Antimicrobial Peptides OaBac5mini (N-RFRPPIRRPPIRPPFRPPFRPPVR-C) was prepared via solid-phase synthesis using 9-fluorenylmethoxycarbonyl (F-moc) chemistry at GL Biochem (Shanghai) Ltd. and analyzed by HPLC and MALDI-TOF MS to confirm that the purity was >91.06%.

Amoxicillin, kanamycin, florfenicol, and tetracycline were purchased from China National Institute for Drug and Biological Products Control (Beijing, China). Polymyxin B sulfate (PMB) purchased from Beijing Solarbio Science & Technology co., Ltd (Beijing, China).

The strains of E. coli ATCC 25922 and S. aureus ATCC 25923 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, United States). The strains of E. coli W13, E. coli IF4, E. coli 2, and E. coli 17 were individually isolated from the livers of diseased chickens infected by E. coli. The strains of S. aureus B5, S. aureus B9, S. aureus B54, and S. aureus B63 were individually isolated from the milk of cows with mastitis. These clinical isolates were all identified by the VITEK-32 system (bioMérieux, France) and PCR amplification sequencing.

IPEC-J2 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, United States). IPEC-J2 cells were cultured in High Glucose DMEM (Dulbecco's Modified Eagle Medium, HyClone, USA) supplemented with 10% fetal bovine serum (Biological Industries, Israel), and 1% penicillin-streptomycin (Solarbio, China). The cells were maintained in CO₂ incubator (Galaxy R, RS Biotech, Scotland) with 5% CO₂ at 37°C.

The method described by Datsenko and Wanner was used for chromosomal gene deletion (20). In brief, the genetic fragment containing the kanamycin resistance gene aph flanked by FLP Recognition Target (FRT) sites was amplified by PCR using the template plasmid pKD4 and the hybrid primers LBMAF:5′-GGCAG ATCCCGATTAGCGCCGCGCGTTTCTGGTCGTTGGATTTCCGTGTAGGCTGGAGCTGCTTC-3′ and LBMAR: 5′-CTCGCGTACCGTAGGCGGCGTCGCGCGCGTGGCATCGTCTTCACCCATATGAATATCCTCCTTAG-3′, which consisted of 20 nucleotides (nt) of the helper plasmid pKD4 and 45 nt on the 5′ and 3′ ends of the inactivated sbmA. The PCR fragment (1,567 bp) was purified, digested with DpnI, repurified and transferred into E. coli ATCC 25922 by electroporation, in which the Red recombinase expression plasmid pKD46 was previously transformed and induced by L-arabinose. Transformants were selected on Luria-Bertani (LB) agar containing 50 μg/ml of kanamycin at 37°C. The inserted sequence was amplified from the kanamycin-resistant strains by using the primers SBMF: 5′-GCACGGCAGAAAAAAGCA-3′ and SBMR: 5′-GACGGAAACAGCAAGAACAAA-3′ which is located outside of inactivated gene. The length of the PCR product of sbmA using the primers set SBMF and SBMR in E. coli ATCC 25922 is 1,404 bp. When sbmA is successfully inactivated, the PCR product (2,198 bp) was amplified and sequenced for the verification of the gene deletion.

MICs of OaBac5mini, amoxicillin, kanamycin, florfenicol and tetracycline were determined using the two-fold broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) guidance (21). MIC values of the tested antibacterial agents were determined on three independent occasions. Escherichia coli ATCC 25922 was used as the quality control in all the susceptibility tests.

To determine the effect of different salt ions on the antibacterial activity of OaBac5mini, MIC values of OaBac5mini were tested at different physiological salt concentrations (150 mM NaCl, 4.5 mM KCl, 6 μM NH₄Cl, 1 mM MgCl₂, 2.5 mM CaCl₂, and 4 μM FeCl₃) as described by Maisetta et al. (22).

The sensitivities of OaBac5mini to different pH, temperature, digestive enzymes, and repeated freeze-thawing conditions were determined using the inhibition zone assay as previously described (23). For pH sensitivity, OaBac5mini was diluted with each solution whose pH was individually adjusted to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 with HCl or NaOH, and incubated for 2 h, followed by adjusting the pH to 7 to end the reaction. For temperature sensitivity, the diluted peptide was incubated at 30, 40, 50, 60, 70, 80, 90, and 100°C for 30 min. To determine the digestive enzymes sensitivity, OaBac5mini was incubated with 100 μg/ml pepsin (in pH 2 sterile water, sigma, USA), 5–100 μg/ml trypsin (in pH 6.8 KH₂PO₄ buffer, sigma, USA) and 100 μg/ml protease K (Solarbio, China) at 37°C for 3 h, respectively. To end the reaction after incubation, the pepsin buffer was adjusted to pH 8, the trypsin solution and protease K solution were incubated at 95°C for 10 min. For repeated freeze-thawing sensitivity, OaBac5mini was frozen and then thawed at room temperature 0–12 times. All the final concentrations of OaBac5mini in sensitivity tests were 50 μg/ml. All experiments were repeated three times.

