M. synoviae strain CQTL01 was isolated from the synovial fluid of a Three-Yellow broiler in China in 2022. The strain was subsequently grown in KM2 medium (Tuopu, Zhaoyuan, Shandong, China) supplemented with 20% porcine serum (Jianglai, Shanghai, China) and 0.01% NAD (Sangon Biotech, Shanghai, China) at 37°C. The Escherichia coli strains DH5α and BL21(DE3) were grown in Luria–Bertani (LB) broth or on solid medium. The pET-30a(+) expression vector was preserved by our laboratory. Three hundred and sixty-eight serum samples were collected from five commercial poultry farms and two poultry slaughterhouses and were assessed with a M. synoviae ELISA antibody test kit (IDEXX, Westbrook, ME, USA) (Table 1). Chicken sera against other avian pathogens, including M. gallisepticum, Avibacterium paragallinarum (AP) serovars A, B and C, Salmonella Pullorum-Gallinarum (SPG), Newcastle disease virus (NDV), and avian influenza virus (AIV) subtypes H5, H7 and H9, respectively, were purchased from Harbin National Engineering Research Center of the Veterinary Biologics Corp in China.

The full-length sequence of the gene encoding ms087 in the CQTL01 strain was obtained from the genome sequence (The data have been deposited in China National Center for Bioinformation, run accession: CRR1309196). The molecular weight (MW) of MS087 was computed with Detaibio.¹ BLASTP² was used to carry out amino acid identity matching with sequences retrieved from the NCBI database. The predictor SignalP 6.0 (33) was used to detect the presence of the signal peptide. TMHMM 2.0 (34) was applied to predict transmembrane helices. The computational online software programs CELLO v.2.5 (35) and Gpos-mPLoc (36) were used to directly predict the subcellular localization of the protein. The immunogenicity of the protein was calculated by VaxiJen V2.0 (37) using the default parameters.

On the basis of the ms087 gene sequence from the CQTL01 strain, two primers (ms087-F: CGCGGATCCATGAAAATAAAAAAACT TTTATCTTTTGC and ms087-R: CCGCTCGAGATCATTTGC AAAATTAGTTAAATAAGT) were designed and synthesized. The genomic DNA of the CQTL01 strain was extracted using a TIANamp bacteria DNA kit (Tiangen, Beijing, China). The ms087 gene was amplified with ApexHF HS DNA Polymerase FS Master Mix (Accurate, Changsha, Hunan, China) by using the genomic DNA of CQTL01 as the template. After purification, the PCR product was digested with BamH I and XhoI and ligated to the expression vector pET-30a(+). The recombinant plasmid was subsequently transformed into E. coli DH5α and BL21 (DE3) competent cells via the heat shock method. Recombinant MS087 (rMS087) was expressed by induction with 1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) at 16°C for 20 h on a shaker at 200 r·min⁻¹. After induction, the expression and expression form of rMS087 in the recombinant bacteria were examined via 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and Western blotting with a mouse anti-His tag antibody (Bioss, Beijing, China). Soluble rMS087 was purified with Ni-NTA HisTrap™HP (Cytiva, Shanghai, China), and the concentration of purified recombinant protein was measured via a BCA protein assay kit (Epizyme Biotech, Shanghai, China) according to the manufacturer’s instructions.

Fifty micrograms of purified rMS087 protein at a concentration of 1 mg/mL emulsified with an equal volume of Freund’s complete adjuvant (BioFROXX, Beijing, China) was used to immunize female BALB/c mice aged 7 weeks via multipoint subcutaneous injection into groins and back. Booster dose of 50 μg of emulsified rMS087 protein with an equal volume of Freund’s incomplete adjuvant were applied on days 21 and 28 after the first immunization, and additional booster dose of 50 μg of purified rMS087 protein was applied on days 35 and 42 after the first immunization, respectively. The day before each immunization, blood samples were collected from the retro-orbital sinus. On day 49 after the first immunization, blood samples were collected from the eyeballs and the mice were euthanized. A specific antibody against rMS087 in sera were evaluated via indirect ELISA. Briefly, 96-well ELISA plates (Corning Incorporated, Kennebunk, ME, USA) were coated with 100 μL of purified rMS087 protein (0.5 μg/mL) in 0.05 mol/L carbonate buffer (pH 9.6) overnight at 4°C after incubation at 37°C for 1 h. Then, the plates were blocked with 5% skim milk diluted with PBS and subsequently incubated with serially diluted sera (from 1:500 to 1:2,048,000). The produced antisera were used for identification of the distribution of MS087 in M. synoviae. The protocols were approved by the Institutional Animal Care and Use Committee of Southwest University (IACUC No. IACUC-20240322-01).

