<?xml version="1.0" encoding="utf-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Vet. Sci.</journal-id>
<journal-title>Frontiers in Veterinary Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Vet. Sci.</abbrev-journal-title>
<issn pub-type="epub">2297-1769</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fvets.2024.1526600</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Veterinary Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>HA198 mutations in H9N2 avian influenza: molecular dynamics insights into receptor binding</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Zhu</surname> <given-names>Rui</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<xref ref-type="author-notes" rid="fn0002"><sup>&#x2020;</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Wu</surname> <given-names>Jie</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn0002"><sup>&#x2020;</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Chen</surname> <given-names>Ruiying</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Zhou</surname> <given-names>Mo</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/603676/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Cao</surname> <given-names>Shinuo</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/555154/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Wu</surname> <given-names>Zhi</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2600762/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Wang</surname> <given-names>Ligang</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Zhang</surname> <given-names>Lei</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>&#x002A;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2891847/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Zhu</surname> <given-names>Shanyuan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<xref ref-type="corresp" rid="c002"><sup>&#x002A;</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Jiangsu Agri-animal Husbandry Vocational College</institution>, <addr-line>Taizhou, Jiangsu</addr-line>, <country>China</country></aff>
<aff id="aff2"><sup>2</sup><institution>Jiangsu Key Laboratory for High-Tech Research and Development of Veterinary Biopharmaceuticals</institution>, <addr-line>Taizhou, Jiangsu</addr-line>, <country>China</country></aff>
<aff id="aff3"><sup>3</sup><institution>Jiangsu Co-innovation Center for Engineering Technology Research Center for Modern Animal Science and Novel Veterinary Pharmaceutic Development</institution>, <addr-line>Taizhou, Jiangsu</addr-line>, <country>China</country></aff>
<author-notes>
<fn fn-type="edited-by" id="fn0003">
<p>Edited by: Dirk Werling, Royal Veterinary College (RVC), United Kingdom</p>
</fn>
<fn fn-type="edited-by" id="fn0004">
<p>Reviewed by: Muhammad Ahsan Yaseen, Experimental Zooprophylactic Institute of Abruzzo and Molise G. Caporale, Italy</p>
<p>Matthew Turnbull, MRC-University of Glasgow Centre For Virus Research (MRC), United Kingdom</p>
</fn>
<corresp id="c001">&#x002A;Correspondence: Lei Zhang, <email>leizhang@jsahvc.edu.cn</email></corresp>
<corresp id="c002">Shanyuan Zhu, <email>jstzzsy@126.com</email></corresp>
<fn fn-type="equal" id="fn0002"><p><sup>&#x2020;</sup>These authors have contributed equally to this work</p></fn>
</author-notes>
<pub-date pub-type="epub">
<day>08</day>
<month>01</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>11</volume>
<elocation-id>1526600</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>11</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>24</day>
<month>12</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2025 Zhu, Wu, Chen, Zhou, Cao, Wu, Wang, Zhang and Zhu.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Zhu, Wu, Chen, Zhou, Cao, Wu, Wang, Zhang and Zhu</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>The H9N2 avian influenza virus is widely disseminated in poultry and poses a zoonotic threat, despite vaccination efforts. Mutations at residue 198 of hemagglutinin (HA) are critical for antigenic variation and receptor-binding specificity, but the underlying molecular mechanisms remain unclear. This study explores the molecular mechanisms by which mutations at the HA 198 site affect the antigenicity, receptor specificity, and binding affinity of the H9N2 virus.</p>
</sec>
<sec>
<title>Methods</title>
<p>Using the sequence of the A/Chicken/Jiangsu/WJ57/2012 strain, we constructed recombinant H9N2 viruses, including rWJ57, rWJ57/HA<sub>198A</sub>, and rWJ57/HA<sub>198T</sub>, using reverse genetics. These variants were analyzed through hemagglutination inhibition (HI) assays, receptor-destroying enzyme (RDE) assays, enzyme-linked immunosorbent assays (ELISA) and solid-phase receptor binding assays. Additionally, molecular dynamics (MD) simulations were performed to further dissect the atomic-level interactions between HA and sialic acids (SA).</p>
</sec>
<sec>
<title>Results</title>
<p>The results demonstrated that HA mutations significantly altered the receptor-binding properties of the virus. Specifically, rWJ57 (HA<sub>198V</sub>) exhibited 4-fold and 16-fold higher overall receptor-binding avidity compared to rWJ57/HA<sub>198A</sub> and rWJ57/HA<sub>198T</sub>, respectively. Furthermore, HA<sub>198V/T</sub> mutations significantly enhanced viral binding to human-type &#x03B1;2,6 SA receptors (<italic>p</italic>&#x202F;&#x003C;&#x202F;0.001), whereas the HA<sub>198A</sub> mutation exhibited a marked preference for avian-type &#x03B1;2,3 SA receptors (<italic>p</italic>&#x202F;&#x003C;&#x202F;0.001). Additionally, these mutations altered interactions with non-specific antibodies but not specific antibodies, with high-avidity receptor binding mutations exhibiting reduced non-specific antibody binding, suggesting a potential novel mechanism for immune evasion. MD simulations revealed HA<sub>198V/T</sub> formed stable complexes with the &#x03B1;2,6 SA, mediated by specific residues and water bridges, whereas HA<sub>198A</sub> formed stable complexes with the &#x03B1;2,3 SA. Interestingly, residue 198 interacted with the &#x03B1;2,6 SA via water bridges but had with showed minimal direct interaction with &#x03B1;2,3 SA.</p>
</sec>
<sec>
<title>Discussion</title>
<p>This study provides new insights into the molecular basis of receptor specificity, binding affinity, and antigenic drift in H9N2 viruses, highlighting the critical role of HA 198 mutations in regulating host adaptation. These findings are of great significance for H9N2 virus surveillance, vaccine development, and zoonotic transmission risk assessment.</p>
</sec>
</abstract>
<kwd-group>
<kwd>H9N2 avian influenza virus</kwd>
<kwd>mutations at residue 198</kwd>
<kwd>hemagglutinin</kwd>
<kwd>receptor binding</kwd>
<kwd>molecular dynamics simulations</kwd>
</kwd-group>
<counts>
<fig-count count="9"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="36"/>
<page-count count="14"/>
<word-count count="8562"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Veterinary Infectious Diseases</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="sec1">
<title>Introduction</title>
<p>H9N2 avian influenza virus (AIV) has been emerged as one of the most concerning low-pathogenic strains in China (<xref ref-type="bibr" rid="ref1">1</xref>), posing significant challenges to both the poultry industry and public health. This virus not only co-infects with bacterial pathogens such as <italic>Escherichia coli</italic>, <italic>Staphylococcus aureus</italic>, and <italic>Haemophilus paragallinarum</italic> (<xref ref-type="bibr" rid="ref2 ref3 ref4">2&#x2013;4</xref>), but also serves as a genetic donor for human-infecting influenza subtypes, including H3N8, H7N9, H10N3, and H10N8 (<xref ref-type="bibr" rid="ref5 ref6 ref7 ref8 ref9">5&#x2013;9</xref>). Despite China&#x2019;s ongoing H9N2 vaccination efforts for more than two decades, the virus continues to circulate widely, driven by rapid antigenic variation (<xref ref-type="bibr" rid="ref1">1</xref>). The hemagglutinin (HA) protein, particularly its receptor-binding domain (RBD), undergoes frequent mutations that affect both antigenicity and receptor specificity (<xref ref-type="bibr" rid="ref10">10</xref>). Among the various mutation sites in the HA protein, position 198 (H9 whole numbering system, corresponding to position 180 in H9 mature peptide numbering and position 190 in H3 numbering) has emerged as a critical focal point for understanding H9N2 virus evolution. This position, located near the receptor-binding domain, demonstrates a compelling pattern of amino acid substitutions that suggests strong selective pressure (<xref ref-type="bibr" rid="ref11">11</xref>).</p>
<p>Previous research has shown that H9N2 vaccine strains commonly acquire the A198V mutation after multiple passages in specific-pathogen-free (SPF) chickens, leading to a significant reduction in hemagglutinin inhibition (HI) titers and an increase in receptor-binding activity (<xref ref-type="bibr" rid="ref12 ref13 ref14">12&#x2013;14</xref>). This mutation is also linked to the virus&#x2019;s ability to evade antibody-mediated immunity, further complicating disease control efforts (<xref ref-type="bibr" rid="ref15">15</xref>, <xref ref-type="bibr" rid="ref16">16</xref>). The mutation at amino acid 198 within the HA protein, which is often found at this receptor-binding site, can also influence the binding affinity of H9N2 to sialic acid receptors (<xref ref-type="bibr" rid="ref17">17</xref>). Despite these findings, the molecular mechanisms by which mutations at the 198 site affect receptor-binding affinity remain poorly understood, underscoring the need for deeper investigation.</p>
<p>With recent advances in biological detection technologies, the precision of methods used to study virus-receptor interactions has significantly improved. Traditional techniques such as erythrocyte adsorption assays have been replaced by more advanced methods like solid-phase direct binding assays, glycan microarrays, surface plasmon resonance, and X-ray crystallography (<xref ref-type="bibr" rid="ref18 ref19 ref20">18&#x2013;20</xref>). However, while these biological detection methods provide valuable insights, they are often complemented by computational approaches such as molecular docking and molecular dynamics (MD) simulations, which can simulate interactions between viral proteins and receptors under natural conditions (<xref ref-type="bibr" rid="ref21">21</xref>, <xref ref-type="bibr" rid="ref22">22</xref>). Although these computational techniques are widely used in drug discovery, they are underutilized in research on virus-host interactions, particularly in influenza viruses.</p>
<p>This study aims to investigate the molecular basis of receptor-binding alterations caused by mutations at position 198 in the HA protein of H9N2 AIV. Using the epidemic strain A/Chicken/Jiangsu/WJ57 (H9N2, WJ57) with 198&#x202F;V as the backbone (<xref ref-type="bibr" rid="ref23">23</xref>), we employed reverse genetics to generate recombinant viruses carrying V198A and V198T mutations. The effects of these mutations on receptor-binding activity were assessed experimentally, while molecular docking and MD simulations were used to analyze the interactions between the HA protein and sialic acid receptors. Our findings reveal the molecular mechanisms by which mutations at the 198 site affect receptor-binding affinity and sialic acid specificity, contributing to a better understanding of the adaptive evolution of H9N2 AIV and its antigenic variation.</p>
</sec>
<sec sec-type="materials|methods" id="sec2">
<title>Materials and methods</title>
<sec id="sec3">
<title>Ethical compliance</title>
