The 20-day-old adults of D. helophoroides were purchased from the Southern Natural Enemy Breeding and Application Engineering Technology Research Center, the State Forestry Administration (Changsha, Hunan, China), and stored in the refrigerator under 4°C at Fujian Agriculture and Forestry University (Fuzhou, Fujian, China). Prior to experiments, 30 healthy D. helophoroides adults were taken out and put into a modified plastic box (16 × 10.5 × 5 cm, L × W × H) under room temperature (25 ± 1°C), allowed 5 min to recover, and then transferred to an artificial climate chamber (Shanghai Yiheng, MGC-300H, 20L) under 25 ± 1°C, L:D = 12:12 h, RH = 70 ± 10% for 2 d. All samples were screened by removing dead and dying individuals in the lab during the process of mass rearing, and three replicates were prepared.

The plastic box was modified to be a rearing box for D. helophoroides adults by making 15 ventilation holes (d = 1 mm) by using a soldering iron and placing two paper towels (15 × 5 cm, length × width) on the bottom of the rearing box. In total, five pieces of P. massoniana bark and one section of P. massoniana wood (d = 4 cm, h = 6 cm) were also placed on the paper towels to simulate habitat. Finally, a centrifuge tube (3 ml) containing an artificial diet for D. helophoroides and a moist cotton ball was placed to provide food and water, respectively.

Formulation of an artificial diet for D. helophoroides adults was as follows: 20 g larval powder of M. alternatus larvae, 60 g powder of Zophobas morio, 20 g powder of Tenebrio molitor, 10 g powder of Antheraea pernyi pupae, 10 g dried yeast, 10 g glucose, 10 g lyophilized yolk powder, 50 g pine powder (containing 15 g epidermal powder plus 35 g xylem powder), and 20 g sunflower oil, with all ingredients thoroughly mixed (20). The prepared artificial diet was put into centrifuge tubes (3 ml) and stored in the refrigerator at −4°C.

Most strains of Beauveria spp. were naturally collected from infected insect cadavers in the forests in Fujian, China, and a few strains were obtained from the Fujian Academy of Forestry (FAF, Fujian, China). The PDA medium was used to obtain pure cultures after delineation, and by continuous isolation in a sterile ultra-clean bench in the lab. A total of 17 strains of Beauveria spp. were obtained and identified based on the fungal morphological characteristics (Table 1) and stored at 4°C in the refrigerator.

The 17 strains were inoculated in line on sterile Petri dishes (d = 10 cm) containing the PDA medium and incubated purely in an artificial incubator (Shanghai Yiheng, LRH-150) under 26 ± 1°C, 80 ± 10% humidity for 14 d; then each strain after full sporulation was eluted with sterile water containing 0.01% Tween-80 in a 50 ml centrifuge tube and fixed to 10 ml, cultivated in the incubator shakers for 30 min under 25 °C (speed 200 rpm/min), then diluted to make suspension (10⁸ spores/ml). A total of 30 healthy D. helophoroides adults were placed into the pathogenic fungus suspension for 10 s to allow sufficient contact at the point where they were transferred into clean rearing boxes with sterile forceps. Each strain had three replicates. Samples immersed in the sterile water (Tween-80) were used as control (CK). The artificial diet and moist cotton balls were renewed daily, and their mortality, number of dead individuals, and time of death were recorded. Dead D. helophoroides adults were routinely placed into sealed centrifuge tubes (5 ml) inside an artificial incubator (Panasonic, Japan, MIR-154-PC) for 14 d. The incubation conditions were 26 ± 1°C and 80 ± 10% humidity, and colony growth on the surface of D. helophoroides adult cadaver was observed daily.

All 17 strains were screened based on the spore production, growth rate, spore germination rate, mortality, cadaver rate, and lethality duration, and the strains with the highest and lowest pathogenicity to D. helophoroides adults were determined.

The strain with the highest pathogenicity was fully eluted with sterile water containing 0.01% Tween-80 in a 50 ml centrifuge tube and fixed to 10 ml, cultivated in the incubator shakers for 30 min under 25°C (speed 200 rpm/min) and then diluted to make 1 × 10⁵, 1 × 10⁶, 1 × 10⁷, 1 × 10⁸, and 1 × 10⁹ spores/ml suspensions. For each suspension, 30 healthy D. helophoroides adults were submerged for 5 s before they were placed back into rearing boxes and reared on an artificial diet for 20 d of observation. Sterile water containing 0.01% Tween-80 was used as the control, and each treatment had three replicates.

The pure culture of 17 strains was inoculated on the PDA medium, and their spore germination rates were measured. The colony traits were morphologically observed at 24 h, and then their growth rates were measured by the crossover method. Finally, spore production was counted by using a hemocytometer plate after full sporulation at 14 d, and their spore morphology, size, and spore peduncle were also observed and recorded.

