A total of 164 Japanese quail samples were obtained from slaughterhouses in the Republic of Korea. All experimental protocols were approved by the Institutional of Animal Care and Use Committee (IACUC) of Jeonbuk National University (JBNU 2021-049). All efforts were made to minimize the number of animals used and their suffering.

Genomic DNA was extracted from 20 mg peripheral tissues of quails using BioFACT Multi-Bead™ genomic DNA prep kit (BioFACT, Daejeon, Korea) following the manufacturer's instructions.

To amplify quail PRNP gene, gene-specific primers were designed and synthesized based on the quail PRNP gene registered in GenBank (GeneID: 107323677). The information on gene-specific primers of the quail PRNP gene was as follows, forward: 5'-AGGTCTATGCTCGCTGCTCT-3'; and reverse: 5'-AAGGACAAGGGACACCCCAT-3'. These primers were used to amplify the entire ORF of the quail PRNP gene. Polymerase chain reaction (PCR) was performed with 2.5 μl of 10 x Taq polymerase reaction buffer (25 mM), 5 μl of 5 x band helper, 0.5 μl of dNTPs (each 10 mM), 1 μl of each forward and reverse primers (each 10 μM), 0.12 μl of Taq polymerase (5 U/μl) (BioFACT, Daejeon, Korea), 3 μl of template genomic DNA (25-30 ng/μl), and 11.88 μl of nuclease-free water to a total volume of 25 μl. The PCR conditions were as follows: 1 cycle of predenaturation at 98°C for 2 min, 34 cycles of denaturation at 95°C for 20 s, annealing at 60°C for 40 s, elongation at 72°C for 1 min 30 s, and 1 cycle of final elongation at 72°C for 5 min. The experiments were performed using an S-1000 Thermal Cycler (Bio–Rad, Hercules, CA, USA). The PCR product stained with ethidium bromide (EtBr) was loaded to a gel electrophoresis system and then eluted by the Favor prep™ GEL/PCR purification kit (FAVORGEN, PingTung, Taiwan). The purified PCR products were sequenced using BigDye Terminator cycle sequencing kit (ABI, Foster City, CA, USA). The fluorescent PCR protocol consists of an initial 60 s incubation at 96°C, followed by 25 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 75 s. Then, PCR products were loaded into an ABI 3730 Capillary Sequencer (ABI, Foster City, CA, USA). The sequencing results were read by the Finch TV program (Geospriza Inc., Seattle, WA, USA), and genotyping was carried out.

Linkage disequilibrium (LD) and haplotype analyses were performed using Haploview program ver. 4.2 (Broad Institute, Cambridge, MA, USA).

The effect of amino acid substitution was estimated by four in silico programs, including Protein Variation Effect Analyzer (PROVEAN), Protein Analysis Through Evolutionary Relationships (PAHTHER), Sorting Intolerant From Tolerant (SIFT) programs, and combined Amyloid and Composition-based prediction of the prion-like aggregation propensity (AMYCO) (24–27). PROVEAN (http://provean.jcvi.org/seq_submit.php) predicts the effect of amino acid substitution on the biological function of proteins and is scored by calculating clustering BLAST hits of homologs collected from the NCBI database. When the score is < -2.5, it is predicted as “deleterious,” and when it is above −2.5, it is predicted as “neutral.” PANTHER (http://www.pantherdb.org) estimates the likelihood of a non-synonymous SNP to cause a functional impact on the protein. It evaluates amino acid substitution by calculating the time conserved during the evolution of species. Scores based on retention time are as follows: “most likely damaging” if >450 my (~0.2), “possibly damaging” for scores between 200 my and 450 my (~0.4), and “most likely benign” for <200 my. SIFT (https://sift.bii.a-star.edu.sg/) predicts substitution effects based on sequence homology, and the prediction results are described as follows: normalized probabilities ≤ 0.05 are predicted to be damaging, whereas those with normalized probabilities >0.05 are predicted to be tolerated. AMYCO (http://bioinf.uab.es/amycov04/) predicts the effect of amino acid substitution aggregation propensity. It uses the pWALTZ and PAPA algorithms and calculates the results with the PSEP score. An AMYCO score below 0.45 indicates low amyloid propensity while an AMYCO score above 0.74 indicates high amyloid propensity.

To analyze the genetic relationship, phylogenetic analysis was performed in five species, including chicken, turkey, goose, duck, and quail using Molecular Evolutionary Genetic Analysis X (MEGA X) program (28). Detailed information on the species analyzed in this study is described in Table 1. The evolutionary tree was drawn using neighbor joining method with 2,000 bootstrap tests. The branch length of phylogenetic tree represents the evolutionary distance, which was calculated amino acid substitution by Poisson correction method.

To find quail-specific amino acids, multiple sequence alignment was performed in the above-mentioned five avian species using Clustal Omega (29) (https://www.ebi.ac.uk/Tools/msa/clustalo/).

The 3D structure of avian PrPs was analyzed by SWISS-MODEL program (30), with the highest global model quality estimation (GMQE) score selected to predict avian PrPs. The modeling quality was estimated by a qualitative model energy analysis (QMEAN) score. Hydrogen bond analysis was performed to calculate the change in the bond or distance of the hydrogen bond due to amino acid substitution. Hydrogen bonds were predicted if hydrogen was in the 1.2 to 2.76 Å range for a compatible donor atom.