<p>The SPF chicken embryos were purchased from Nanjing Biology Medical Factory Qian Yuan-hao Biological Co., Ltd. All animal experiments adhered to the Guide for the Care and Use for Laboratory Animals stipulated by the Ministry of Science and Technology, and followed the animal protection and management regulations of the Jiangsu Agri-Animal Husbandry Vocational College (Approval No: jsahvc-2024-60).</p>
</sec>
<sec id="sec4">
<title>Viruses and cells culture</title>
<p>The sequences of the H9N2 vaccine strain A/chicken/Jiangsu/WJ57/2012 (WJ57), published in the GenBank database under accession numbers KP893703 to KP893708 and KJ000709 to KJ000710, were synthesized by SYNBIO Technologies (Suzhou, China). The recombinant WJ57 strain (rWJ57) was generated using reverse genetics and stored at the Jiangsu Key Laboratory for High-Tech Research and Development of Veterinary Biopharmaceuticals. COS-1 cells were purchased from ATCC (Manassas, VA, United States), cultured in Dulbecco&#x2019;s Modified Eagle&#x2019;s Medium (DMEM) (Gibco, BRL, Grand Island, United States) supplemented with 10% fetal calf serum (Gemini, Woodland, CA, United States), and incubated at 37&#x00B0;C with 5% CO&#x2082;.</p>
</sec>
<sec id="sec5">
<title>HA gene sequencing analysis</title>
<p>The frequency and prevalence of residues at amino acid position 198 in HA were analyzed by comparing 4,093 full-length H9N2 HA sequences from Chinese isolates deposited in GenBank from 2013 to 2021 (up to January 1, 2023).</p>
</sec>
<sec id="sec6">
<title>Generation of recombinant H9N2 viruses</title>
<p>Primers for site-directed mutagenesis and homologous recombination were designed based on the HA sequence of the WJ57 virus using Primer 5.0 software (Primer-E Ltd., Plymouth, United Kingdom). Overlap PCR was used to amplify the mutant HA genes, which were then inserted into the transcriptional/expression vector pHW2000 using the ClonExpress II One Step Cloning Kit (Vazyme Biotech, Nanjing, China). After transformation into DH5&#x03B1; cells, 10 colonies were randomly selected, cultured, and subjected to plasmid DNA extraction (TianGen, Beijing, China). The constructs were then sequenced (GENEWIZ, Suzhou, China) to confirm their accuracy. The primers used in the amplification process are listed in <xref ref-type="table" rid="tab1">Table 1</xref>.</p>
<table-wrap position="float" id="tab1">
<label>Table 1</label>
<caption>
<p>Primers used for construction of recombinant plasmids.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="top">Primer</th>
<th align="left" valign="top">Primer sequence (5&#x2032;&#x2013;3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn1"><sup>a</sup></xref>pHW-HA-F</td>
<td align="left" valign="middle">gtcgacctccgaagttgggggggAGCAAAAGCAGGGGAATTTC</td>
</tr>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn1"><sup>a</sup></xref>pHW-HA-R</td>
<td align="left" valign="middle">ggcattttgggccgccgggttattAGTAGAAACAAGGGTGTTTTTGCC</td>
</tr>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn2"><sup>b</sup></xref>V198A-F</td>
<td align="left" valign="middle">CCACCGATACT<underline>GCA</underline>CAGACAAATCT</td>
</tr>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn2"><sup>b</sup></xref>V198A-R</td>
<td align="left" valign="middle">AGATTTGTCTG<underline>TGC</underline>AGTATCGGTGG</td>
</tr>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn2"><sup>b</sup></xref>V198T-F</td>
<td align="left" valign="middle">CCACCGATACT<underline>ACG</underline>CAGACAAATCT</td>
</tr>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn2"><sup>b</sup></xref>V198T-R</td>
<td align="left" valign="middle">AGATTTGTCTG<underline>CGT</underline>AGTATCGGTGG</td>
</tr>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn3"><sup>c</sup></xref>pHWvector-F</td>
<td align="left" valign="middle">ACCCGGCGGCCCAAAATGCC</td>
</tr>
<tr>
<td align="left" valign="middle"><xref ref-type="table-fn" rid="tfn3"><sup>c</sup></xref>pHWvector-R</td>
<td align="left" valign="middle">CCCCAACTTCGGAGGTCGAC</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn1">
<label>a</label>
<p>Primers employed for pHW2000 construction using a binucleotide cloning strategy to amplify the full-length cDNA of the HA gene. Lowercase letters denote the homologous arm sequences from the pHW2000 vector.</p>
</fn>
<fn id="tfn2">
<label>b</label>
<p>Primers used for site-specific mutations in the HA gene, with sequences marked by a single underline indicating the nucleotides subjected to mutation.</p>
</fn>
<fn id="tfn3">
<label>c</label>
<p>Primers utilized for amplifying the linearized pHW2000 vector.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>As described by Zhu et al. (<xref ref-type="bibr" rid="ref14">14</xref>), the H9N2 recombinant viruses, rWJ/HA<sub>198A</sub> and rWJ/HA<sub>198T</sub>, were identified and rescued using the rWJ57 strain backbone. Briefly, a total of 2.4&#x202F;&#x03BC;g of eight plasmids, mixed in equal amounts, was added to 100&#x202F;&#x03BC;L of Opti-MEM medium (Gibco, BRL, Grand Island, United States). Then, 5&#x202F;&#x03BC;L of X-treme GENE HP DNA Transfection Reagent (Roche, Basel, Switzerland) was introduced to the mixture, which was incubated at room temperature for 15&#x202F;min. The mixture was then added to COS-1 cells cultured in 12-well plates at 70&#x2013;80% confluency. The cells were incubated at 37&#x00B0;C with 5% CO&#x2082; for 24&#x202F;h, after which 2&#x202F;&#x03BC;g/mL of TPCK-trypsin (Sigma, St. Louis, MO, United States) was added to each well. Following a 30-h transfection period, the supernatants were collected and used to propagate the virus in 10-day-old specific pathogen-free (SPF) embryonated chicken eggs. Finally, the rescued virus was subjected to an HA assay, and the HA genes were sequenced at GENEWIZ (Suzhou, China) to confirm the accuracy of the intended mutations.</p>
</sec>
<sec id="sec7">
<title>Antisera preparation</title>
<p>Antisera for the rWJ57 strain were prepared as previously described (<xref ref-type="bibr" rid="ref11">11</xref>, <xref ref-type="bibr" rid="ref14">14</xref>). Briefly, 3-week-old SPF chickens were immunized twice by subcutaneous injection of 0.3&#x202F;mL of an oil-emulsified, inactivated whole-virus vaccine of the rWJ57 strain, which was inactivated by adding 0.2% formalin (<italic>v</italic>/v) for 24&#x202F;h at 37&#x00B0;C. Antisera were collected from the chickens 2&#x202F;weeks after the booster vaccination. The negative sera used were collected from non-immunized SPF chickens as a pre-immunized control.</p>
</sec>
<sec id="sec8">
<title>Hemagglutination inhibition assay</title>
<p>Antisera for the rWJ57 strain were treated with cholera filtrate (Sigma-Aldrich, St. Louis, MO, United States) to remove nonspecific hemagglutination inhibitors before conducting the HI assay on three recombinant viruses: rWJ57, rWJ/HA<sub>198A</sub> and rWJ/HA<sub>198T</sub>. The assay was performed using 4 hemagglutination units (HAU) of H9N2 and 1% (<italic>v</italic>/v) chicken erythrocytes (<xref ref-type="bibr" rid="ref14">14</xref>, <xref ref-type="bibr" rid="ref24">24</xref>).</p>
</sec>
<sec id="sec9">
<title>Enzyme-linked immunosorbent assay</title>
<p>The ELISA assay was conducted according to previously described methods (<xref ref-type="bibr" rid="ref14">14</xref>, <xref ref-type="bibr" rid="ref24">24</xref>). Sucrose gradient-purified viruses&#x2014;rWJ57, rWJ/HA<sub>198A</sub> and rWJ/HA<sub>198T</sub>&#x2014;were diluted in PBS and seeded into Nunc-Immuno MaxiSorp 96-well plates (Corning, NY, United States) at a concentration of 16 HAU per well. Following overnight incubation at 4&#x00B0;C, the wells were blocked with PBS-nonfat dry milk (Beyotime, Shanghai, China). Serial two-fold dilutions of antisera against the rWJ57 virus in chickens were prepared using PBS containing 0.05% Tween 20 and then added to the wells, followed by a 2-h incubation at 37&#x00B0;C. After washing, a goat anti-chicken horseradish peroxidase antibody (Bioss, Beijing, China) was added, and the plates were incubated for 1.5&#x202F;h at 37&#x00B0;C. Finally, TMB (3,3&#x2032;,5,5&#x2032;-tetramethylbenzidine) substrate (Beyotime, Shanghai, China) was added, and the reaction was stopped using TMB stop substrate (Beyotime, Shanghai, China).</p>
<p>Absorbance was measured at 450&#x202F;nm using an automated ELISA plate reader (model EL311SX; Biotek, Winooski, VT, United States). The area under the curve (AUC) for each virus was calculated using GraphPad Prism 9.5 software (San Diego, CA, USA), based on virus-antibody binding above the corresponding negative control.</p>
</sec>
<sec id="sec10">
<title>Receptor-destroying enzyme assay and solid-phase binding assay</title>
<p>The RDE assay was performed as previously described (<xref ref-type="bibr" rid="ref14">14</xref>, <xref ref-type="bibr" rid="ref25">25</xref>). Chicken erythrocytes were treated with &#x03B1;2-3,6,8 neuraminidase (New England Biolabs, Beverly, MA, United States) through 11 two-fold serial dilutions starting from a maximum concentration of 1,000&#x202F;U/mL for 1&#x202F;h at 37&#x00B0;C. After washing with PBS, 1% (<italic>v</italic>/v) solutions of the treated erythrocytes were added to 4 HAU of each virus (determined using untreated chicken erythrocytes). Agglutination was measured after 1&#x202F;h of incubation.</p>
<p>To further evaluate the receptor-binding properties of the H9N2 viruses, we performed solid-phase binding assays using the synthetic sialyl glycopolymers Neu5Ac 2&#x2013;3 Gal&#x03B2;1-4 GlcNAc (3&#x2032;SLN)-PAA-biotin and Neu5Ac 2&#x2013;6 Gal&#x03B2;1-4 GlcNAc (6&#x2032;SLN)-PAA-biotin (GlycoTech), based on the method described by Zhang et al. (<xref ref-type="bibr" rid="ref26">26</xref>, <xref ref-type="bibr" rid="ref27">27</xref>). The glycan analogs were serially diluted in PBS and added to streptavidin-coated 96-well plates (Pierce). Plates were blocked with PBS containing 2% skim milk, and 64 HA units of virus were applied per well, followed by chicken antiserum as the primary antibody. Detection was done by adding HRP-conjugated rabbit anti-chicken IgG and tetramethylbenzidine substrate, with the reaction stopped by 1&#x202F;M H<sub>2</sub>SO<sub>4</sub>. Absorbance at 450&#x202F;nm was measured, and all samples were tested in triplicate.</p>
</sec>
<sec id="sec11">
<title>Molecular docking and dynamics simulation</title>
<p>The structures of HA were predicted using the Swiss-Model and validated by Ramachandran plot analysis, with 98.2% of residues in favored regions. The protonation state of all compounds was set to pH 7.4, and 3D structures were generated using Open Babel (<xref ref-type="bibr" rid="ref28">28</xref>). AutoDock Tools (ADT3) were used to prepare and parameterize the receptor protein and ligands. Docking grid files were constructed with AutoGrid from the sitemap, and docking simulations were performed using AutoDock Vina (1.2.0) (<xref ref-type="bibr" rid="ref29">29</xref>, <xref ref-type="bibr" rid="ref30">30</xref>). The optimal pose was selected for protein-ligand interaction analysis. Finally, protein-ligand interaction figures were generated using PyMOL. The ligands used in this study were &#x03B1;2,6 sialic acid (SA) (6&#x2032;SLN, CAS no. 501427&#x2013;93-6) and &#x03B1;2,3 SA (3&#x2032;SLN, CAS no. 501427&#x2013;92-5).</p>
<p>MD simulations were conducted using the non-commercial version 2022.1 of Desmond/Maestro software.<xref ref-type="fn" rid="fn0001"><sup>1</sup></xref> TIP3P water molecules were added to the systems, which were neutralized with a 0.15&#x202F;M NaCl solution. After system minimization and relaxation, a 100-ns production simulation was performed using an isothermal-isobaric ensemble at 300&#x202F;K and 1&#x202F;bar. Trajectory coordinates were recorded every 100&#x202F;ps throughout the simulation. Molecular dynamics analysis was performed using the Simulation Interaction Diagram feature of Desmond software.</p>
</sec>
<sec id="sec12">
<title>Statistical analysis</title>
