Salmonella enterica serovar Gallinarum biovar Gallinarum (S. gallinarum) NCTC13346 (SG287/91) strain was used as the parent strain (WT) of the gene-deficient strain. pCP20, pKD3, and pKD46 were used to create a strain lacking the SPI-14 genes (SG0835-0836). pCP20 is a temperature-sensitive plasmid, and the genetic recombination enzyme encoded by pCP20 recognizes the Flippase Recognition Target (FRT) sequences located at both ends of the chloramphenicol resistance cassette of pKD3 and removes the chloramphenicol resistance cassette that has replaced the target gene (13). The WT and mSPI-14 were streaked onto Luria-Bertani (LB) agar (Eiken Chemical, Tokyo, Japan) plates using a platinum loop, cultured overnight at 37°C, and the resulting single colony was inoculated into LB broth (Eiken Chemical) and cultured at 37°C with shaking at 150 rpm to prepare a bacterial suspension for next experiments.

SPI-14 contains the genes of SG0834-0839, among which 0835 and 0836–0838 are genes with distinct functions (Figure 1A). Therefore, the SG0835 and SG0836 genes contained in SPI-14 were deleted from the parental WT strain according to the previously reported methods (18, 19). In brief, the PCR primers, SG0835-0836F-1 (TATTGAATTATCAGATGCTCCATTCAAATGAGAGACGA GAGTAGGCTGGAGCTGCTTCTT) and SG0835-0836R-1 (GTTATGTTCAGCAATAACTAAA GAAGCCATATTTTCCTCCCATATGAATATCCTCCTTAG), were used to amplify the chloramphenicol resistance cassette, and the SG0835-0836 region was replaced by homologous recombination. To remove the chloramphenicol resistance cassette (Cm) that replaced SG0835-0836 on the genome, pCP20 was transformed into the competent cells of the SG0835-0836::Cm strain in perforated cuvette (0.1 cm gap) using Gene Pulser® II and electroporation (1.8 kV, 25 μF, 200 Ω). The transformed colonies were spread on LB agar plates and cultured at 42°C overnight to remove Cm and shed pCP20 to obtain SGΔ0835-0836. Cm removal was confirmed by colony PCR using the primers SG0835-0836F-2 (TAGCATCGGTCATCAGGCACAAG) and SG0835-0836R-2 (TTTTCACCA TGGGCAAATAT), which anneal to the flanking regions 500 bp away from SG0835-0836. The constructed SGΔ0835-0836 strain was named mSPI-14 mutant.

To compare the growth characteristics of WT and mSPI-14 in vitro, each strain was cultured in LB broth at 37°C with shaking at 150 rpm for 14 h. The cultured bacterial culture was diluted with LB broth to an optical density (OD_{600 nm}) =1.5, and 100 μL of the diluted suspension was inoculated into 10 mL of LB broth, cultured at 37°C with shaking 150 rpm, and the absorbance (OD_{600 nm}) of the culture suspensions were measured at 2, 4, 6, 8, 10, 12, and 24 h after incubation. On the other hand, the number of bacteria in the culture suspensions was counted by applying bacterial culture on LB agar and DHL agar plate, which were incubated at 37°C overnight. Colonies on the plates were counted as colony-forming units (CFU). To compare the colony morphology and cell shape of the WT and mSPI-14, we spread WT and mSPI-14 bacterial liquids on LB agar plates, incubated at 37°C for 18 to 24 h, and observed the colony morphology. Gram stain was performed on fresh single colony smears of each strain, and the shape of the cells was observed under a microscope. To investigate whether growth ability changes between WT and mSPI-14 in different culture conditions, we observed bacterial growth in LB broth containing bile acids (final concentration was 0.01 or 0.02 mM, Sigma-Aldrich), hydrogen peroxide (final concentration of 0.5 or 1.0 mM, Wako, Osaka, Japan), or nalidixic acid (final concentration of 1.25 or 2.5 μg/mL, Wako) in 96-well flat-bottom plates (Greiner BioOne, Kremsmünster, Austria), respectively (19). The plates were incubated at 37°C without shaking, and the bacterial growth at the indicated time points was determined by monitoring the optical density (OD_{600 nm}) using a 96-well plate reader (Bio-Rad, model 680 microplate reader, Hercules, CA, United States).