To determine the distribution of MS087 in M. synoviae, an indirect immunofluorescence assay (IFA) and Western blotting were performed. Suspension IFA was performed as previously described (38). Briefly, 50 mL of M. synoviae strain CQTL01 cultured in the late logarithmic growth phase was collected and washed three times with PBS by centrifugation. Afterward, the cells were incubated with mouse anti-rMS087 polyclonal antiserum or preimmune serum diluted at 1:10,000 with PBS containing 0.5% bovine serum albumin (BSA) overnight at 4°C with shaking at 70 r·min⁻¹. After washing, the cells were incubated with a 1:300 dilution of CoraLite488-conjugated goat anti-mouse IgG(H + L) (Proteintech, Wuhan, Hubei, China).

The cytoplasmic and membrane fractions of M. synoviae strain CQTL01 were separated using a membrane and cytoplasmic protein extraction kit (Biosharp, Hefei, Anhui, China) according to the manufacturer’s protocol. The supernatant of the culture medium after centrifugation was also collected. The cytoplasmic fraction and the culture supernatant were concentrated with a membrane and cytoplasmic protein extraction kit before SDS–PAGE. Proteins from different fractions were loaded onto an SDS–PAGE gel and subjected to electrophoresis. The proteins were subsequently transferred to a PVDF membrane. The membrane was blocked with 5% skim milk in TBST (pH 7.2) for 2 h at room temperature (RT). The membrane was then incubated with mouse anti-rMS087 polyclonal antiserum (1:10,000) in 5% skim milk diluted with TBST overnight at 4°C to block nonspecific binding. The samples were subsequently incubated with HRP-conjugated goat anti-mouse IgG (H + L) (1:10,000) (ABclonal, Wuhan, Hubei, China) at RT for 1 h. The protein bands were visualized using an ultra-enhanced chemiluminescence (ECL) reagent (Biosharp, Hefei, Anhui, China).

Three M. synoviae-negative serum samples were collected from broilers, three M. synoviae-positive serum samples were obtained from broilers, and three M. synoviae-positive serum samples were drawn from laying hens. The status of the sera was confirmed with an IDEXX M. synoviae ELISA antibody test kit. Therefore, in this assay, three serum samples were used as negative controls and six serum samples were designated positive controls according to the results from the commercial ELISA antibody test kit.

Briefly, the wells of microtiter plates (Corning Incorporated, Kennebunk, ME, USA) were coated with 100 μL of rMS087 protein at concentrations from 0.05 μg/mL to 8 μg/mL in 0.05 mol/L carbonate buffer (pH 9.6) at 37°C for 1 h and then at 4°C overnight. After the unbound antigen was discarded, the wells were washed five times with PBS containing 0.05% Tween-20 (PBST). Nonspecific binding was blocked by incubation with 200 μL of PBST, 1% BSA, 1% ovalbumin (OVA), 2.5% skim milk, or 1% gelatin at 37°C for 0.5 h to 4 h. After five washes with PBST, 100 μL of each serum sample (diluted from 1:50 to 1:8,000 in blocking buffer) was added and incubated at 37°C for 0.5 h to 3 h. After five washes, 100 μL of HRP-conjugated goat anti-chicken IgG(H + L) secondary antibody (Bioss, Beijing, China) (diluted from 1:5,000 to 1:640,000) was added and incubated at 37°C for 0.5–3 h. After washing with PBST, 50 μL of substrate A (100 mL H₂O containing 2.72 g of anhydrous sodium acetate, 0.35 g of citric acid monohydrate, 0.06 mL of 30% hydrogen peroxide) and substrate B (100 mL H₂O containing 0.04 g of EDTA·Na₂, 0.2078 g of citric acid monohydrate, 10 mL of glycerol, 0.0391 g of TMB·2HCl) (39) were added, the mixture was incubated at RT for 5–30 min, and the reaction was ended with the addition of 50 μL of 2 mol/L H₂SO₄. The optical density at 450 nm (OD₄₅₀) was recorded with an ELISA plate reader (Thermo Fisher Scientific, Ratastie 2, FI-01620 Vantaa, Finland). Each experiment was performed at least three times, and all samples were assayed in triplicate. The working conditions were optimized by determining the highest M. synoviae-positive (P)-to-negative (N) serum OD₄₅₀ ratios.