<p>Data normality was verified using Shapiro&#x2013;Wilk test. For experiments comparing both virus types and concentrations (receptor binding assays), statistical analysis was performed using two-way ANOVA with Holm-Bonferroni correction for multiple comparisons to control family-wise error rate. For single variable comparisons (HI titers and antibody binding assays), pairwise comparisons were made using Student&#x2019;s <italic>t</italic>-test. All statistical analyses were conducted in GraphPad Prism 9.5, with adjusted <italic>p</italic>-values less than 0.05 considered statistically significant. All experiments were performed with three independent biological replicates (<italic>n</italic>&#x202F;=&#x202F;3), with technical duplicates for each biological replicate to ensure measurement reliability. The mean values from technical duplicates were used for statistical analysis. For molecular dynamics simulations, each system was simulated for 100&#x202F;ns and repeated three times with different initial velocities to ensure conformational sampling adequacy.</p>
</sec>
</sec>
<sec sec-type="results" id="sec13">
<title>Results</title>
<sec id="sec14">
<title>Analysis of the prevalence of various residues at the position 198</title>
<p>An analysis of 4,093 avian H9N2 AIV HA protein sequences at position 198, published in GenBank from 2013 to 2021, revealed three prevalent residues: 198&#x202F;T, 198A, and 198&#x202F;V. The most frequent was 198&#x202F;T, representing 72.4% of the sequences, followed by 198A (20.7%), while 198&#x202F;V was the least common (6.9%) (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Between 2013 and 2015, the frequency of the 198&#x202F;T mutation steadily increased, reaching over 80% from 2015 to 2017. However, from 2017 to 2020, the prevalence of 198&#x202F;T steadily declined, dropping to 70% in 2021, while the 198&#x202F;V showed an inverse trend, rising in frequency and becoming dominant by 2021 (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). The 198A frequency remained stable (10&#x2013;15%) throughout the study period, with minor fluctuations.</p>
<fig position="float" id="fig1">
<label>Figure 1</label>
<caption>
<p>Analysis of amino acid mutations at position 198 in the HA protein of H9N2 AIV. <bold>(A)</bold> Distribution of HA protein variants among 4,093 analyzed sequences. <bold>(B)</bold> Temporal trends in the prevalence of HA protein variants 198A, 198&#x202F;T, and 198&#x202F;V from 2013 to 2021. <bold>(C)</bold> HI titers of different recombinant viruses (rWJ57 (HA<sub>198V</sub>), rWJ/HA<sub>198T</sub>, and rWJ/HA<sub>198A</sub>) against anti-rWJ57 sera. Data are presented as mean&#x202F;&#x00B1;&#x202F;SD from three independent biological replicates (<italic>n</italic>&#x202F;=&#x202F;3), with technical duplicates for each replicate. Statistical analysis was performed using Student&#x2019;s <italic>t</italic>-test, &#x002A;&#x002A;<italic>p</italic>&#x202F;&#x003C;&#x202F;0.001.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g001.tif"/>
</fig>
</sec>
<sec id="sec15">
<title>Rescue and identification of recombinant viruses</title>
<p>Following transfection of COS-1 cells with eight plasmids encoding the full H9N2 genome, the supernatants were inoculated into SPF chicken embryos. After 90&#x202F;h, HA titers were measured in the allantoic fluid, and recombinant viruses with HA titers &#x2265;2<sup>2</sup> were considered positive. The HA titers for rWJ/HA<sub>198A</sub> and rWJ/HA<sub>198T</sub> viruses were 2<sup>6</sup> and 2<sup>8</sup>, respectively. Sequencing confirmed that the HA genes contained the desired mutations at positions 591&#x2013;594, while all other gene segments (PB2, PB1, PA, NP, NA, M, and NS) were identical to the parental rWJ57 strain.</p>
</sec>
<sec id="sec16">
<title>Mutations at HA position 198 as a key modulator of HI titers</title>
<p>To investigate how mutations at residue 198 influence the antigenic properties of the virus, HI assays were performed using sera from chickens infected with rWJ57. The rWJ57 virus carrying the 198&#x202F;V mutation showed a three-fold lower HI titer compared to rWJ/HA<sub>198A</sub> and rWJ/HA<sub>198T</sub> (<xref ref-type="fig" rid="fig1">Figure 1C</xref>), suggesting that residue 198 plays a critical role in promoting viral escape from a polyclonal antibody binding.</p>
</sec>
<sec id="sec17">
<title>Mutations at HA position 198 affects the binding affinities to non-specific antibodies</title>
<p>To explore the underlying mechanisms, ELISA assays were conducted to measure the binding affinities of specific and non-specific antibodies. The results demonstrated that the rWJ57 virus had significantly lower affinity for non-specific antibodies compared to rWJ/HA<sub>198A</sub> (<italic>p</italic>&#x202F;&#x003C;&#x202F;0.001), while rWJ/HA<sub>198T</sub> displayed significantly higher affinity than both rWJ57 and rWJ/HA<sub>198A</sub> (<italic>p</italic>&#x202F;&#x003C;&#x202F;0.001) (<xref ref-type="fig" rid="fig2">Figures 2A</xref>,<xref ref-type="fig" rid="fig2">B</xref>). However, no significant differences were observed in the binding affinities of the three viruses to specific antibodies (<xref ref-type="fig" rid="fig2">Figures 2A</xref>,<xref ref-type="fig" rid="fig2">C</xref>).</p>
<fig position="float" id="fig2">
<label>Figure 2</label>
<caption>
<p>Characterization of recombinant H9N2 viruses with mutations at HA position 198. <bold>(A)</bold> ELISA-based antibody binding curves for negative sera (dotted lines) and anti-rWJ57 virus sera (solid lines) against three recombinant viruses. Negative control sera were collected from age-matched SPF chickens before immunization. Background signals from no-serum controls were subtracted from all measurements. <bold>(B)</bold> Area under the curve (AUC) of non-specific antibody binding and <bold>(C)</bold> specific antibody binding to recombinant viruses, measured by ELISA. The AUC values were calculated using GraphPad Prism 9.5 based on the binding curves in <bold>(A)</bold>, where non-specific binding represents the AUC of negative sera, and specific binding represents the difference between anti-rWJ57 sera and negative sera AUC values. <bold>(D)</bold> Receptor binding avidity of recombinant viruses determined by RDE assay. <bold>(E)</bold> Binding affinity of recombinant viruses to 6&#x2019;SLN and <bold>(F)</bold> 3&#x2019;SLN receptor analogs. rWJ57 virus (orange), rWJ/HA<sub>198A</sub> virus (green), and rWJ/HA<sub>198T</sub> virus (blue) were used. All experiments were performed with three independent biological replicates (<italic>n</italic>&#x202F;=&#x202F;3), with technical duplicates for each biological replicate. Data points represent the mean&#x202F;&#x00B1;&#x202F;SD of the biological replicates. Statistical analysis was performed using two-way ANOVA with Holm-Bonferroni correction. &#x002A;&#x002A;<italic>p</italic>&#x202F;&#x003C;&#x202F;0.01, &#x002A;&#x002A;&#x002A;<italic>p</italic>&#x202F;&#x003C;&#x202F;0.001; NS, not significant; SLN, sialylated glycan analogs.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g002.tif"/>
</fig>
</sec>
<sec id="sec18">
<title>Mutations at HA position 198 influences the receptor binding activity and specificity</title>
<p>To assess how receptor binding activity affects HI titers, chicken erythrocytes were treated with &#x03B1;2-3,6,8 neuraminidase to modify sialic acid receptors. Stronger receptor binding was reflected by the virus&#x2019;s ability to agglutinate erythrocytes treated with higher concentrations of neuraminidase. Results showed that rWJ57 exhibited receptor binding activity four-fold higher than rWJ/HA<sub>198A</sub> and 16-fold higher than rWJ/HA<sub>198T</sub> (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). These findings suggest that the mutation at position 198 alters receptor binding, which primarily drives HI titer fluctuations in the H9N2 virus, rather than specific antibodies.</p>
<p>While the RDE assay demonstrates the virus&#x2019;s binding activity for sialic acids (both &#x03B1;2-3 SA and &#x03B1;2-6 SA), it cannot differentiate the virus&#x2019;s affinity for specific sialic acid types. To further explore the effect of mutations at HA position 198 on the affinity for specific sialic acids, we conducted a solid-phase binding assay. The results revealed distinct receptor preferences among H9N2 virus variants with mutations at HA position 198. For 6&#x2019;SLN binding, rWJ57 demonstrated the highest binding affinity across all tested concentrations (0.313&#x2013;10&#x202F;&#x03BC;g/mL), followed by rWJ/HA<sub>198T</sub>, while rWJ/HA<sub>198A</sub> showed the lowest affinity. The differences in binding affinity among the three viruses were statistically significant at each tested concentration (<italic>p</italic> &#x003C;&#x202F;0.001) (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). Conversely, for 3&#x2019;SLN binding, rWJ/HA<sub>198A</sub> exhibited the strongest binding affinity, followed by rWJ57, while rWJ/HA<sub>198T</sub> showed the lowest affinity. Similarly, significant differences in binding affinity were observed among all three viruses at each tested concentration (<italic>p</italic> &#x003C;&#x202F;0.001) (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). These findings indicate that the amino acid at position 198 of the HA protein plays a crucial role in determining receptor binding specificity.</p>
</sec>
<sec id="sec19">
<title>Mutations at HA position 198 alter in HA protein-sialic acid receptor interactions</title>
<p>The &#x03B1;2,6 SA formed five hydrogen bond interactions with the HA protein of the rWJ57 strain (HA<sub>198V</sub> protein) at amino acid positions 109, 147, 201, 235, and 236, with a binding energy of &#x2212;6.1&#x202F;kcal/mol (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). It also formed five hydrogen bond interactions with the rWJ/HA<sub>198T</sub> HA protein (HA<sub>198T</sub> protein) at positions 109, 147, 148, 233, and 236, with a binding energy of &#x2212;5.9&#x202F;kcal/mol (<xref ref-type="fig" rid="fig3">Figure 3B</xref>), and four interactions with the rWJ/HA<sub>198A</sub> HA protein (HA<sub>198A</sub> protein) at positions 145, 147, 235, and 236, with a binding energy of &#x2212;6.0&#x202F;kcal/mol (<xref ref-type="fig" rid="fig3">Figure 3C</xref>).</p>
<fig position="float" id="fig3">
<label>Figure 3</label>
<caption>
<p>Molecular docking analysis of 6&#x2019;SLN and 3&#x2019;SLN with HA proteins of the recombinant viruses. <bold>(A&#x2013;C)</bold> Docking results of 6&#x2019;SLN with HA proteins: <bold>(A)</bold> HA<sub>198V</sub>, <bold>(B)</bold> HA<sub>198T</sub>, and <bold>(C)</bold> HA<sub>198A</sub>. <bold>(D&#x2013;F)</bold> Docking results of 3&#x2019;SLN with HA proteins: <bold>(D)</bold> HA<sub>198V</sub>, <bold>(E)</bold> HA<sub>198T</sub>, and <bold>(F)</bold> HA<sub>198A</sub>. Each panel displays the overall structure of the HA protein (left) with a zoomed-in view of the binding site (right). The HA protein is represented as a slate cartoon model. Ligands (6&#x2019;SLN and 3&#x2019;SLN) are shown as cyan sticks, with key interacting residues highlighted as magenta sticks. Nonpolar hydrogen atoms are omitted for clarity. Hydrogen bonds, ionic interactions, and hydrophobic interactions are depicted as yellow, magenta, and green dashed lines, respectively. Tables below each structure summarize the hydrogen bond interactions and binding energies. Hydrogen bond distances are indicated in &#x00C5;ngstroms (&#x00C5;).</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g003.tif"/>
</fig>