To investigate the time-kill effect of OaBac5mini against E. coli ATCC 25922, bacteria (5×10⁵ CFU/ml) were cultured in fresh Mueller-Hinton (MH) broth (Yashi Organisms, China) with different concentrations of OaBac5mini (0, 50, 100, and 200 μg/ml) at 37°C with shaking at the speed of 220 rpm. Equal amounts (100 μl) of E. coli ATCC 25922 from each sample were withdrawn at 0, 2, 4, 6, 8, 10, 12, and 24 h, diluted with Luria-Bertani (LB) broth (Solarbio, China) and plated onto LB agar plates. Plates were placed at 37°C for 18 h for the CFU counts.

The fresh blood was collected from rabbit hearts, and then centrifuged and rinsed with phosphate-buffered saline (PBS) three times. The 1:100 diluted rabbit blood cells (RBCs) solution was mixed with an equal volume of OaBac5mini solution (3.125–400 μg/ml final concentrations), PBS (negative control) and 0.1% Triton X-100 (Solarbio, China, positive control), respectively, followed by incubating at 37°C for 1 h. The mixed solution was centrifuged and 100 μl of the supernatant was added into a 96-well plate. The optical density (OD) of samples was monitored immediately using INFINITE 200 PRO (Infinite^® 2000, TECAN, Austria) at an absorption wavelength of 413 nm. The experiment was conducted in triplicate. The OD value at 413 nm was used to calculate the hemolysis ratio with the formula below:

AS is the OaBac5mini-treated sample, AN is the negative control, AP is the positive control.

Real time cellular analysis (RTCA) was used to evaluate the proliferation and viability of IPEC-J2 cells. Cells were seeded in 16-well E-plates (xCELLigence, ACEA biosciences, USA) at the concentration of 20,000 cells per well, allowing attachment overnight, and then high glucose MEM was replaced by fresh complete MEM with different concentrations of OaBac5mini (25, 50, 100, 200, and 400 μg/ml). Real time cellular analysis was monitored using xCELLigence RTCA DP system (xCELLigence, ACEA biosciences, USA) for 100 h at 15 min intervals. The cell index was normalized by RTCA software 2.0 (xCELLigence, ACEA biosciences, USA).

To investigate the antibacterial mechanism of OaBac5mini, the physicochemical properties of OaBac5mini were analyzed using ProtParam software (https://www.expasy.org/resources/protparam/) in protein and proteomes resources of ExPASy (24), the Swiss Bioinformatics Resource Portal. Furthermore, the hydrophilic and hydrophobic regions were predicted using the ProtScale tool with Hphob./Kyte & Doolittle scale (https://web.expasy.org/protscale/). The secondary structure was predicted by PHD on the NPS@ server (https://npsa-prabi.ibcp.fr/NPSA/npsa_phd.html). The three-dimension (3D) model was predicted by PEP-FOLD3 (https://bioserv.rpbs.univ-paris-diderot.fr/services/PEP-FOLD3/).

The permeability of OaBac5mini to E. coli ATCC 25922 cell membranes was determined by N-Phenyl-1-naphthylamine (NPN, sigma, India), which is a fluorescent dye that only can pass through the damaged cell membrane and exhibit an increase of fluorescence. The NPN uptake assay was conducted following the instructions of Helander and Mattila (25) with minor modifications. In brief, E. coli. ATCC 25922 in logarithm growth period was centrifuged and resuspended with N′-a-hydroxythylpiperazine-N′-ethanesulfanic acid (HEPES, Solarbio, China, 5 mM, pH 7.2–7.4). NPN (10 μM final concentration, diluted with 5 mM HEPES) containing OaBac5mini (25, 50, 100, and 200 μg/ml final concentrations), PMB (positive control, 50 μg/ml final concentrations) or PBS (negative control) were mixed with an equal volume of prepared bacteria solution and were added into a 96-well plate. Fluorescence units were monitored immediately using INFINITE 200 PRO (Infinite^® 2000, TECAN, Austria) at the excitation wavelength of 350 nm and emission wavelength of 420 nm for 100 min at 5 min intervals. Experiments were performed in biological triplicate.