Three hundred and sixty-eight chicken serum samples were tested via the ELISA method established in this study, with three replicates for each serum sample. A receiver operating characteristic (ROC) curve was generated via GraphPad Prism 8.0 software on the basis of the average OD₄₅₀ values determined for the serum samples, with the value generated at the maximum value of the Youden index was set as the cut-off value (40, 41).

Reproducibility, i.e., intra- and inter-assay variation, between runs was determined as described previously (39), with minor modifications. In brief, four M. synoviae-negative and four M. synoviae-positive serum samples identified by both the commercial ELISA antibody test kit and the rMS087-based ELISA antibody test method were selected randomly for reproducibility experiments. Five replicates of each sample in the same batch were chosen for the intra-assay (within plate) variation assessment, and three plates from different batches were chosen for the inter-assay (between runs) variation assessment. The coefficient of variations (CVs) were calculated.

The cross-reactivity of the established ELISA method with other avian pathogen-positive sera was investigated by using positive sera against M. gallisepticum, Salmonella Pullorum-Gallinarum, A. paragallinarum serovars A, B, and C, Newcastle disease virus, and avian influenza virus subtypes H5, H7 and H9. Two M. synoviae-negative and two M. synoviae-positive serum samples confirmed by both the IDEXX M. synoviae ELISA antibody test kit and the ELISA antibody test method established in this study were used as controls.

Five M. synoviae-positive serum samples were diluted with blocking buffer as follows: 1:500, 1:1,000, 1:2,000, 1:4,000, 1:8,000, 1:16,000, 1:32,000, and 1:64,000. Then, ELISA was carried out with the optimal working conditions except for the optimal dilution of the serum. The maximum dilution of sera for the ELISA was assessed according to the cut-off value.

Anti-M. synoviae antibodies were tested in 368 chicken serum samples via both a commercial ELISA antibody test kit and the rMS087-based ELISA antibody test method, with three replicates for each serum sample.

The full length of the ms087 gene in the M. synoviae CQTL01 strain was 606 bp, and the gene did not contain a TGA codon, encoding tryptophan in Mycoplasma. The amino acid sequence shared over 97% homology with proteins of M. synoviae strains deposited in the GenBank database and had no more than 40% homology with the proteins of other Mycoplasma species according to the BLAST analysis (Supplementary Figure S1). For example, the amino acid sequence of M. synoviae had no more than 32% homology with the amino acid sequence of M. meleagridis and had no more than 21% homology with the amino acid sequence of M. canis. The ORF was predicted to encode a protein containing 201 amino acids with a MW of 23 kDa. The amino acid sequence of the MS087 protein was predicted to possess a signal peptide cleaved by signal peptidase I of the Sec translocator (the cleavage site is between amino acid positions 24 and 25) but lacked a transmembrane domain. Both CELLO v.2.5 and Gpos-mPLoc calculated that MS087 could be secreted by the organism as an extracellular protein. However, MS087 was predicted to have an antigenicity score of 0.3061 (the threshold score for antigenicity is 0.4).

The full-length ms087 gene was amplified from the CQTL01 strain via PCR (Figure 1A) and then cloned and inserted into the pET-30a(+) vector, which was subsequently successfully transformed into E. coli BL21(DE3) competent cells. After IPTG induction of the transformed cells, His-tagged rMS087 was expressed in soluble and inclusion body forms by the recombinant bacteria harboring the ms087 gene (Figures 1B,C) and the purity of soluble rMS087 after purification was confirmed by SDS–PAGE (Figure 1D).

Purified rMS087 was used to generate rMS087 antiserum by immunization of BALB/c mice. The titers of the anti-rMS087 antibody in the sera of 5 mice were 1:1,024,000, 1:512,000, 1:256,000, 1:25,600, and 1:512,000. Antiserum with an antibody titer of 1:1,024,000 was used randomly for the subsequent experiments, and this antiserum could react with rMS087 of the recombinant bacteria (Figure 2A).

