate reader (Männedorf, Sweden).

We utilized the web-based RPA Design platform¹ to generate four primer pairs specific to the VP3 gene of N-MDPV (FJM3 strain, GenBank KR075690.1), with amplicon sizes constrained between 150 and 250 bp and primer lengths configured at 25–35 nucleotides. For Cas12a targeting, crRNA constructs were engineered to recognize sequences immediately downstream of 5’-TTTV-3′ protospacer adjacent motifs (PAMs). Each crRNA comprised: a 5′-T7 promoter sequence (UAAUACGACUCACUAUA), a Cas12a-binding scaffold (UAAUUUCUACUAAGUGUAGAU), and a variable 20–25 nt target sequence following the PAM motif. The crRNA Design interface² facilitated sequence optimization through predictive scoring algorithms. Synthesis of all oligonucleotides was commercially outsourced to EZassay Ltd. (Shenzhen, China). Complete nucleic acid sequences have been archived in Table 1.

RPA amplification was conducted using manufacturer-recommended parameters with the commercial RPA Kit. Each 20 μl reaction mixture contained 10.0 μl reaction buffer, 6.0 μl nuclease-free ddH₂O, and 0.5 μl each of 20 μM forward/reverse primers. The assembled reactions underwent thermal incubation at 37°C for 20 min in a metal bath.

The CRISPR/Cas12a detection system comprised 5 μl RPA products, 1 μl LbCas12a protein, 2 μl Cas12a reaction buffer, 1 μl crRNA, and 0.6 μl fluorophore-quencher modified ssDNA reporter (FAM-TTATT-BHQ, 4 μM) in a 20 μl reaction volume. After thermal treatment at 37°C for 15 min in a metal bath, enzymatic activity was quantified through fluorescence detection using excitation/emission wavelengths of 492/521 nm. The dual-functional probe system (FAM-TTATT-Biotin and FAM-TTATT-BHQ) was synthesized via HPLC purification by EZassay Ltd. (Shenzhen, China).

For lateral flow strip (LFS) analysis, 2 μl reaction product was combined with 78 μl dilution buffer and assessed following a 2-min incubation with LFS at ambient temperature. Results were interpreted via clearance-based detection principle: a solitary band at the control line (C) indicated positivity, whereas concurrent C and test line (T) bands confirmed negativity.

To optimize the working concentrations of Cas12a and crRNA, parameter combinationsof Cas12a (25, 50, 100, 150 and 200 nmol/L) and crRNA (50, 100, 150 and 200 nmol/L) were systematically tested, with fluorescence quantification establishing 200 nmol/L and 50 nmol/L as optimal for Cas12a and crRNA, respectively.

To investigate the sensitivity of the RPA-CRISPR/Cas12a reaction, 10-fold serial dilutions of the pcDNA3.1-N-MDPV VP3-Flag plasmid standard were used as templates for the RPA reaction, whereas ddH2O was used as a negative control. The nucleic acids extracted from multiple viruses that seriously threaten poultry health, namely, Duck adenovirus 3 (DAdV-3), Fowl adenovirus type 4 (FAdV-4), Duck astrovirus (DAstV), Duck plague virus (DPV), Duck hepatitis virus (DHV), Duck circovirus (DuCV), Duck tembusu virus (DTMUV) and Duck reovirus (DRV) were detected to evaluate the analytical specificity of the RPA-CRISPR/Cas12a assay.

GraphPad Prism 9 software (GraphPad Software, Inc.) was utilized to analyze the data. Statistical significance was evaluated through the application of two-tailed t-tests. The results were shown as mean ± standard error of the mean (SEM) based on three independent experiments, with p values lower than 0.05 being considered significant.

As schematized in Figure 1, colloidal gold-FAM antibody conjugates formed a signaling complex with dual-functional probes (5’-FAM-ssDNA-Biotin-3′). Immobilized streptavidin on the control line (C) captured the biotinylated detection complex, generating a visible red band. In positive samples containing N-MDPV DNA, Cas12a’s collateral cleavage activity severed the ssDNA reporter, preventing colloidal gold-FAM conjugates from reaching the test line (T)—manifested as C-line band only. Negative samples preserved intact probes, producing both C and T-line bands. Absence of C-line bands indicated invalid tests due to insufficient sample migration or reagent failure. This cleavage-mediated signal elimination mechanism achieved visual interpretation without instrumentation.

Proper design of primer sequences plays a critical role in RPA performance. Initial screening of three VP3-targeting primer pairs revealed successful amplification, with agarose gel electrophoresis confirming expected 250 bp amplicons across all primer groups (Figure 2A). Cas12a-LFS analysis demonstrated positive signals for all primer pairs (Figure 2B, lanes 1/2/3) with negative control remaining blank. Fluorescence quantification (Figures 2B lower panel, 2C) identified primer set #3 as the top performer through maximum signal intensity and values. This optimized primer pair was consequently chosen for subsequent assay development.

To determine optimal Cas12a and crRNA concentrations, gradient combinations of Cas12a (25–200 nmol/L) and crRNA (50–200 nmol/L) were systematically evaluated. Figure 3A demonstrates that 200 nmol/L Cas12a generated stronger fluorescence signals than 150 nmol/L, while 100 nmol/L crRNA did not outperform 50 nmol/L under identical conditions. Fluorescence quantification (Figure 3B) indicated no statistically significant differences across higher concentration groups. Consequently, 200 nmol/L Cas12a and 50 nmol/L crRNA were selected as optimal parameters for downstream assays.

The detection sensitivity of the CRISPR/Cas12a platform was evaluated using serially diluted plasmid standards (pcDNA3.1-N-MDPV VP3-Flag) ranging from 1.3 × 10¹¹ to 1.3 × 10⁻¹copies/μl. Following RPA amplification of each dilution series, CRISPR/Cas12a-LFS analysis revealed a detection threshold of 1.3 × 10⁰ copies/μl, evidenced by disappearance of the T-line band on lateral flow strips (Figure 4A) and marked differences in fluorescence intensity (Figure 4B) and relative fluorescence units (Figure 4C) between the 1.3 × 10⁰ and 1.3 × 10⁻¹ copy groups.

The specificity of the CRISPR/Cas12a assay was verified by testing eight non-target duck viruses (DAdV-3, FAdV-4, DAstV, DPV, DHV, DuCV, DTMUV and DRV). As demonstrated through lateral flow strips (Figure 5A), blue light detection (Figure 5B), and fluorescence analysis (Figure 5C), N-MDPV DNA was exclusively detected, confirming method specificity with no cross-reactivity observed.

The clinical utility of the RPA-CRISPR assay was validated using 98 duck samples. Following the detection principle outlined in Figure 1, lateral flow strip (LFS) results were quantified through grayscale analysis using ImageJ software (National Institutes of Health, Bethesda, MD, USA) of test line (T) intensities, where visible bands corresponded to positive signals. Specimens were categorized into 51 positives and 47 negatives based on grayscale thresholds (Figure 6). Comparative analysis with our previously established qPCR assay demonstrated 98.98% concordance (Table 2), confirming the method’s diagnostic reliability for N-MDPVdetection in clinical settings.