The integrity of the inner membrane of E. coli ATCC 25922 treated by OaBac5mini was investigated by 3,3′-Dipropylthiadicarbocyanine iodide [DiSC₃(5), Sigma, USA], which is a fluorescent probe that can be concentrated in the integrated cytoplasmic membrane, leading to fluorescence self-quenching. If the membrane is depolarized or disrupted, DiSC₃(5) is released into the aqueous medium and leads to increased fluorescence. The DiSC₃(5) assay was conducted following the instruction of Sautrey et al. (26) with minor modifications. In brief, E. coli ATCC 25922 was centrifuged and diluted with 5 mM HEPES (containing 5 mM glucose) till OD₆₀₀ is 0.05. 1 μM DiSC₃(5) was added into the prepared bacteria solution, then incubated at 37°C with shaking at 220 rpm for 1 h in the dark. KCl solution was added (final concentration was 100 mM) after 30 min incubation. Then, 190 μl treated bacteria solution and either 10 μl OaBac5mini (the final concentrations were 25, 50, 100, and 200 μg/ml), PMB (positive control, final concentrations were 50 and 100 μg/ml), or PBS (negative control) were added into wells in a 96-well plate. Fluorescence units were investigated immediately using INFINITE 200 PRO (Infinite^® 2000, TECAN, Austria) at the excitation wavelength of 620 nm and emission wavelength of 670 nm for 30 min at 1 min intervals. Triple experiments were conducted with three individual clones of E. coli ATCC 25922.

Escherichia coli ATCC 25922 (OD₆₀₀ = 0.6) was centrifugated and resuspended with the same volume of 10 mM PBS (negative control), OaBac5mini (50 and 200 μg/ml) and PMB (50 μg/ml, positive control), respectively, and then incubated at 37°C for 3 h. The treated bacteria were collected by centrifugation and rinsed with PBS (PH 7.4) three times, then fixed with 2.5% glutaraldehyde overnight at 4°C. The fixed bacteria were centrifugated and dehydrated for 15 min with a series of gradient ethanol solutions (30, 50, 70, 80, 90, 95, and 100%), and then resuspended with 100 μl 100% ethanol. Three microliter of resuspended bacteria were dripped onto the treated silicon wafer and the bacteria were observed using scanning electron microscopy (SEM; Quanta 200, FEI, USA).

The statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, San Diego, CA) and shown with MEAN ± SEM. One-way ANOVA was used to test the statistical significance of the differences, and then Dunnett's multiple comparison test or Tukey's multiple comparison test was performed using SPSS 20 (SPSS, Chicago, USA). Statistically significance defined as ^*P < 0.05, ^**P < 0.01, and ^***P < 0.001.

The MICs of OaBac5mini, kanamycin, amoxicillin, florfenicol and tetracycline against different strains were shown in Table 1. OaBac5mini showed potent antibacterial activity against E. coli (MICs, 1.95–25 μg/ml) but weak antibacterial activity against S. aureus (MICs, 208.33 to >250 μg/ml). Moreover, OaBac5mini exhibited stronger activity against clinical isolates of MDR E. coli (MICs, 1.95–3.26 μg/ml) than E. coli ATCC 25922 (MIC, 25 μg/ml). To be noticed, the absence of sbmA caused the MIC of E. coli ATCC 25922 to OaBac5mini increase four-fold, suggesting that OaBac5mini can enter into the cytoplasm via SbmA and plays its antibacterial activity.

The antibacterial activity of OaBac5mini against E. coli ATCC 25922 was investigated in the presence of different salt ions with similar concentrations to that in human serum. As shown in Table 2, the presence of increased CaCl₂ decreased susceptibility to OaBac5mini compared to MH broth alone. Other salt ions (MgCl₂, NH₄Cl, FeCl₃, NaCl and KCl) did not significantly affect the antibacterial activity of OaBac5mini. This suggests that OaBac5mini will show a comparable stability in serum.

As shown in Figure 1, OaBac5mini exhibits stable antibacterial activity against E. coli ATCC 25922 in acid-base environments (Figure 1A), high-temperature environments (Figure 1B), repeated freeze-thawing (Figure 1C) or digestive enzymes pepsin and proteinase K as well as trypsin with low concentrations (Figure 1D). However, OaBac5mini completely lost activity after it was treated by trypsin with concentrations ranging from 20 to 100 μg/ml.