<p>The &#x03B1;2,3 SA formed six hydrogen bond interactions with the HA<sub>198V</sub> protein at amino acid positions 109, 147, 148, 233, 235, and 236, with a binding energy of &#x2212;5.6&#x202F;kcal/mol (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). It also formed six interactions with the HA<sub>198T</sub> protein at positions 109, 147, 198, 233, 235, and 236, with a binding energy of &#x2212;5.5&#x202F;kcal/mol (<xref ref-type="fig" rid="fig3">Figure 3E</xref>), and three interactions with the HA<sub>198A</sub> protein at positions 109, 145, and 147, with a binding energy of &#x2212;5.5&#x202F;kcal/mol (<xref ref-type="fig" rid="fig3">Figure 3F</xref>).</p>
<p>These results indicate that alterations at amino acid position 198 of the HA protein directly modify the microstructure of the receptor-binding pocket, leading to changes in the binding sites, interaction forces, torque, and binding energy with sialic acid receptors, ultimately influencing the interactions between the HA protein and the receptors.</p>
</sec>
<sec id="sec20">
<title>MD simulation</title>
<p>To explore the molecular mechanisms by which mutations at residue 198 influence receptor binding affinity and viral tropism, molecular dynamics (MD) simulations were employed to evaluate the structural and dynamic behavior of the HA-sialic acid receptor complexes. The simulation focused on how the HA<sub>198V</sub>, HA<sub>198T</sub>, and HA<sub>198A</sub> mutations alter the interaction between the HA protein and both &#x03B1;2,6 SA and &#x03B1;2,3 SA. The key metrics analyzed were root mean square deviation (RMSD), root mean square fluctuation (RMSF), hydrogen bonding patterns, and binding stability, which provided insights into conformational changes and receptor affinity.</p>
</sec>
<sec id="sec21">
<title>MD simulation demonstrates stable binding stability between HA198V and &#x03B1;2,6 SA</title>
<p>During the simulation, the HA protein maintained a stable interaction with the &#x03B1;2,6 SA. The RMSD values for the HA<sub>198V</sub> protein and the &#x03B1;2,6 SA stabilized around 7.0&#x202F;&#x00C5; and 9.0&#x202F;&#x00C5;, respectively, after initial fluctuations (<xref ref-type="fig" rid="fig4">Figure 4A</xref>), suggesting that the complex underwent minor adjustments before reaching a stable conformation. RMSF analysis (<xref ref-type="fig" rid="fig4">Figures 4B</xref>,<xref ref-type="fig" rid="fig4">C</xref>) revealed minimal fluctuations in key binding residues, particularly Tyr109, Thr147, Met235, and Gly236, highlighting their crucial role in maintaining the interaction&#x2019;s stability.</p>
<fig position="float" id="fig4">
<label>Figure 4</label>
<caption>
<p>MD simulation results for 6&#x2019;SLN and HA<sub>198V</sub>. <bold>(A)</bold> RMSD plot of HA<sub>198V</sub> (blue) and 6&#x2019;SLN (red) over 100&#x202F;ns of simulation time. <bold>(B)</bold> RMSF plot of HA<sub>198V</sub> residues, with green bars indicating regions of high fluctuation. <bold>(C)</bold> RMSF plot of 6&#x2019;SLN atoms. <bold>(D)</bold> Interaction analysis between 6&#x2019;SLN and HA<sub>198V</sub>. Bar graph shows the frequency of different types of interactions (hydrogen bonds, hydrophobic interactions, ionic interactions, and water bridges) for specific residues. The red arrow indicates the mutation site 198&#x202F;V. <bold>(E)</bold> 2D interaction diagram of 6&#x2019;SLN with surrounding amino acid residues of HA<sub>198V</sub>. Dashed lines represent different types of interactions.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g004.tif"/>
</fig>
<p>Thr147 played a pivotal role in the binding process, forming hydrogen bonds with a high formation frequency of 118%, supported by secondary water bridge interactions with a frequency of 30% (<xref ref-type="fig" rid="fig4">Figures 4D</xref>,<xref ref-type="fig" rid="fig4">E</xref>). Other residues, including Tyr109, Asn145, Trp161, and Gly236, also contributed through hydrophobic and ionic interactions, further stabilizing the complex. The &#x03B1;2,6 SA itself formed several intramolecular hydrogen bonds, which contributed to its conformational stability (<xref ref-type="fig" rid="fig4">Figure 4E</xref>).</p>
<p>These findings suggest that the HA<sub>198V</sub> mutation significantly enhances the binding affinity between the HA protein and &#x03B1;2,6 SA. The combination of hydrogen bonds, hydrophobic interactions, and water bridges forms a robust network that stabilizes the HA -&#x03B1;2,6 SA complex.</p>
</sec>
<sec id="sec22">
<title>MD simulation reveals enhanced binding affinity between HA198T and &#x03B1;2,6 SA</title>
<p>In the MD simulation of the HA<sub>198T</sub> protein complexed with the &#x03B1;2,6 SA, the RMSD of the HA<sub>198T</sub> protein stabilized at approximately 9.0&#x202F;&#x00C5;, while the &#x03B1;2,6 SA&#x2019;s RMSD stabilized at around 16&#x202F;&#x00C5; after initial fluctuations (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). These RMSD values indicate that both the protein and &#x03B1;2,6 SA underwent structural adjustments before reaching a stable conformation.</p>
<fig position="float" id="fig5">
<label>Figure 5</label>
<caption>
<p>MD simulation results for 6&#x2019;SLN binding to HA<sub>198T</sub>. <bold>(A)</bold> RMSD of HA<sub>198T</sub> atoms (blue) and 6&#x2019;SLN atoms (red) over 100&#x202F;ns simulation time. <bold>(B)</bold> RMSF of HA<sub>198T</sub> residues. Green bars indicate residues involved in 6&#x2019;SLN binding. <bold>(C)</bold> RMSF of 6&#x2019;SLN atoms over the simulation trajectory. <bold>(D)</bold> Interaction fractions of key residues with the 6&#x2019;SLN, categorized by interaction type. The 198&#x202F;T mutation site is indicated with a red arrow. <bold>(E)</bold> 2D representation of key interactions between 6&#x2019;SLN and HA<sub>198T</sub> residues at the end of the simulation. Hydrogen bonds are shown as purple dashed lines.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g005.tif"/>
</fig>
<p>Further analysis using RMSF revealed that the HA<sub>198T</sub> protein exhibited relatively low fluctuations, indicating minimal conformational changes during the binding process (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). In contrast, the &#x03B1;2,6 SA displayed higher RMSF values, highlighting its dynamic and flexible nature (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). This flexibility likely facilitated binding interactions with the protein, contributing to the formation of a more stable complex.</p>
<p>A total of 30 interactions were identified between the HA<sub>198T</sub> protein and the &#x03B1;2,6 SA, with Thr147 playing a critical role, showing a hydrogen bond formation frequency of 92% (<xref ref-type="fig" rid="fig5">Figures 5D</xref>,<xref ref-type="fig" rid="fig5">E</xref>). Other residues, such as Asn145 and Gly233, also contributed significantly to the stability of the complex, reinforcing the hydrogen bonding network. Additionally, the &#x03B1;2,6 SA formed several intramolecular hydrogen bonds, further stabilizing its conformation and strengthening the overall &#x03B1;2,6 SA-protein complex (<xref ref-type="fig" rid="fig5">Figure 5E</xref>).</p>
<p>Overall, the HA<sub>198T</sub> mutation enhances the binding affinity between the HA protein and the &#x03B1;2,6 SA. The hydrogen bond network, particularly involving Thr147, is crucial in stabilizing the complex. The flexibility of the &#x03B1;2,6 SA, along with its intramolecular interactions, plays a significant role in the stability and dynamic behavior of the &#x03B1;2,6 SA-protein interaction. These findings provide valuable insights into the molecular mechanisms underlying the increased receptor binding affinity due to the HA<sub>198T</sub> mutation, with potential implications for future vaccine or antiviral drug development.</p>
</sec>
<sec id="sec23">
<title>MD simulation reveals unstable binding and dissociation between HA198A and &#x03B1;2,6 SA</title>
<p>During the molecular dynamics simulation, the HA<sub>198A</sub> protein exhibited significant fluctuations. The RMSD of HA<sub>198A</sub> eventually stabilized at approximately 4.0&#x202F;&#x00C5;, whereas the RMSD of the &#x03B1;2,6 SA fluctuated substantially, finally stabilizing near 90&#x202F;&#x00C5; (<xref ref-type="fig" rid="fig6">Figure 6A</xref>).</p>
<fig position="float" id="fig6">
<label>Figure 6</label>
<caption>
<p>MD simulation results for 6&#x2019;SLN and HA<sub>198A</sub>. <bold>(A)</bold> Time evolution of HA<sub>198A</sub> RMSD (blue) and 6&#x2019;SLN RMSD (red) during the 100&#x202F;ns simulation. <bold>(B)</bold> RMSF of HA<sub>198A</sub> residues. Green bars indicate regions of high flexibility. <bold>(C)</bold> RMSF of 6&#x2019;SLN atoms, showing stable binding throughout the simulation. <bold>(D)</bold> Fraction of different types of interactions (hydrogen bonds, hydrophobic interactions, ionic interactions, and water bridges) between the HA<sub>198A</sub> and 6&#x2019;SLN for key residues. The red arrow indicates residue 198A. <bold>(E)</bold> 2D interaction diagram of the ligand with surrounding amino acid residues, showing hydrogen bonds, hydrophobic interactions, and water-mediated interactions.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g006.tif"/>
</fig>
<p>While RMSF of the HA<sub>198A</sub> protein remained relatively small, the RMSF of the &#x03B1;2,6 SA was notably larger (<xref ref-type="fig" rid="fig6">Figures 6B</xref>,<xref ref-type="fig" rid="fig6">C</xref>), indicating greater movement of the &#x03B1;2,6 SA during the simulation. Despite the formation of 29 interactions, the &#x03B1;2,6 SA eventually moved away from the active binding pocket (<xref ref-type="fig" rid="fig6">Figures 6D</xref>,<xref ref-type="fig" rid="fig6">E</xref>).</p>
<p>These results suggest that the initial binding conformation between the &#x03B1;2,6 SA and the HA<sub>198A</sub> protein was unstable, characterized by weak binding affinity. During the simulation, the &#x03B1;2,6 SA ultimately dissociated from the binding pocket, failing to maintain a stable interaction with the HA protein.</p>
</sec>
<sec id="sec24">
<title>MD simulation reveals moderate binding affinity between HA198V and &#x03B1;2,3 SA after initial instability</title>
<p>During the MD simulation, the RMSD of the HA<sub>198V</sub> protein stabilized at approximately 8.0&#x202F;&#x00C5;, while the RMSD of the &#x03B1;2,3 SA, after some fluctuations, settled around 10.0&#x202F;&#x00C5; (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). The RMSF values for the amino acid residues interacting with the &#x03B1;2,3 SA, highlighted by green lines in <xref ref-type="fig" rid="fig7">Figure 7B</xref>, were relatively low, indicating minimal conformational changes in these regions during the binding process. In contrast, the RMSF values for the atoms in the &#x03B1;2,3 SA were relatively high, reflecting substantial fluctuations in the &#x03B1;2,3 SA &#x2018;s structure (<xref ref-type="fig" rid="fig7">Figure 7C</xref>). These findings suggest that the initial binding conformation was unstable, though the system eventually achieved a more stable conformation after significant fluctuations.</p>
<fig position="float" id="fig7">
<label>Figure 7</label>
<caption>
<p>MD simulation results for 3&#x2019;SLN and HA<sub>198V</sub>. <bold>(A)</bold> RMSD plot of HA<sub>198V</sub> (blue) and 3&#x2019;SLN (red) over 100&#x202F;ns simulation time. <bold>(B)</bold> RMSF plot of HA<sub>198V</sub> residues. Green bars indicate key binding site residues. <bold>(C)</bold> RMSF plot of 3&#x2019;SLN atoms. <bold>(D)</bold> Interaction fraction analysis of HA<sub>198V</sub>-3&#x2019;SLN contacts, categorized by interaction type. <bold>(E)</bold> 2D representation of the 3&#x2019;SLN structure with key interacting residue (Phe408) highlighted.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g007.tif"/>
</fig>
