The protocol was approved by the Committee of Animal Experiments of South China Agricultural University, Guangzhou, China (Approval ID: SYXK-2019-0136). All biological safety and sanitation measures were observed.

The linear B cell epitopes of σB protein (TH11 strain, NCIB accession No. AFX68863.1) were predicted using Bepipred Linear Epitope Prediction 2.0 (http://tools.iedb.org/bcell/) (21). The multiple-epitope subunit vaccine was constructed using the B-cell epitopes through a GGGGG linker, and codon optimization was achieved using the Java Codon adaptation tool (http://www.jcat.de/) to improve its expression level in the BL21 (DE3) strain of E. coli (21). The optimized sequence was synthesized by Sangon Biotech (Shanghai, China) and cloned into the pSmart-I vector (Convenience Biology, Changzhou, China) downstream of the Sumo gene using the BamH I and Xho I restriction sites. The recombinant plasmid was used to transform the E. coli BL21 (DE3) cells; single colonies were selected and grown in LB medium with 50 μg/mL kanamycin at 37°C until an OD₆₀₀ of 0.5–0.6 was reached. Protein expression was induced by adding isopropyl β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM and incubated at 16°C overnight. Cells were collected, resuspended in buffer A [20 mM Tris, 250 mM NaCl, 5% (V/V) glycerine; pH ± 8.0], and ultrasonicated. The cell lysate was centrifuged at 13,000 g and 4°C for 30 min. The recombinant proteins in the supernatant were purified by nickel-nitrilotriacetate (Ni-NTA) affinity chromatography, as previously described (22). Briefly, the supernatants were loaded on the Ni-NTA agarose by gravity flow and washed with buffer B (20 mM Tris, 250 mM NaCl, 50 mM imidazole; pH 8.0). The protein of interest was eluted with buffer C (20 mM Tris, 250 mM NaCl, 250 mM imidazole; pH ± 8.0). The eluate was dialyzed in PBS buffer (pH 7.4) and analyzed via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and western blotting.

The purified rMLBE protein or PBS was mixed with oil adjuvant to obtain the rMLBE or control vaccines, respectively. For the animal studies, 60 one-day-old NDRV-free Muscovy ducks were supplied by the Wens Food Group Co. Ltd. and randomly divided into four groups of 15 each. Of them, three groups were immunized with 10, 20, and 40 μg of rMLBE vaccine on day 0; while one group was immunized with PBS. Sera from the immunized groups were collected at 0, 7, and 14 days post-vaccination (DPV) for antibody detection. The birds were challenged with 5 × 10⁴ ELD₅₀ of the NDRV CHY strain at 14-DPV. Three ducks from each group were sacrificed at 3, 5, and 7 days post-challenge (DPC), and their spleens and livers were collected for viral load determination.

The specific IgY antibody titer was determined by indirect enzyme-linked immunosorbent assay (ELISA) using sample sera diluted 100-fold in PBST with 2 mg of E. coli lysates and 10 μg of sumo-tag protein. Briefly, 96-well microtiter plates (Costar, USA) were coated with 1 μg/well of purified ΣB protein in 0.1 M carbonate/bicarbonate buffer (pH ± 9.6) and incubated at 4°C overnight. After washing thrice in PBST, the plates were blocked with 5% BSA in PBST for 1 h at 37°C. After washing thrice in PBST, 100 μL of the diluted serum was added to the microtiter wells and incubated for 1 h at 37°C. After washing thrice in PBST, 100 μL of horseradish (HRP)-conjugated anti-duck IgY antibody diluted to 1:3000 in PBST (KPL, USA) was added and incubated for 1 h at 37°C. After washing thrice in PBST, 100 μL of 3,3′,5,5′-Tetramethylbenzidine (TMB) was added to each well and incubated for 10 min at room temperature. The reaction was stopped by adding 50 μL of 2 M H₂SO₄, and the OD₄₅₀ was measured. The S/P was calculated using the formula: S/P = (OD test serum-OD negative control serum)/(OD positive control serum-OD negative control serum). The test serum was considered positive when the S/P was > 0.2.

Fluorescent quantitative (qRT-PCR) was used to determine the viral load of NDRV in the tissues as described previously (23). The tissues were homogenized, and viral RNA was extracted using MagPure Viral Nucleic Acid Micro LQ Kit (Magen, Guangzhou, China). qRT-PCR was performed as described previously (24) using a One Step RT-qPCR Probe Kit (Yeasen, Shanghai, China) with the forward primer: CCCGGATTCTCGATGAATGGT, reverse primer: CGACCCACTGCTGGATACAAG, and the probe: FAM-AACGCCTGTGCACGAGCTGAAC-3′-TAMRA under the following conditions: 50°C for 15 min, 95°C for 2 min, 40 cycles of 94°C for 15 s, and 60°C for 30 s. The viral load was determined using a standard curve. Each sample was run in triplicates.

Livers and kidneys of the ducks of different groups were collected 3, 5, and 7 DPC and fixed in 10% formalin for 48 h at 25°C. These tissues were embedded in paraffin wax, sliced into 4-μm-thick sections, stained with hematoxylin and eosin (HE), and then examined using light microscopy.