IFA and Western blotting were performed to determine the distribution of MS087 in M. synoviae via the mouse anti-rMS087 polyclonal antiserum. In the suspension IFA, green fluorescent puncta were observed on the surface of the CQTL01 strain after incubation with mouse anti-rMS087 serum, whereas no fluorescent signal was observed after incubation with preimmune mouse serum (Figure 2B). These results implied that MS087 was localized on the surface of M. synoviae. The distribution of MS087 in M. synoviae was subsequently analyzed via Western blotting (Figure 2C). The mouse anti-rMS087 serum reacted with whole cell proteins, as well as membrane, cytoplasmic and extracellular proteins, at approximately 31 kDa, suggesting that MS087 is present in both the membrane and cytoplasm of M. synoviae and can even be secreted from the organism.

Optimization of the working conditions for the detection of anti-M. synoviae antibodies in chicken sera involves the optimal antigen concentration, blocking buffer, blocking duration, serum dilution, serum incubation duration, secondary antibody dilution, secondary antibody incubation duration, and colorimetric reaction duration. As shown in Figure 3A, 100 μL of purified rMS087, adjusted to a concentration of 2 μg/mL with 0.05 mol/L carbonate buffer, was added to each well. After the unbound antigen was discarded, 200 μL of 1% BSA diluted with PBS (Figure 3B) was used to block nonspecific binding at 37°C for 3 h (Figure 3C). The optimal dilution of serum with 1% BSA was 1:500 (Figure 3D), and the optimal incubation time for the serum samples was 1.5 h (Figure 3E). As shown in Figure 3F, the P/N ratio increased with increasing HRP-conjugated goat anti-chicken IgG (H + L) secondary antibody dilution, reached a maximum at 1:20,000 and subsequently decreased with increasing serum dilution. Moreover, the highest P/N ratio was obtained after incubation with the secondary antibody for 2 h (Figure 3G). Finally, the highest P/N value was obtained when the enzyme reacted with the substrate for 5 min (Figure 3H).

One hundred and fifty-eight serum samples from broilers and 210 serum samples from layers were assessed via the M. synoviae ELISA antibody method based on rMS087. The ROC curve was generated on the basis of the values obtained from 368 serum samples, with the maximum value of the Youden index as the cut-off value. The maximum Youden index was 0.958, and the cut-off value was 0.5, indicating that when the OD₄₅₀ value of the serum to be tested was ≥0.50, the sample was considered as positive for anti-M. synoviae antibodies; when the OD₄₅₀ value was <0.50, the sample was considered as negative for anti-M. synoviae antibodies.

The reproducibility of the rMS087-based ELISA was assessed by determining the intra- and inter-assay variation. The intra-assay CVs of 4 negative serum samples and four positive serum samples ranged from 1.32 to 5.50%, and the inter-assay CVs of these samples ranged from 4.01 to 8.77%, suggesting that the ELISA results are reproducible, yielding low and acceptable variation.

The ELISA exhibited no cross-reactivity with sera containing antibodies against nine avian pathogens (Figure 4). These data indicated that the ELISA was specific to anti-M. synoviae antibodies induced by natural infection and that there was no cross-reaction with antisera against other avian pathogens.

As shown in Figure 5, with increasing dilution ratio of the serum, the OD₄₅₀ value decreased gradually. Five serum samples at a dilution of 1:1,000, three at a dilution of 1:2,000, and one at a dilution of 1:4,000 were considered positive, whereas no serum sample at a dilution of 1:8,000 or more were considered positive, suggesting that the serum can be diluted up to 1,000 times when using this method.

Serum samples collected from two slaughterhouses and five poultry farms were tested via a commercial ELISA kit and the rMS087-based ELISA method. The results are shown in Table 2. The results of the commercial ELISA kit and the rMS087-based ELISA were inconsistent in 28 samples. The total agreement between the commercial ELISA kit and the rMS087-based ELISA was 92.4%, with the sensitivity and specificity of the rMS087-based ELISA being 93.2% and 91.5% compared to those of the commercial ELISA kit, respectively. However, the rMS087-based ELISA method (52.4%, 193/368) could detect more M. synoviae-positive serum samples than commercial ELISA kit (51.9%, 191/368).