<p>The HA<sub>198V</sub> protein and the &#x03B1;2,3 SA formed 41 interactions, with Phe408 playing a pivotal role by forming hydrogen bonds with a 31% frequency, highlighting its importance in the binding process. Other interaction sites contributed via hydrogen bonds and water bridges, although these interactions were comparatively weak (<xref ref-type="fig" rid="fig7">Figures 7D</xref>,<xref ref-type="fig" rid="fig7">E</xref>). Additionally, the &#x03B1;2,3 SA formed several intramolecular hydrogen bonds that helped stabilize its conformation during binding (<xref ref-type="fig" rid="fig7">Figure 7E</xref>).</p>
<p>Overall, these results indicate that the HA<sub>198V</sub> protein and &#x03B1;2,3 SA optimized their binding conformation through the simulation, achieving a more stable structure with moderate binding affinity.</p>
</sec>
<sec id="sec25">
<title>MD simulation confirms weak binding characteristics between HA198T and &#x03B1;2,3 SA</title>
<p>During the MD simulation, the HA<sub>198T</sub> protein exhibited minimal fluctuations, with its RMSD stabilizing at approximately 6&#x202F;&#x00C5;. In contrast, the RMSD of the &#x03B1;2,3 SA displayed significant variability before eventually stabilizing at around 30&#x202F;&#x00C5; (<xref ref-type="fig" rid="fig8">Figure 8A</xref>). The RMSF values for the HA<sub>198T</sub> protein were relatively low, indicating limited conformational changes, while the &#x03B1;2,3 SA exhibited much higher RMSF values, suggesting considerable fluctuations in the &#x03B1;2,3 SA&#x2019;s structure throughout the simulation (<xref ref-type="fig" rid="fig8">Figures 8B</xref>,<xref ref-type="fig" rid="fig8">C</xref>). This pattern suggests that the initial conformation of the HA<sub>198T</sub> protein and &#x03B1;2,3 SA complex was unstable, with the &#x03B1;2,3 SA gradually moving away from the binding pocket during the course of the simulation.</p>
<fig position="float" id="fig8">
<label>Figure 8</label>
<caption>
<p>MD simulation results for 3&#x2019;SLN and HA<sub>198T</sub> interaction. <bold>(A)</bold> Time evolution of HA<sub>198T</sub> RMSD (blue) and 3&#x2019;SLN RMSD (red) during the 100&#x202F;ns simulation. <bold>(B)</bold> Per-residue RMSF of the HA<sub>198T</sub>. Green bars indicate residues involved in 3&#x2019;SLN binding. <bold>(C)</bold> Per-atom RMSF of the 3&#x2019;SLN. <bold>(D)</bold> Fraction of simulation time different types of interactions (hydrogen bonds, hydrophobic, ionic, and water bridges) were maintained between the HA<sub>198T</sub> and 3&#x2019;SLN. <bold>(E)</bold> 2D representation of the key interactions between 3&#x2019;SLN and HA<sub>198T</sub>, showing hydrogen bonds (dotted lines) and other non-covalent interactions.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g008.tif"/>
</fig>
<p>Although a total of 91 interactions were formed between the protein and &#x03B1;2,3 SA, none of these interactions had frequencies exceeding 30% (<xref ref-type="fig" rid="fig8">Figure 8D</xref>), and only those above this threshold are shown in <xref ref-type="fig" rid="fig8">Figures 8D</xref>,<xref ref-type="fig" rid="fig8">E</xref>. The absence of strong, consistent interactions indicates a weak binding affinity between the HA<sub>198T</sub> protein and the &#x03B1;2,3 SA. Consequently, the &#x03B1;2,3 SA was unable to maintain stable binding within the protein&#x2019;s receptor pocket, which is consistent with its detachment from the binding site.</p>
</sec>
<sec id="sec26">
<title>MD simulation reveals high-affinity stable binding between HA198A and &#x03B1;2,3 SA</title>
<p>During the MD simulation, both the HA<sub>198A</sub> protein and the &#x03B1;2,3 SA demonstrated high stability. The RMSD of the HA<sub>198A</sub> protein stabilized at approximately 6.0&#x202F;&#x00C5;, and after initial fluctuations, the RMSD of the &#x03B1;2,3 SA also stabilized at around 6.0&#x202F;&#x00C5; (<xref ref-type="fig" rid="fig9">Figure 9A</xref>). The RMSF values for the interacting amino acid residues of HA<sub>198A</sub> (indicated in green in <xref ref-type="fig" rid="fig9">Figure 9B</xref>) and the &#x03B1;2,3 SA atoms showed minimal fluctuations overall (<xref ref-type="fig" rid="fig9">Figures 9B</xref>,<xref ref-type="fig" rid="fig9">C</xref>), indicating that both the protein and the &#x03B1;2,3 SA had relatively stable initial conformations. After some dynamic movements, a more stable binding conformation was formed.</p>
<fig position="float" id="fig9">
<label>Figure 9</label>
<caption>
<p>MD simulation results for 3&#x2019;SLN and HA<sub>198A</sub> interaction. <bold>(A)</bold> RMSD of HA<sub>198A</sub> (blue) and 3&#x2019;SLN (red) over the 100&#x202F;ns simulation time. <bold>(B)</bold> RMSF of HA<sub>198A</sub> residues. Green bars indicate key binding site residues. <bold>(C)</bold> RMSF of 3&#x2019;SLN atoms over the simulation period. <bold>(D)</bold> Interaction fraction of different types of bonds (hydrogen bonds, hydrophobic interactions, ionic bonds, and water bridges) between the 3&#x2019;SLN and specific HA<sub>198A</sub> residues. <bold>(E)</bold> 2D interaction diagram showing key binding interactions between 3&#x2019;SLN and HA<sub>198A</sub> residues at the end of the simulation. Dotted lines represent different types of interactions: pink for hydrogen bonds, green for <italic>&#x03C0;</italic>-&#x03C0; stacking, and blue for water bridges.</p>
</caption>
<graphic xlink:href="fvets-11-1526600-g009.tif"/>
</fig>
<p>The HA<sub>198A</sub> protein and the &#x03B1;2,3 SA formed a total of 33 interactions. Notably, the hydrogen bond and water bridge interaction frequencies of Glu407 reached 159 and 99%, respectively, underscoring the critical role of Glu407 in the binding process (<xref ref-type="fig" rid="fig9">Figures 9D</xref>,<xref ref-type="fig" rid="fig9">E</xref>). Other important residues, including Glu99, Arg275, Ile276, Lys278, and Asp405, also contributed significantly to maintaining the complex&#x2019;s stability (<xref ref-type="fig" rid="fig9">Figures 9D</xref>,<xref ref-type="fig" rid="fig9">E</xref>). Additionally, several intramolecular hydrogen bonds were formed within the &#x03B1;2,3 SA, further stabilizing its binding conformation (<xref ref-type="fig" rid="fig9">Figure 9E</xref>).</p>
<p>These results suggest that the &#x03B1;2,3 SA and HA<sub>198A</sub> protein optimized their initial binding conformations during molecular dynamics simulations, resulting in a more stable complex with high binding affinity.</p>
<p>In summary, MD simulations provided insights into the molecular interactions and conformational changes governing the binding affinity between the HA protein and sialic acids, which are critical for viral receptor specificity. The binding affinity between the 198th residue of the HA protein and the &#x03B1;2,6 SA decreased in the order of HA<sub>198V</sub>, HA<sub>198T</sub>, and HA<sub>198A</sub>. Conversely, for the &#x03B1;2,3 SA, the binding affinity increased in the order of HA<sub>198T</sub>, HA<sub>198V</sub>, and HA<sub>198A</sub>. Furthermore, when interacting with the &#x03B1;2,6 SA, the 198th residue primarily engaged through the formation of water bridges. In contrast, the 198th residue did not directly participate in interactions with the &#x03B1;2,3 SA, suggesting a differential role of this residue in modulating receptor specificity based on SA type.</p>
</sec>
</sec>
<sec sec-type="discussion" id="sec27">
<title>Discussion</title>
<p>The ongoing evolution of the H9N2 AIV has led to a mismatch between epidemic and vaccine strains, contributing significantly to immune failure and periodic outbreaks. Recent years have seen extensive documentation of the diversity and high mutability of amino acids at position 198 on the HA protein, closely associated with the adaptive evolution of H9N2 AIV (<xref ref-type="bibr" rid="ref11">11</xref>, <xref ref-type="bibr" rid="ref31 ref32 ref33 ref34">31&#x2013;34</xref>). This study aimed to elucidate the molecular mechanisms by which high-frequency amino acids at position 198 on the HA protein influence receptor binding affinity and specificity, providing new insights into the adaptive evolution patterns, antigenic variation mechanisms, and cross-species transmission potential of H9N2 AIV.</p>
<p>Our analysis revealed that between 2013 and 2021, 79.36% of H9N2 AIV strains in China contained the 190&#x202F;T/V mutation, corroborating and extending the findings of Sun et al. (<xref ref-type="bibr" rid="ref35">35</xref>), who reported an increase from 22.9% before 1999 to 57.2% between 2013 and 2019. This significant increase could explain the rising number of H9N2 avian influenza viruses with enhanced mammalian infection potential, potentially contributing to the observed increase in human infections. The public health implications of this trend are considerable, highlighting the need for enhanced surveillance strategies and the development of more effective vaccines that can address the evolving nature of these viruses. The differential binding patterns we observed between HA variants and non-specific antibodies provide new insights into H9N2 immune escape mechanisms. Our findings that the 198&#x202F;V mutation reduces non-specific antibody binding while enhancing receptor binding avidity suggests a mechanism where increased receptor competition facilitates antibody escape, consistent with previous observations in other influenza subtypes (<xref ref-type="bibr" rid="ref15">15</xref>, <xref ref-type="bibr" rid="ref16">16</xref>). This is particularly significant given that position 198 contributes to both receptor binding and antigenic recognition (<xref ref-type="bibr" rid="ref17">17</xref>). The enhanced receptor binding associated with 198&#x202F;V mutation may provide these variants with a competitive advantage in evading host immunity while maintaining efficient cell entry.</p>
<p>Furthermore, we observed a negative correlation between the prevalence trends of the 198V and 198T mutations. This intriguing finding could potentially reflect evolutionary trade-offs in viral fitness. While both mutations enhance binding to human-type receptors, 198&#x202F;V appears to confer notably higher receptor binding affinity. Based on previous studies (<xref ref-type="bibr" rid="ref15">15</xref>), such increased binding avidity might drive antigenic drift, which could explain our observation of reduced polyclonal antibody binding to 198&#x202F;V variants. Additionally, this stronger binding might potentially disrupt the optimal HA-NA balance required for efficient transmission. In contrast, 198&#x202F;T&#x2019;s moderate binding affinity could theoretically maintain better functional balance while providing sufficient receptor engagement. We speculate that this potential trade-off between immune escape and transmission efficiency might contribute to their opposing evolutionary patterns.</p>
<p>As previously reported (<xref ref-type="bibr" rid="ref14">14</xref>), the HA<sub>198V</sub> mutation in the H9N2 virus promoted viral escape from polyclonal antibody binding by enhancing receptor-binding activity, consistent with the findings of this study. Additionally, our results demonstrate that mutations at HA position 198 significantly influence receptor binding preferences and affinities. Specifically, HA<sub>198V</sub> and HA<sub>198T</sub> variants exhibit higher affinity for 6&#x2019;SLN, a receptor more prevalent in the upper respiratory tract of mammals (<xref ref-type="bibr" rid="ref36">36</xref>), compared to HA<sub>198A</sub>. Conversely, the HA<sub>198A</sub> variant shows a stronger preference for 3&#x2019;SLN. These differential binding patterns, consistently demonstrated in both RDE and solid-phase binding assays, align with previous reports of HA<sub>198V/T</sub> mutations promoting mammalian adaptation (<xref ref-type="bibr" rid="ref31">31</xref>). Moreover, the observed differences in non-specific antibody binding among HA<sub>198V</sub>, HA<sub>198T</sub>, and HA<sub>198A</sub> variants suggest complex interactions between receptor binding and antibody recognition. These findings have significant implications for vaccine design and efficacy, particularly in light of the ongoing challenge of antigenic drift in H9N2 AIV. The altered antibody binding profiles associated with different HA<sub>198</sub> variants underscore the need for vaccine strategies that can induce broadly specific antibodies or that can be quickly updated to match circulating strains.</p>