Chicken infection experiments were conducted in accordance with the regulations for animal experiments specified in the Animal Welfare Act and the Guide for the Care and Use of Laboratory Animals. The animal experiment protocol was reviewed and approved by the Kitasato University Animal Care Committee (approval numbers: 20–055 and 21–039). Boris brown hens (20-day-old) were housed and provided water and food ad libitum. To confirm the absence of Salmonella in the flock, fecal swabs were collected from breeding cages, and the bacteriological detection of Salmonella was performed before the experimental infection (5, 20). Each chicken was orally inoculated with 10⁸ CFU WT or mSPI-14 strain in a volume of 1.0 mL by oral gavage (the number of chickens in each group is 5). The chickens were housed and kept for 14 days, and any clinical signs were observed and recorded twice a day for monitoring. The above experiment was repeated twice. Every effort was made to reduce animal suffering during experiments. These infection experiments were performed at the same time using the WT and mSPI-14 strains, as well as two other mutant strains (wecB::Cm and trxB::Cm) that were not shown in this article.

Chickens were inoculated orally with 10⁸ CFU of WT or mSPI-14 or with 1.0 mL of PBS as an uninfected control using the method described above. The chickens were euthanized on days 1, 3, 5, and 7 post-infection. Liver and spleen samples were collected aseptically from 3 to 5 chickens in each group at each time point. The organ samples were then diluted 10-fold with PBS to make homogenates, serially diluted 10-fold with PBS, and plated onto LB agar plates. After incubation at 37°C for 24 h, the numbers of colonies on the plates were determined and calculated as CFU/g organ.

Clinical changes, including redness and discoloration of the comb and ruffled feathers, of chickens inoculated with WT, mSPI-14, or PBS were observed, recorded, and evaluated for the occurrence of systemic infection. The extent of inflammation of the liver and spleen from 3 to 4 chickens in each group was investigated at 1, 3, 5, and 7 days after inoculation by observing swelling, congestion, bleeding, redness, and discoloration of the tissues. To assess histological changes and inflammation levels, livers and spleens from each group were fixed in 4% paraformaldehyde (pH 7.4) at 4°C for 24 h and embedded in paraffin. Sections were cut at three levels to a thickness of 4 μm and stained with hematoxylin–eosin (HE) staining. Histological changes, such as the infiltration of inflammatory cells and tissue damage, were recorded and photographed.

RNA was extracted from the livers of chickens infected with WT or mSPI-14 strain and PBS control on days 3 and 5 after infection, and the expression levels of inflammatory cytokines and chemokines were measured by real-time PCR according to our previously reported methods (17, 19). GAPDH was used as an endogenous control, and IL-1β, IL-6, TNF-α, IL-12, IFN-γ, and CXCLi1 were used as target genes. The expression of the genes was determined using the threshold cycle (ct) value relative to that of the housekeeping gene GAPDH, and the results were expressed as fold changes in the corrected target gene in the infected chickens relative to the uninfected controls.

Bacterial counts were expressed in logarithms, and significant differences in the bacterial counts or OD values between WT and mSPI-14 average value at each time point were tested using Student’s t-test. In the analysis of cytokine expression levels, significant differences among the three groups in the expression levels of the WT inoculated group, mSPI-14 inoculated group, and uninfected (PBS) control group at each sampling day after inoculation were tested through one-way ANOVA analysis followed by Tukey’s multiple comparison test. Statistical analysis was performed using GraphPad Prism 9.3.0 (GraphPad Software, San Diego, CA, United States), and a significant difference was determined when the p values were < 0.05.

We first compared the bacterial growth characteristics of WT and mSPI-14 strains. The bacterial culture with the OD₆₀₀ value of WT or mSPI-14 strain was inoculated into LB liquid medium and cultured with shaking at 37°C for 24 h; no significant difference was observed in the OD₆₀₀ value and the numbers of viable bacteria between the WT and mSPI-14 strains (Figures 1B,C). There was no significant difference in colony size and morphology between the WT and mSPI-14 strains when observing the colonies generated on LB agar and DHL agar plate medium (Figure 1D). We also compared the shapes of Gram-stained bacterial bodies; no abnormality was observed in the shape of the mSPI-14 strain, and no significant differences in morphology were observed between the WT and mSPI-14 strains (Figure 1E).

Since it is known that the wild type of S. gallinarum is resistant to bile acids and sensitive to hydrogen peroxide (H₂O₂) and nalidixic acid, we evaluated the effects of SPI-14 gene deletion on the resistance to bile acids and sensitivity to H₂O₂ and nalidixic acid. In the LB broth with different concentrations of bile acid, the mSPI-14 mutant showed significantly reduced OD values from 4 h after exposure to the concentrations of 0.01 or 0.02 mM bile acid, indicating mSPI-1 is more sensitive to bile acid than the WT strain (p < 0.01, Figure 2A). To examine if the SPI-14 is also relevant for antibiotic resistance, the growth of the mSPI-14 and WT strains were analyzed in LB broth supplemented with different concentrations of nalidixic acid. There were similar OD values at 1.25 μg/mL nalidixic acid and no significant difference in the growth between mSPI-14 and WT strains. In addition, both mSPI-14 and WT strains abrogated growth when the concentration of 2.5 μg/mL was added to the media (Figure 2B). In addition, the mSPI-14 showed comparable growth to the WT strain after exposure to LB broth with 0.5 and 1.0 mM H₂O₂ (Figure 2C).