To validate the 3D structure of avian PrPs predicted by SWISS-Model, avian PrPs were analyzed by AlphaFold based on machine learning (https://colab.research.google.com/github/deepmind/alphafold/blob/main/notebooks/AlphaFold.ipynb). The intra-domain confidence of modeling was estimated by predicted local distance difference test (pLDDT) score on a scale from 0 to 100.

To amplify the quail PRNP gene, PCR was performed with gene-specific primers. The quail PRNP gene is located on chromosome 22 and consists of three exons. The ORF is located at exon 3. The size of our PCR products (801 bp) was identical to that of the quail PRNP gene registered in GenBank (GeneID: 107323677). To identify the genetic polymorphisms of the quail PRNP gene, we performed DNA sequencing in 164 quails. We found a total of 33 novel SNPs, including 28 SNPs at c.12C>T, c.15C>T, c.60C>T, c.111T>C, c.126C>T, c.144C>T, c.162T>C, c.168G>A, c.171G>A,C, c.174T>C, c.186A>G, c.192C>T, c.222C>T, c.321G>A, c.357G>A, c.453C>T, c.459G>A, c.463C>A, c.474C>T, c.486G>A, c.540T>C, c.546C>T, c.645C>T, c.678G>T, c.685C>T, c.702G>A, c.705T>C, and c.714C>T, along with three nonsynonymous SNPs at c.56C>T (T19I), c.61G>A (V21I), and c.64G>T (A22S) in the ORF region and two SNPs at c.806A>G and 811G>A in the 3' untranslated region (UTR) (Figure 1A). Electropherograms of the 33 novel SNPs are shown in Figure 1B. Notably, insertion/deletion polymorphisms were not found in the quail PRNP gene. Detailed information on the genotype and allele frequencies of the 33 SNPs of the quail PRNP gene is described in Table 2. In addition, we performed LD analysis to evaluate genetic linkage among 33 SNPs of the quail PRNP gene using the r² value. Detailed LD values are described in Table 3. Furthermore, we performed haplotype analysis on the 33 SNPs of the quail PRNP gene. Briefly, seven major haplotypes were found. The haplotype present in the highest proportion was CCCCGGTCCTGGTACCGGCGCCGTCCGCGTCAG (62.5%), followed by CCCCAGCCCTAATGTCAACACCACCCTCATCAG (5.2%) and CCTTGTTCCCAACACCGATGCCGTCTGCGCCAA (2.1%) (Table 4).

To analyze the functional and structural effects of nonsynonymous SNPs on quail PrP, PROVEAN, PANTEHR, and SIFT programs were used. T19I and A22S were predicted to have benign effects on quail PrP by all three programs. In addition, V21I was predicted by PROVEAN and PANTHER to have a neutral effect on quail PrP. However, V21I was predicted to have a deleterious effect on quail PrP by SIFT (Table 5). To analyze the effect of nonsynonymous SNPs on the amyloid propensity of quail PrP, the AMYCO program was used. Notably, T19I, V21I, and A22S were predicted to have low amyloid propensity with a score of “0” (Table 5). T19, I19, V21, and I21 alleles were predicted to have no hydrogen bond. A22 and S22 alleles were predicted to have one hydrogen bond with S24 (1.99 Å) (Figure 2).

To analyze the evolutionary relationship of quail PrP among avian species, phylogenetic analysis was performed in five avian species of chicken, turkey, goose, duck, and quail using MEGA X program. Notably, quail PrP showed the closest genetic distance to turkey PrP, followed by chicken PrP (Figure 3A). Multiple sequence alignment showed that length of the amino acid sequences of duck PrP was the longest (136 aa), while the length of the amino acid sequence of quail PrP (115 aa) was identical to those of turkey and goose. In addition, we found three quail-specific amino acids, namely S144, D214, and T259 (Figure 3B).

To identify the difference in tandem repeats in amino acid sequences among the five avian species, we aligned their tandem repeat regional sequences (Figure 3C). The result showed that both chicken and turkey PrPs had eight tandem repeats, followed by seven in quail and four each in geese and duck.

SWISS-MODEL was used to analyze the secondary structure of avain PrPs (Figure 4, Table 6). In chicken, turkey, and goose PrPs, three α-helix and two β-sheet structures were observed, followed by five α-helix and four β-sheet structures in duck, and three α-helix and two β-sheet structures in quail. The proportion of the β-sheet structure of quail PrP was lower than that of duck (quail: 5.21%; duck: 8.82%). As shown in the secondary structure of avian PrPs, all avian PrPs showed similar tertiary structures (Figure 4B, Table 6). Since SWISS-MODEL has been predicted with a relatively low confidence (Table 6), we validated the 3D structure of avian PrPs using AlphaFold (Supplementary Figure 1). Notably, quail PrP showed a similar 3D structure with chicken PrP.

QMEAN, qualitative model energy analysis; GMQE, global model quality estimation.

To analyze the amyloid propensity of the substitutions of three amino acids on avian PrPs, we evaluated amyloid propensity according to the allele using AMYCO (Table 7). Among the five avian species, duck PrP was predicted to have the highest amyloid propensity (44) compared to all other four avian PrPs. Notably, the amyloid propensity of the avian PrPs was not changed by any substitution of the three amino acids.