<p>To further elucidate the mechanisms underlying changes in receptor-binding strength and specificity caused by HA<sub>198</sub> amino acid mutations, we employed molecular docking and molecular dynamics simulations. These computational approaches revealed that mutations such as HA<sub>198V</sub>, HA<sub>198T</sub>, and HA<sub>198A</sub> induce conformational changes in the receptor-binding pocket, significantly altering the interactions between the H9N2 virus and both &#x03B1;2,6 SA and &#x03B1;2,3 SA receptors. The molecular docking analysis revealed small but consistent differences in binding energies between variants (&#x2212;5.5 to &#x2212;6.1&#x202F;kcal/mol), which, while subtle, align well with our solid-phase binding assay results showing differential receptor binding patterns. The predicted binding modes and energetic differences are further validated by our 100-ns MD simulations, which demonstrate stable protein-ligand interactions and consistent conformational differences, providing a comprehensive molecular basis for the observed receptor binding preferences.</p>
<p>Specifically, during MD simulations, the HA<sub>198V</sub> and HA<sub>198T</sub> mutations enhanced binding stability with 6&#x2019;SLN, while HA<sub>198A</sub> formed a more stable complex with 3&#x2019;SLN. We also identified key residues, such as Thr147, Glu199, and Tyr109, that play crucial roles in receptor binding by forming stable hydrogen bonds and water bridges with sialic acids. Notably, residue 198 primarily interacts with &#x03B1;2,6 SA through water bridges, while showing minimal direct involvement in binding with &#x03B1;2,3 SA. These molecular-level changes could translate to broader phenotypic effects, such as altered transmissibility or virulence in different host species. For instance, the enhanced stability of HA<sub>198V</sub> and HA<sub>198T</sub> with 6&#x2019;SLN might contribute to more efficient viral entry and replication in mammalian cells, potentially increasing the risk of zoonotic transmission. Conversely, the preference of HA<sub>198A</sub> for 3&#x2019;SLN might optimize the virus for replication in avian hosts. Understanding these structure&#x2013;function relationships at the molecular level provides valuable insights into the mechanisms of host adaptation and could inform the development of targeted antiviral strategies.</p>
<p>This study underscores the advantages of molecular docking and MD simulations in analyzing virus-receptor interactions. Compared to traditional biological assays, these computational techniques offer more direct visualization of the dynamic interactions between viral proteins and receptors, revealing molecular changes and their biological significance. These tools provide a powerful means to study the adaptive evolution and antigenic drift of the H9N2 virus, allowing for rapid assessment of the potential impact of newly identified HA mutations on receptor binding. However, it is important to acknowledge the limitations of these computational approaches. While they provide valuable insights into molecular interactions, they may not fully capture the complexity of the cellular environment or the potential influence of other viral and host factors. Therefore, these computational studies should be viewed as complementary to experimental approaches. Integrating computational predictions with <italic>in vitro</italic> and <italic>in vivo</italic> experimental validation can provide a more comprehensive understanding of virus-host interactions and enhance the reliability of our findings.</p>
<p>In conclusion, this study combined experimental data with computational simulations to elucidate how mutations at residue 198 of the HA protein regulate receptor-binding affinity, specificity, and antibody recognition, driving viral antigenic drift and host adaptation. These findings offer valuable insights into the underlying molecular mechanisms of H9N2 AIV evolution and adaptation.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="sec28">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec sec-type="ethics-statement" id="sec29">
<title>Ethics statement</title>
<p>The animal study was approved by the Animal protection and management regulations of the Jiangsu Agri-Animal Husbandry Vocational College. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="sec30">
<title>Author contributions</title>
<p>RZ: Writing &#x2013; original draft, Writing &#x2013; review &#x0026; editing. JW: Methodology, Writing &#x2013; original draft. RC: Methodology, Writing &#x2013; original draft. MZ: Writing &#x2013; review &#x0026; editing. SC: Writing &#x2013; review &#x0026; editing. ZW: Writing &#x2013; review &#x0026; editing. LW: Data curation, Writing &#x2013; original draft. LZ: Writing &#x2013; review &#x0026; editing, Funding acquisition. SZ: Writing &#x2013; review &#x0026; editing, Project administration.</p>
</sec>
<sec sec-type="funding-information" id="sec31">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This research was supported by Jiangsu Agri-Animal Husbandry Vocational College Natural Science Project (NSF2022CB15), Jiangsu University Blue Project [(2023) No. 27], Enterprise Practice Training Program for Young Teachers in Higher Vocational Colleges of Jiangsu Province (2023QYSJ037), and Taizhou 311 High-Level Talent Training Project [(2024) No. 1].</p>
</sec>
<sec sec-type="COI-statement" id="sec32">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="sec33">
<title>Generative AI statement</title>
<p>The authors declare that no Gen AI was used in the creation of this manuscript.</p>
</sec>
<sec sec-type="disclaimer" id="sec34">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<fn-group>
<title>Abbreviations</title>
<fn fn-type="abbr">
<p>HA<sub>198A</sub>, an alanine residue at position 198 in HA; HA<sub>198V</sub>, a valine residue at position 198 in HA; HA<sub>198T</sub>, a threonine residue at position 198 in HA; TPCK-trypsin, tosyl-phenylalanine chloromethyl-ketone treated typsin.</p>
</fn>
</fn-group>
<fn-group>
<fn id="fn0001"><p><sup>1</sup><ext-link xlink:href="https://www.deshawresearch.com" ext-link-type="uri">https://www.deshawresearch.com</ext-link></p></fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="ref1"><label>1.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Sun</surname> <given-names>Y</given-names></name> <name><surname>Liu</surname> <given-names>J</given-names></name></person-group>. <article-title>H9N2 influenza virus in China: a cause of concern</article-title>. <source>Protein Cell</source>. (<year>2015</year>) <volume>6</volume>:<fpage>18</fpage>&#x2013;<lpage>25</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s13238-014-0111-7</pub-id>, PMID: <pub-id pub-id-type="pmid">25384439</pub-id></citation></ref>
<ref id="ref2"><label>2.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kishida</surname> <given-names>N</given-names></name> <name><surname>Sakoda</surname> <given-names>Y</given-names></name> <name><surname>Eto</surname> <given-names>M</given-names></name> <name><surname>Sunaga</surname> <given-names>Y</given-names></name> <name><surname>Kida</surname> <given-names>H</given-names></name></person-group>. <article-title>Co-infection of staphylococcus aureus or haemophilus paragallinarum exacerbates H9N2 influenza a virus infection in chickens</article-title>. <source>Arch Virol</source>. (<year>2004</year>) <volume>149</volume>:<fpage>2095</fpage>&#x2013;<lpage>104</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00705-004-0372-1</pub-id>, PMID: <pub-id pub-id-type="pmid">15503199</pub-id></citation></ref>
<ref id="ref3"><label>3.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>J</given-names></name> <name><surname>Li</surname> <given-names>Y</given-names></name> <name><surname>Yin</surname> <given-names>Y</given-names></name></person-group>. <article-title>Respiratory phagocytes are implicated in enhanced colibacillosis in chickens co-infected with influenza virus H9N2 and escherichia coli</article-title>. <source>Br Poult Sci</source>. (<year>2018</year>) <volume>59</volume>:<fpage>160</fpage>&#x2013;<lpage>5</lpage>. doi: <pub-id pub-id-type="doi">10.1080/00071668.2017.1406061</pub-id>, PMID: <pub-id pub-id-type="pmid">29148834</pub-id></citation></ref>
<ref id="ref4"><label>4.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>X</given-names></name> <name><surname>Wang</surname> <given-names>H</given-names></name> <name><surname>Zhang</surname> <given-names>S</given-names></name> <name><surname>Shang</surname> <given-names>H</given-names></name> <name><surname>Wang</surname> <given-names>C</given-names></name> <name><surname>Zhou</surname> <given-names>F</given-names></name> <etal/></person-group>. <article-title>The role of transforming growth factor beta-1 protein in escherichia coli secondary infection induced by H9N2 avian influenza virus in chickens</article-title>. <source>Microb Pathog</source>. (<year>2023</year>) <volume>175</volume>:<fpage>105983</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.micpath.2023.105983</pub-id></citation></ref>
<ref id="ref5"><label>5.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Pu</surname> <given-names>J</given-names></name> <name><surname>Wang</surname> <given-names>S</given-names></name> <name><surname>Yin</surname> <given-names>Y</given-names></name> <name><surname>Zhang</surname> <given-names>G</given-names></name> <name><surname>Carter</surname> <given-names>RA</given-names></name> <name><surname>Wang</surname> <given-names>J</given-names></name> <etal/></person-group>. <article-title>Evolution of the H9N2 influenza genotype that facilitated the genesis of the novel H7N9 virus</article-title>. <source>Proc Natl Acad Sci USA</source>. (<year>2015</year>) <volume>112</volume>:<fpage>548</fpage>&#x2013;<lpage>53</lpage>. doi: <pub-id pub-id-type="doi">10.1073/pnas.1422456112</pub-id>, PMID: <pub-id pub-id-type="pmid">25548189</pub-id></citation></ref>
<ref id="ref6"><label>6.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname> <given-names>S</given-names></name> <name><surname>Zhou</surname> <given-names>J</given-names></name> <name><surname>Xiong</surname> <given-names>J</given-names></name> <name><surname>du</surname> <given-names>X</given-names></name> <name><surname>Yang</surname> <given-names>W</given-names></name> <name><surname>Huang</surname> <given-names>J</given-names></name> <etal/></person-group>. <article-title>Continued evolution of H10N3 influenza virus with adaptive mutations poses an increased threat to mammals</article-title>. <source>Virol Sin</source>. (<year>2024</year>) <volume>39</volume>:<fpage>546</fpage>&#x2013;<lpage>55</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.virs.2024.06.005</pub-id>, PMID: <pub-id pub-id-type="pmid">38871182</pub-id></citation></ref>
<ref id="ref7"><label>7.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>B</given-names></name> <name><surname>Su</surname> <given-names>G</given-names></name> <name><surname>Xiao</surname> <given-names>C</given-names></name> <name><surname>Zhang</surname> <given-names>J</given-names></name> <name><surname>Li</surname> <given-names>H</given-names></name> <name><surname>Sun</surname> <given-names>N</given-names></name> <etal/></person-group>. <article-title>The PB2 co-adaptation of H10N8 avian influenza virus increases the pathogenicity to chickens and mice</article-title>. <source>Transbound Emerg Dis</source>. (<year>2022</year>) <volume>69</volume>:<fpage>1794</fpage>&#x2013;<lpage>803</lpage>. doi: <pub-id pub-id-type="doi">10.1111/tbed.14157</pub-id>, PMID: <pub-id pub-id-type="pmid">34008327</pub-id></citation></ref>