DNA from different strains was extracted by using the Ezup column-based fungal genomic DNA extraction kit (Sangon Biotech Co., Ltd., Shanghai, China) and amplified by using the fungal universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). The 25 ul PCR amplification system contained Taq PCE Master Mix 12.5 ul, template DNA 1uL, forward primers, and reverse primers (10 uM) per 1 ul, ddH₂O 9.5 ul, respectively. The PCR reaction procedure was as follows: pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 90 s for 30 cycles, and finally, all reactions were extended for 10 min at 72°C and detected by electrophoresis using 1% agarose gel. Some PCR samples were specifically selected based on ITS region amplification and sequenced to confirm them as Beauveria species. The PCR amplified samples with the ITS region confirmed as Beauveria bassiana by electrophoresis were sent to Biotech Bioengineering (Shanghai) Co., for sequencing, then the ITS sequences were submitted to the NCBI database for BLASTN comparison, and 23 fungal sequences were downloaded to construct a phylogenetic evolutionary tree by using the maximum likelihood method (ML) and MEGA10.0 software to determine their species.

The cumulative mortality rate [mortality rate (%) = (number of deaths / total number of insects tested) × 100], corrected mortality rate [corrected mortality rate (%) = [(mortality rate in the treatment group–mortality rate in CK) / (1–CK mortality rate)] × 100], and cadaver rate, [cadaver rate, (%) = (number of cadaver / total number of insects tested) × 100] were calculated for each strain. All data were analyzed by using IBM SPSS Statistics 26 software. Figures of cadaver rate and cumulative mortality curve were drawn using Origin 2021b 64 bits. A DSLR camera (Canon EOS 77D) with a macro lens (LAOWA 100 mm Macro) was used to take pictures of the cadavers of D. helophoroide.

The spore production of 17 strains varied after 14 d cultivation, of which the BbMQ strain was 1.32 × 10⁹ spores/ml, the spore germination rate was 94.71%, and the colony area was 49.15 mm², which were significantly higher than those of other strains (Table 2, F_18,50 = 16.931, p < 0.05).

All tested Beauveria spp. were pathogenic to all D. helophoroides adults, of which the corrected mortality of the BbMQ strain was 81.82%, indicating that it was the most pathogenic and virulent strain, followed by BbFD strains (76.14%). In addition, the cumulative mortality of the BbMQ strain reached 82.22% at 20 d, which was significantly higher than the other 15 strains (p < 0.05). We also found that the mortalities of BbHD, BbWYS, BbMH-01, BbLJ-06, and BbYT-03 strains were <15%, of which the BbWYS strain was only 5.56% (Table 3, F_17,36 = 11.896, p < 0.01). All 17 strains could fit the univariate linear regression equation (F_18,38 = 12.181, p < 0.01, R² > 0.85), while the mid-lethal time of the BbMQ strain was theoretically 10.62 d, which was remarkably shorter than the BbFD, BbMH-03 strains (Figure 1, Table 3, F_18,38 = 12.181, p < 0.01).

The infected D. helophoroides adults tended to move slowly and showed slight anorexia during the initial stage of infection. At the beginning of infection (4 ~ 6 d), the number of D. helophoroides adults feeding on the diet gradually decreased, and approximately two adults showed daily foraging behavior, and no adults were seen to have fed on the diet during the final period (10 ~ 15 d), while five adults fed daily on the diet in the control groups.

Dead beetles were characterized by having three pairs of legs bent and unfolded after infection, with tarsus clutching the wood, or three pairs of legs stretched out with the abdomen upwards (Figures 2A, E). During 14 d, moisturized culture and the growth of the BbMQ strains was observed as a model: mycelium started from the head mouthparts, thoracic and abdominal ends, and intersegmental areas between each foot of the adult insect after 1 ~ 2 d infection/death, then the whole adult body was covered by the mycelium (Figure 2F), the mycelium grew rapidly on the day 3 (Figure 2J), and a large number of spores started to cover the body surface on day 6 to day 11 (Figure 2H). In contrast, the dead adults from control groups with the moisturizing cultivation did not produce any mycelia and spores during the entire process (0–11 d) (Figures 2B–D).

Out of a total of 17 strains, only 12 strains were found to produce cadavers by moisturizing and culturing the infected carcasses, accounting for 70.6% of all tested strains, and the cadaver rates of BbFD and BbMQ strains were 54.45 and 47.78%, respectively (Figure 3, F_18,38 = 23.781 p < 0.05). The virulence and infestation of Beauveria spp. on the D. helophoroides adult was relatively stable, and the survival of D. helophoroides adults might be seriously threatened by the natural Beauveria spp. in the forests.

Based on the mortality rate, lethality time, cadaver rate, spore production, spore germination rate, and colony growth area of 17 strains, the BbMQ strain was thought to be the most dangerous to D. helophoroides adults. Further results showed that both the cumulative mortality rate and cadaver rate of D. helophoroides adults decreased significantly with decreased concentrations of the spore suspension, the lethal time increased significantly with decreasing concentrations of the suspension, and the lethal median time was the shortest (10.88 d) under 1 × 10⁹ spores/ml suspension, indicating that the lethality of the BbMQ strain on the D. helophoroides adults was determined by the concentration of the spore suspensions (Table 4, F_5,12 = 203.738, p < 0.05). The semi-lethal concentrations were 7.41 × 10⁸, 4.89 × 10⁸, and 4.43 × 10⁸ spores/ml, respectively, when D. helophoroides adults were infected by the BbMQ strain at days 10, 15, and 20, and all fit the univariate linear regression equation (F_4,10 = 220.038, p < 0.05, R² > 0.85) (Table 5).