The time-kill curves of OaBac5mini against E. coli ATCC 25922 are shown in Figure 2. Results showed that 200 μg/ml OaBac5mini (8 × MIC) effectively killed E. coli ATCC 25922 after co-incubation for 12 h. When the concentration of OaBac5mini was 50 μg/ml (2 × MIC), the number of bacteria remained stable in the first co-incubation for 8h before it increased, attaining an amount similar to that of E. coli ATCC 25922 without OaBac5mini after co-incubation for 24 h. At the same time, 100 μg/ml OaBac5mini also caused the numbers of bacteria to decrease after co-incubation for 12 h and increase in further co-incubation for 12 h.

The hemolysis of OaBac5mini against RBCs was decided by testing the OD of every sample at an absorption wavelength of 413 nm. As shown in Figure 3, the mean hemolysis rate of RBCs was −1.26 to 1.59% after co-incubating with different concentrations of OaBac5mini (3.125–400 μg/ml) at 37°C for 1 h, which indicates that OaBac5mini does not cause hemolysis.

The results of RTCA showed that OaBac5mini was not cytotoxic to IPEC-J2 cells, but seemed to increase the proliferation of cells (Figure 4). Overall, the cell indexes of OaBac5mini treated groups showed a significant increase (P < 0.01) compared with the control group (Figure 4B). The lower the concentration of OaBac5mini, the stronger the promotion effect on cell proliferation was observed (Figure 4A). Even though the concentration of OaBac5mini attained 400 μg/ml, the cell indexes didn't change significantly compared to the control group (P > 0.05; Figure 4B).

To illustrate the antimicrobial mechanism of OaBac5mini, the physicochemical properties and structure were predicted. As shown in Table 3 and Figure 5, OaBac5mini is a positively charged hydrophilic linear peptide, whose formula is C₁₄₂H₂₂₆N₄₈O₂₅ with a molecular weight (MW) of 3005.66, as well as a theoretical pI of 12.85. OaBac5mini is a Pro- and Arg-rich peptide, whose amino acid composition is 10 Pro (41.7%), 8 Arg (33.3%), 3 Phe (12.5%), 2 Ile (8.3%), and 1 Val (4.2%). There are 8 positively charged residues, bringing the net charge to 8. Furthermore, the grand average of hydropathicity (GRAVY) is −1.267, and the hydropath./Kyte & Doolittle score predicted by ProtScale was 0.433 to −3.533, which indicates that OaBac5mini is a hydrophilic peptide with several hydrophobic residues (Table 3 and Figure 5A). The predicted secondary structure showed that OaBac5mini is rich in random coils without other secondary structures (Figure 5B). The 3D modeling indicated that OaBac5mini is a linear antimicrobial peptide (Figure 5C).

The permeabilization of the outer membrane of E. coli ATCC 25922 was determined by detecting the fluorescence changes of NPN. As shown in Figure 6A, the fluorescence intensity increased in bacteria treated with OaBac5mini for 20 min and exhibited a slight decrease until 60 min. The average fluorescence intensity of NPN in bacteria treated with OaBac5mini for 60 min was significantly increased (P < 0.01) compared with the negative control (Figure 6B), which indicated that the outer membrane of the bacteria was damaged by OaBac5mini.

The inner membrane integrity of E. coli ATCC 25922 was investigated by detecting the fluorescence changes of DiSC₃(5). As shown in Figure 6C, the fluorescence intensity increased when bacteria were treated with OaBac5mini for 10 min, and gradually leveled off for the next 20 min. The average fluorescence intensity of DiSC₃(5) of all OaBac5mini treated groups was significantly increased within 30 min (P < 0.05, Figure 6D), which indicates that the inner membranes were damaged by OaBac5mini.

The morphology and ultrastructure of E. coli ATCC 25922 treated with concentrations of 50 and 200 μg/ml OaBac5mini were investigated by SEM. As shown in Figure 7, E. coli treated with PBS (negative control) exhibited smooth and regular surfaces of the membranes. But both of the bacteria treated with OaBac5mini or 50 μg/ml PMB (positive control) exhibited atrophy, corrugation, and pore formation on the surface of the cell membranes, as well as the leakage of the intracellular contents. The results of SEM directly reflect the membrane damage, and also verify the results of NPN and DiSC₃(5).