<ref id="ref8"><label>8.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Mao</surname> <given-names>Q</given-names></name> <name><surname>Zhou</surname> <given-names>S</given-names></name> <name><surname>Liu</surname> <given-names>S</given-names></name> <name><surname>Peng</surname> <given-names>C</given-names></name> <name><surname>Yin</surname> <given-names>X</given-names></name> <name><surname>Li</surname> <given-names>J</given-names></name> <etal/></person-group>. <article-title>Emergence of novel reassortant H3N3 avian influenza viruses with increased pathogenicity in chickens in 2023</article-title>. <source>Emerg Microb Infect</source>. (<year>2024</year>) <volume>13</volume>:<fpage>2287683</fpage>. doi: <pub-id pub-id-type="doi">10.1080/22221751.2023.2287683</pub-id>, PMID: <pub-id pub-id-type="pmid">37990831</pub-id></citation></ref>
<ref id="ref9"><label>9.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>P</given-names></name> <name><surname>Niu</surname> <given-names>M</given-names></name> <name><surname>Li</surname> <given-names>Y</given-names></name> <name><surname>Xu</surname> <given-names>M</given-names></name> <name><surname>Zhao</surname> <given-names>T</given-names></name> <name><surname>Cao</surname> <given-names>X</given-names></name> <etal/></person-group>. <article-title>Human infection with H3N8 avian influenza virus: a novel H9N2-original reassortment virus</article-title>. <source>J Infect</source>. (<year>2022</year>) <volume>85</volume>:<fpage>e187</fpage>&#x2013;<lpage>9</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jinf.2022.08.033</pub-id>, PMID: <pub-id pub-id-type="pmid">36058414</pub-id></citation></ref>
<ref id="ref10"><label>10.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Koel</surname> <given-names>BF</given-names></name> <name><surname>Burke</surname> <given-names>DF</given-names></name> <name><surname>Bestebroer</surname> <given-names>TM</given-names></name> <name><surname>van der Vliet</surname> <given-names>S</given-names></name> <name><surname>Zondag</surname> <given-names>GCM</given-names></name> <name><surname>Vervaet</surname> <given-names>G</given-names></name> <etal/></person-group>. <article-title>Substitutions near the receptor binding site determine major antigenic change during influenza virus evolution</article-title>. <source>Science</source>. (<year>2013</year>) <volume>342</volume>:<fpage>976</fpage>&#x2013;<lpage>9</lpage>. doi: <pub-id pub-id-type="doi">10.1126/science.1244730</pub-id></citation></ref>
<ref id="ref11"><label>11.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhu</surname> <given-names>R</given-names></name> <name><surname>Xu</surname> <given-names>D</given-names></name> <name><surname>Yang</surname> <given-names>X</given-names></name> <name><surname>Zhang</surname> <given-names>J</given-names></name> <name><surname>Wang</surname> <given-names>S</given-names></name> <name><surname>Shi</surname> <given-names>H</given-names></name> <etal/></person-group>. <article-title>Genetic and biological characterization of H9N2 avian influenza viruses isolated in China from 2011 to 2014</article-title>. <source>PLoS One</source>. (<year>2018</year>) <volume>13</volume>:<fpage>e0199260</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0199260</pub-id>, PMID: <pub-id pub-id-type="pmid">29969454</pub-id></citation></ref>
<ref id="ref12"><label>12.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Su</surname> <given-names>H</given-names></name> <name><surname>Zhao</surname> <given-names>Y</given-names></name> <name><surname>Zheng</surname> <given-names>L</given-names></name> <name><surname>Wang</surname> <given-names>S</given-names></name> <name><surname>Shi</surname> <given-names>H</given-names></name> <name><surname>Liu</surname> <given-names>X</given-names></name></person-group>. <article-title>Effect of the selection pressure of vaccine antibodies on evolution of H9N2 avian influenza virus in chickens</article-title>. <source>AMB Express</source>. (<year>2020</year>) <volume>10</volume>:<fpage>98</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s13568-020-01036-0</pub-id>, PMID: <pub-id pub-id-type="pmid">32462233</pub-id></citation></ref>
<ref id="ref13"><label>13.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jin</surname> <given-names>H</given-names></name> <name><surname>Wang</surname> <given-names>W</given-names></name> <name><surname>Yang</surname> <given-names>X</given-names></name> <name><surname>Su</surname> <given-names>H</given-names></name> <name><surname>Fan</surname> <given-names>J</given-names></name> <name><surname>Zhu</surname> <given-names>R</given-names></name> <etal/></person-group>. <article-title>Evolution of H9N2 avian influenza virus in embryonated chicken eggs with or without homologous vaccine antibodies</article-title>. <source>BMC Vet Res</source>. (<year>2018</year>) <volume>14</volume>:<fpage>71</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s12917-018-1391-6</pub-id>, PMID: <pub-id pub-id-type="pmid">29510698</pub-id></citation></ref>
<ref id="ref14"><label>14.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhu</surname> <given-names>R</given-names></name> <name><surname>Xu</surname> <given-names>S</given-names></name> <name><surname>Sun</surname> <given-names>W</given-names></name> <name><surname>Li</surname> <given-names>Q</given-names></name> <name><surname>Wang</surname> <given-names>S</given-names></name> <name><surname>Shi</surname> <given-names>H</given-names></name> <etal/></person-group>. <article-title>HA gene amino acid mutations contribute to antigenic variation and immune escape of H9N2 influenza virus</article-title>. <source>Vet Res</source>. (<year>2022</year>) <volume>53</volume>:<fpage>43</fpage>. doi: <pub-id pub-id-type="doi">10.1186/s13567-022-01058-5</pub-id>, PMID: <pub-id pub-id-type="pmid">35706014</pub-id></citation></ref>
<ref id="ref15"><label>15.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hensley</surname> <given-names>SE</given-names></name> <name><surname>Das</surname> <given-names>SR</given-names></name> <name><surname>Bailey</surname> <given-names>AL</given-names></name> <name><surname>Schmidt</surname> <given-names>LM</given-names></name> <name><surname>Hickman</surname> <given-names>HD</given-names></name> <name><surname>Jayaraman</surname> <given-names>A</given-names></name> <etal/></person-group>. <article-title>Hemagglutinin receptor binding avidity drives influenza a virus antigenic drift</article-title>. <source>Science</source>. (<year>2009</year>) <volume>326</volume>:<fpage>734</fpage>&#x2013;<lpage>6</lpage>. doi: <pub-id pub-id-type="doi">10.1126/science.1178258</pub-id>, PMID: <pub-id pub-id-type="pmid">19900932</pub-id></citation></ref>
<ref id="ref16"><label>16.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Sealy</surname> <given-names>JE</given-names></name> <name><surname>Yaqub</surname> <given-names>T</given-names></name> <name><surname>Peacock</surname> <given-names>TP</given-names></name> <name><surname>Chang</surname> <given-names>P</given-names></name> <name><surname>Ermetal</surname> <given-names>B</given-names></name> <name><surname>Clements</surname> <given-names>A</given-names></name> <etal/></person-group>. <article-title>Association of increased receptor-binding avidity of influenza a(H9N2) viruses with escape from antibody-based immunity and enhanced zoonotic potential</article-title>. <source>Emerg Infect Dis</source>. (<year>2018</year>) <volume>25</volume>:<fpage>63</fpage>&#x2013;<lpage>72</lpage>. doi: <pub-id pub-id-type="doi">10.3201/eid2501.180616</pub-id>, PMID: <pub-id pub-id-type="pmid">30561311</pub-id></citation></ref>
<ref id="ref17"><label>17.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Peacock</surname> <given-names>TP</given-names></name> <name><surname>Sealy</surname> <given-names>JE</given-names></name> <name><surname>Harvey</surname> <given-names>WT</given-names></name> <name><surname>Benton</surname> <given-names>DJ</given-names></name> <name><surname>Reeve</surname> <given-names>R</given-names></name> <name><surname>Iqbal</surname> <given-names>M</given-names></name></person-group>. <article-title>Genetic determinants of receptor-binding preference and zoonotic potential of H9N2 avian influenza viruses</article-title>. <source>J Virol</source>. (<year>2021</year>) <volume>95</volume>:<fpage>e01651</fpage>&#x2013;<lpage>20</lpage>. doi: <pub-id pub-id-type="doi">10.1128/JVI.01651-20</pub-id>, PMID: <pub-id pub-id-type="pmid">33268517</pub-id></citation></ref>
<ref id="ref18"><label>18.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Koehler</surname> <given-names>M</given-names></name> <name><surname>Delguste</surname> <given-names>M</given-names></name> <name><surname>Sieben</surname> <given-names>C</given-names></name> <name><surname>Gillet</surname> <given-names>L</given-names></name> <name><surname>Alsteens</surname> <given-names>D</given-names></name></person-group>. <article-title>Initial step of virus entry: virion binding to cell-surface glycans</article-title>. <source>Annu Rev Virol</source>. (<year>2020</year>) <volume>7</volume>:<fpage>143</fpage>&#x2013;<lpage>65</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev-virology-122019-070025</pub-id>, PMID: <pub-id pub-id-type="pmid">32396772</pub-id></citation></ref>
<ref id="ref19"><label>19.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Overeem</surname> <given-names>NJ</given-names></name> <name><surname>van der Vries</surname> <given-names>E</given-names></name> <name><surname>Huskens</surname> <given-names>J</given-names></name></person-group>. <article-title>A dynamic, supramolecular view on the multivalent interaction between influenza virus and host cell</article-title>. <source>Small</source>. (<year>2021</year>) <volume>17</volume>:<fpage>e2007214</fpage>. doi: <pub-id pub-id-type="doi">10.1002/smll.202007214</pub-id>, PMID: <pub-id pub-id-type="pmid">33682339</pub-id></citation></ref>
<ref id="ref20"><label>20.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname> <given-names>C</given-names></name> <name><surname>Pu</surname> <given-names>J</given-names></name></person-group>. <article-title>Influence of host sialic acid receptors structure on the host specificity of influenza viruses</article-title>. <source>Viruses</source>. (<year>2022</year>) <volume>14</volume>:<fpage>2141</fpage>. doi: <pub-id pub-id-type="doi">10.3390/v14102141</pub-id>, PMID: <pub-id pub-id-type="pmid">36298694</pub-id></citation></ref>
<ref id="ref21"><label>21.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Vora</surname> <given-names>J</given-names></name> <name><surname>Athar</surname> <given-names>M</given-names></name> <name><surname>Sinha</surname> <given-names>S</given-names></name> <name><surname>Jha</surname> <given-names>PC</given-names></name> <name><surname>Shrivastava</surname> <given-names>N</given-names></name></person-group>. <article-title>Binding insight of anti-HIV phytocompounds with prime targets of HIV: a molecular dynamics simulation analysis</article-title>. <source>Curr HIV Res</source>. (<year>2020</year>) <volume>18</volume>:<fpage>132</fpage>&#x2013;<lpage>41</lpage>. doi: <pub-id pub-id-type="doi">10.2174/1570162X18666200129112509</pub-id>, PMID: <pub-id pub-id-type="pmid">31995010</pub-id></citation></ref>
<ref id="ref22"><label>22.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Durrant</surname> <given-names>JD</given-names></name> <name><surname>McCammon</surname> <given-names>JA</given-names></name></person-group>. <article-title>Molecular dynamics simulations and drug discovery</article-title>. <source>BMC Biol</source>. (<year>2011</year>) <volume>9</volume>:<fpage>71</fpage>. doi: <pub-id pub-id-type="doi">10.1186/1741-7007-9-71</pub-id>, PMID: <pub-id pub-id-type="pmid">22035460</pub-id></citation></ref>