To investigate the pathogenic roles of SPI-14 in the systemic infection of chickens induced by S. gallinarum in vivo, we analyzed the clinical changes and mortality in chickens orally infected with the mSPI-14 or WT strain. The chickens infected with 10⁸ CFU of WT showed significant disturbance or depression, which are the typical clinical symptoms of fowl typhoid, and all of the WT-infected chickens died by 9 days post-infection (Figure 3A). In contrast, the chickens infected with mSPI-14 at the same dose as the WT strain exhibited no significant clinical changes, and all of the chickens survived until the end of the observation period.

To analyze the spread and colonization of WT and mSPI-14 in the infected chickens, we counted and compared the numbers of viable bacteria in the organs of the infected chickens. The bacterial burdens in the liver and spleen of WT-infected chickens were detected 1 to 7 days after oral infection. The number of viable bacteria in the liver of WT-inoculated chickens continued to increase, and numbers of 1.96 × 10², 1.08 × 10³, 1.09 × 10⁶, and 2.09 × 10⁷ CFU/g were detected on days 1, 3, 5, and 7 post-inoculation, respectively (Figure 3B). On the other hand, the number of bacteria in the livers of mSPI-14-infected chickens was 1.15 × 10 CFU/g, 0.29 × 10 CFU/g, and 0.53 × 10 on days 3, 5, and 7 after inoculation, which was significantly lower than that of WT-infected chickens. Similar to the liver, the number of bacteria in the spleen of WT inoculated chickens significantly increased and were detected as 2.85 × 10, 5.75 × 10², 5.41 × 10⁵, 1.7 × 10⁷ CFU/g from day 1 to 7 after inoculation (Figure 3C). The counts of bacteria in the spleen of mSPI-14-infected chickens were also significantly lower than those of the WT-infected chickens (p < 0.01).

It is known that the most characteristic pathological findings of fowl typhoid are hypertrophy, white lesions, and small necrotic foci, which were observed in the liver of infected chickens (5). We next compared the pathological changes in the liver of chickens infected with WT and mSPI-14 strains. Macroscopic observation of the liver of chickens inoculated with WT showed that white dot-like lesions and small necrotic lesions appeared 5 days after inoculation, and 7 days after inoculation, more white lesions, congestion, turbidity, and swelling appeared. In contrast, no obvious lesions were observed in chickens infected with mSPI-14 (Figure 4).

Next, we performed the histopathological examination of the liver and spleen of infected chickens to determine whether SPI-14 is related to tissue inflammation caused by S. gallinarum. In the liver tissues of WT-inoculated chickens, inflammatory features, such as focal necrosis of hepatocytes, pseudo-eosinophils, and lymphocyte clusters, were observed from days 3 to 5 after inoculation. The extent of inflammation and tissue destruction increased and expanded (Figure 5A). Furthermore, extensive coagulation necrosis was observed in the spleen tissues of WT-inoculated chickens 5 days after inoculation. In contrast, no remarkable histopathological changes were observed in the liver of chickens inoculated with mSPI-14. Furthermore, extensive coagulation necrosis was observed in the spleen tissues of WT-inoculated chickens 5 days after inoculation. There were no significant histopathological changes in the spleen of mSPI-14-inoculated chickens (Figure 5B).

We further analyzed and compared the immune responses of chickens infected with WT and mSPI-14. The expression of cytokine and chemokine genes, IL-1β, IL-6, TNF-α, IFN-γ, IL-12, and CXCLi1 in the liver of chickens were detected 3 to 5 days post-infection. In the livers of the WT inoculated group, the expression level of TNF-α mRNA was increased 3 days after inoculation compared to the uninfected control group (p < 0.05, Figure 6). At 5 days after inoculation, the mRNA expression levels of TNF-α, IL-12, and CXCLi1 were more significantly increased (p < 0.01), and the increased expression of IL-1β and IFN-γ was also observed at 5 days post-infection (p < 0.05). In contrast, no significant changes in cytokine expression were observed in the liver of the mSPI-14 inoculated group compared with the uninfected control group (Figure 6). Importantly, the expression levels of IL-1β, TNF-α, IFN-γ, IL-12, and CXCLi1 in the livers of the mSPI-14-infected group were significantly lower compared with that of the WT-infected group (Figure 6).