Statistical analyses of IgY antibodies were conducted using two-way ANOVA by GraphPad Prism 6 (www.graphpad.com). Statistical analyses of the results of other experiments were performed using an unpaired t-test. Differences were considered significant at ^*p < 0.05, ^**p < 0.01, or ^***p < 0.001.

σB is an outer layer protein of NDRV. Therefore, it was proposed that sigma could induce immunological protection. The linear B cell epitopes of σB protein were predicted using Bepipred Linear Epitope Prediction 2.0. When the value was >0.5, the peptides with more than 15 residues were chosen for constructing the multiple linear B cell epitopes. As shown in Figure 1 and Table 1, five epitopes were selected and linked with the flexible peptide “GGGGG.” The expression and purification of MLBE were ascertained by SDS–PAGE and western blotting. As shown in Figures 2A, B, MLBE was successfully expressed and purified.

The birds were immunized with different dosages of MLBE, and sera were collected on the indicated dates. NDRV-specific antibodies produced in the birds were detected by indirect ELISA. As shown in Figure 3A, the serum conversion rate of ELISA antibodies was 100% in the 20 and 40 μg immunized birds on 7 DPV and 14 DPV, whereas only one bird was positive among those immunized with 10 μg on 7 DPV. The serum conversion rate was 100% in these birds on 14 DPV. Moreover, the OD₄₅₀ values of 20- and 40-μg immunized birds were significantly higher than the 10 μg-immunized birds on 7 and 14 DPV. However, there was no statistical difference between the 20- and 40 μg-immunized birds. These data indicate that σB MLBE can induce positive immune responses, significantly increasing antibody levels.

To assess the protective ability of MLBE, the birds were challenged at 14 DPV, and the clinical symptoms, gross lesions, and histologic microlesions were monitored. At 7 DPC, two birds died in the PBS group (Figure 3B), whereas no birds died during the challenge period in the immunized groups. Three birds were sacrificed for the examination of lesions. The liver and spleen are the primary target organs of NDRV. As shown in Figure 3, slight lesion spots in the liver were observed in the PBS group at 5 DPC (Figure 4E), whereas massive lesion spots were observed at 7 DPC (Figure 4J). Only slight blood spots were observed in the livers of the 10-μg MLBE group at 5 DPC (Figure 4F). No apparent lesions were observed in the livers of the 20- and 40-μg MLBE groups from 3 to 7 DPC (Figure 4). Lesion spots were also observed at 5 and 7 DPC in the PBS group (Figures 5E, J). Otherwise, the spleen was swollen in the 10-μg MLBE group at 5 and 7 DPC (Figures 5F, K). As expected, no noticeable lesions were observed in the spleen of 20- and 40-μg MLBE groups from 3 to 7 DPC (Figure 5).

The corresponding tissues were fixed, sectioned, and stained with HE (Figures 6, 7). Massive pathological damage was observed in the livers of the birds in the PBS group (Figure 6). Necrosis of local hepatocytes and cytolysis were observed at 5 DPC, around which massive inflammatory cell infiltration and hyperpigmentation were evident (Figure 6E). Focal necrosis of hepatocytes and nucleus fragmentation and nucleolysis were also observed at 7 DPC (Figure 6J). No noticeable pathological change was observed in the immunized groups (Figure 6). Massive pathological damage was also observed in the spleens of the PBS group ducks (Figure 7). An enlarged spleen and an unclear boundary were observed at 3 and 5 DPC (Figures 7A, E), whereas massive necrosis with hemorrhage was observed at 7 DPC (Figure 7J). Spleen and lymphatic nodule enlargement were also observed at 5 and 7 DPC in the 10-μg MLBE group (Figures 7F, K), but no evident pathological change was observed in the 20 and 40-μg MLBE groups. These results demonstrated that the MLBE of σB protein protected birds against virulent NDRV-induced pathological changes.

From each group, six cloacal swabs were collected at 3, 5, and 7 DPCs for detecting viral shedding using qRT-PCR. As shown in Table 2, viral shedding in a high proportion of birds in the PBS and 10-μg MLBE groups was observed at 5 and 7 DPC. A low proportion of birds in the 20- and 40-μg MLBE groups demonstrated viral shedding at 5 DPC, while only 3/6 birds in the 20 μg and 2/6 birds in the 40-μg MLBE group shed virus particles (Table 2). These results indicated that MLBE can impede viral shedding.

The liver and spleen tissue from each group at 3, 5, and 7 DPC were collected for viral load detection. As shown in Figure 8A, the viral load in the livers from the 20-μg MLBE group was markedly lower than that from the PBS group (p < 0.05 or p < 0.01) at 3, 5, and 7 DPC, and the viral load in the livers from the 40-μg MLBE group was also remarkably lesser than that from the PBS group (p < 0.01). The virus load was not significantly different between the PBS and 10-μg MLBE groups. Similarly, the viral load in the spleens from the 20-μg MLBE group was substantially lower than that from the PBS group (p < 0.05 or p < 0.01) at 3, 5, and 7 DPC, and the viral load in the spleens from the 40-μg MLBE group was also significantly lower than that from the PBS group (p < 0.01). The viral load in the spleens from the 10-μg MLBE groups was also considerably lower than that from the PBS group at 7 DPC (p < 0.01), and there was no marked variation at 3 and 5 DPC (Figure 8B). These results indicate that MLBE vaccination can reduce the replication of NDRV in the livers and spleens.