<ref id="ref23"><label>23.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hao</surname> <given-names>X</given-names></name> <name><surname>Hu</surname> <given-names>J</given-names></name> <name><surname>Wang</surname> <given-names>J</given-names></name> <name><surname>Xu</surname> <given-names>J</given-names></name> <name><surname>Cheng</surname> <given-names>H</given-names></name> <name><surname>Xu</surname> <given-names>Y</given-names></name> <etal/></person-group>. <article-title>Reassortant H5N1 avian influenza viruses containing PA or NP gene from an H9N2 virus significantly increase the pathogenicity in mice</article-title>. <source>Vet Microbiol</source>. (<year>2016</year>) <volume>192</volume>:<fpage>95</fpage>&#x2013;<lpage>101</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.vetmic.2016.07.002</pub-id>, PMID: <pub-id pub-id-type="pmid">27527770</pub-id></citation></ref>
<ref id="ref24"><label>24.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Peng</surname> <given-names>Q</given-names></name> <name><surname>Zhu</surname> <given-names>R</given-names></name> <name><surname>Wang</surname> <given-names>X</given-names></name> <name><surname>Shi</surname> <given-names>H</given-names></name> <name><surname>Bellefleur</surname> <given-names>M</given-names></name> <name><surname>Wang</surname> <given-names>S</given-names></name> <etal/></person-group>. <article-title>Impact of the variations in potential glycosylation sites of the hemagglutinin of H9N2 influenza virus</article-title>. <source>Virus Genes</source>. (<year>2019</year>) <volume>55</volume>:<fpage>182</fpage>&#x2013;<lpage>90</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s11262-018-1623-7</pub-id>, PMID: <pub-id pub-id-type="pmid">30594968</pub-id></citation></ref>
<ref id="ref25"><label>25.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chambers</surname> <given-names>BS</given-names></name> <name><surname>Parkhouse</surname> <given-names>K</given-names></name> <name><surname>Ross</surname> <given-names>TM</given-names></name> <name><surname>Alby</surname> <given-names>K</given-names></name> <name><surname>Hensley</surname> <given-names>SE</given-names></name></person-group>. <article-title>Identification of hemagglutinin residues responsible for H3N2 antigenic drift during the 2014&#x2013;2015 influenza season</article-title>. <source>Cell Rep</source>. (<year>2015</year>) <volume>12</volume>:<fpage>1</fpage>&#x2013;<lpage>6</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.celrep.2015.06.005</pub-id>, PMID: <pub-id pub-id-type="pmid">26119736</pub-id></citation></ref>
<ref id="ref26"><label>26.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>N</given-names></name> <name><surname>Quan</surname> <given-names>K</given-names></name> <name><surname>Chen</surname> <given-names>Z</given-names></name> <name><surname>Hu</surname> <given-names>Q</given-names></name> <name><surname>Nie</surname> <given-names>M</given-names></name> <name><surname>Xu</surname> <given-names>N</given-names></name> <etal/></person-group>. <article-title>The emergence of new antigen branches of H9N2 avian influenza virus in China due to antigenic drift on hemagglutinin through antibody escape at immunodominant sites</article-title>. <source>Emerg Microbes Infect</source>. (<year>2023</year>) <volume>12</volume>:<fpage>2246582</fpage>. doi: <pub-id pub-id-type="doi">10.1080/22221751.2023.2246582</pub-id>, PMID: <pub-id pub-id-type="pmid">37550992</pub-id></citation></ref>
<ref id="ref27"><label>27.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gao</surname> <given-names>R</given-names></name> <name><surname>Gu</surname> <given-names>M</given-names></name> <name><surname>Liu</surname> <given-names>K</given-names></name> <name><surname>Li</surname> <given-names>Q</given-names></name> <name><surname>Li</surname> <given-names>J</given-names></name> <name><surname>Shi</surname> <given-names>L</given-names></name> <etal/></person-group>. <article-title>T160A mutation-induced deglycosylation at site 158 in hemagglutinin is a critical determinant of the dual receptor binding properties of clade 2.3.4.4 H5NX subtype avian influenza viruses</article-title>. <source>Vet Microbiol</source>. (<year>2018</year>) <volume>217</volume>:<fpage>158</fpage>&#x2013;<lpage>66</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.vetmic.2018.03.018</pub-id>, PMID: <pub-id pub-id-type="pmid">29615249</pub-id></citation></ref>
<ref id="ref28"><label>28.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>O&#x2019;Boyle</surname> <given-names>NM</given-names></name> <name><surname>Banck</surname> <given-names>M</given-names></name> <name><surname>James</surname> <given-names>CA</given-names></name> <name><surname>Morley</surname> <given-names>C</given-names></name> <name><surname>Vandermeersch</surname> <given-names>T</given-names></name> <name><surname>Hutchison</surname> <given-names>GR</given-names></name></person-group>. <article-title>Open babel: an open chemical toolbox</article-title>. <source>J Cheminform</source>. (<year>2011</year>) <volume>3</volume>:<fpage>33</fpage>. doi: <pub-id pub-id-type="doi">10.1186/1758-2946-3-33</pub-id>, PMID: <pub-id pub-id-type="pmid">21982300</pub-id></citation></ref>
<ref id="ref29"><label>29.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Eberhardt</surname> <given-names>J</given-names></name> <name><surname>Santos-Martins</surname> <given-names>D</given-names></name> <name><surname>Tillack</surname> <given-names>AF</given-names></name> <name><surname>Forli</surname> <given-names>S</given-names></name></person-group>. <article-title>AutoDock vina 1.2.0: new docking methods, expanded force field, and python bindings</article-title>. <source>J Chem Inf Model</source>. (<year>2021</year>) <volume>61</volume>:<fpage>3891</fpage>&#x2013;<lpage>8</lpage>. doi: <pub-id pub-id-type="doi">10.1021/acs.jcim.1c00203</pub-id>, PMID: <pub-id pub-id-type="pmid">34278794</pub-id></citation></ref>
<ref id="ref30"><label>30.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Trott</surname> <given-names>O</given-names></name> <name><surname>Olson</surname> <given-names>AJ</given-names></name></person-group>. <article-title>AutoDock vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization and multithreading</article-title>. <source>J Comput Chem</source>. (<year>2010</year>) <volume>31</volume>:<fpage>455</fpage>&#x2013;<lpage>61</lpage>. doi: <pub-id pub-id-type="doi">10.1002/jcc.21334</pub-id>, PMID: <pub-id pub-id-type="pmid">19499576</pub-id></citation></ref>
<ref id="ref31"><label>31.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Amin</surname> <given-names>F</given-names></name> <name><surname>Mukhtar</surname> <given-names>N</given-names></name> <name><surname>Ali</surname> <given-names>M</given-names></name> <name><surname>Shehzad</surname> <given-names>R</given-names></name> <name><surname>Ayub</surname> <given-names>S</given-names></name> <name><surname>Aslam</surname> <given-names>A</given-names></name> <etal/></person-group>. <article-title>Mapping genetic markers associated with antigenicity and host range in H9N2 influenza a viruses infecting poultry in Pakistan</article-title>. <source>Avian Dis</source>. (<year>2024</year>) <volume>68</volume>:<fpage>43</fpage>&#x2013;<lpage>51</lpage>. doi: <pub-id pub-id-type="doi">10.1637/aviandiseases-D-23-00029</pub-id>, PMID: <pub-id pub-id-type="pmid">38687107</pub-id></citation></ref>
<ref id="ref32"><label>32.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gao</surname> <given-names>X</given-names></name> <name><surname>Wang</surname> <given-names>N</given-names></name> <name><surname>Chen</surname> <given-names>Y</given-names></name> <name><surname>Gu</surname> <given-names>X</given-names></name> <name><surname>Huang</surname> <given-names>Y</given-names></name> <name><surname>Liu</surname> <given-names>Y</given-names></name> <etal/></person-group>. <article-title>Sequence characteristics and phylogenetic analysis of H9N2 subtype avian influenza a viruses detected from poultry and the environment in China, 2018</article-title>. <source>PeerJ</source>. (<year>2021</year>) <volume>9</volume>:<fpage>e12512</fpage>. doi: <pub-id pub-id-type="doi">10.7717/peerj.12512</pub-id>, PMID: <pub-id pub-id-type="pmid">35036116</pub-id></citation></ref>
<ref id="ref33"><label>33.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname> <given-names>F</given-names></name> <name><surname>Xiao</surname> <given-names>Y</given-names></name> <name><surname>Liu</surname> <given-names>F</given-names></name> <name><surname>Yao</surname> <given-names>H</given-names></name> <name><surname>Wu</surname> <given-names>N</given-names></name> <name><surname>Wu</surname> <given-names>H</given-names></name></person-group>. <article-title>Molecular characterization and antigenic analysis of reassortant H9N2 subtype avian influenza viruses in eastern China in 2016</article-title>. <source>Virus Res</source>. (<year>2021</year>) <volume>306</volume>:<fpage>198577</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.virusres.2021.198577</pub-id>, PMID: <pub-id pub-id-type="pmid">34560182</pub-id></citation></ref>
<ref id="ref34"><label>34.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Xia</surname> <given-names>J</given-names></name> <name><surname>Li</surname> <given-names>Y-X</given-names></name> <name><surname>Dong</surname> <given-names>M-Y</given-names></name> <name><surname>Guo</surname> <given-names>ZW</given-names></name> <name><surname>Luo</surname> <given-names>YW</given-names></name> <name><surname>Li</surname> <given-names>NL</given-names></name> <etal/></person-group>. <article-title>Evolution of prevalent H9N2 subtype of avian influenza virus during 2019 to 2022 for the development of a control strategy in China</article-title>. <source>Poult Sci</source>. (<year>2023</year>) <volume>102</volume>:<fpage>102957</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.psj.2023.102957</pub-id>, PMID: <pub-id pub-id-type="pmid">37573848</pub-id></citation></ref>
<ref id="ref35"><label>35.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Sun</surname> <given-names>X</given-names></name> <name><surname>Belser</surname> <given-names>JA</given-names></name> <name><surname>Maines</surname> <given-names>TR</given-names></name></person-group>. <article-title>Adaptation of H9N2 influenza viruses to mammalian hosts: a review of molecular markers</article-title>. <source>Viruses</source>. (<year>2020</year>) <volume>12</volume>:<fpage>541</fpage>. doi: <pub-id pub-id-type="doi">10.3390/v12050541</pub-id>, PMID: <pub-id pub-id-type="pmid">32423002</pub-id></citation></ref>
<ref id="ref36"><label>36.</label><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Sriwilaijaroen</surname> <given-names>N</given-names></name> <name><surname>Kondo</surname> <given-names>S</given-names></name> <name><surname>Yagi</surname> <given-names>H</given-names></name> <name><surname>Takemae</surname> <given-names>N</given-names></name> <name><surname>Saito</surname> <given-names>T</given-names></name> <name><surname>Hiramatsu</surname> <given-names>H</given-names></name> <etal/></person-group>. <article-title>N-glycans from porcine trachea and lung: predominant NeuAc&#x03B1;2-6Gal could be a selective pressure for influenza variants in favor of human-type receptor</article-title>. <source>PLoS One</source>. (<year>2011</year>) <volume>6</volume>:<fpage>e16302</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0016302</pub-id>, PMID: <pub-id pub-id-type="pmid">21347401</pub-id></citation></ref>
</ref-list>
</back>
</article>