The wastewater samples were obtained at the sewage treatment plant in Vrútky, which collects wastewater from Martin city and parts of the Turiec region. Sewage water samples for our experiment were collected from April to July 2022. At that time, the epidemiological situation in the Slovak republic was relatively stabilized, characterized by a decline of newly diagnosed cases; thus, SARS-CoV-2 presence in sewage was expected to be at very low levels (see Supplementary Table A in Supplementary material). Samples were transported to the laboratory on ice and then kept at 4°C until further processing on the same day. The first step was debris removal by centrifugation at 4,000 g for 30 min at 4°C. Next, half of the supernatant was filtered using 0.45 μm syringe filters. Samples of both filtered and unfiltered wastewater were either frozen at −20°C or processed further immediately.

For PEG precipitation, the supernatant was incubated with 8% PEG-8000 (Merck), and 0.3 M NaCl (Sigma-Aldrich) overnight (app. for 16 h) at 4°C. Centrifugation was performed at 10,000 g for 120 min, at 4°C, then the supernatant was removed and the pellet was diluted in 500 μl Opti-MEM™ (Gibco).

When using the Vivaspin centrifugal filter device/molecular weight cut-off 50 kDa (Sartorius), the supernatant was concentrated by centrifuging at 4,000 g for 30 min at 4°C. This centrifugal step was repeated to pass through the entire 50 ml supernatant volume until the final volume of the concentrated sample reached 500 μl. Then the enriched sample was collected and further processed.

Further, after both PEG precipitation and centrifugal filter enrichment protocols, total RNA isolation was carried out using the NucleoSpin™ RNA Virus column (Macherey Nagel). Then, RNA was eluted with 30 μl of RNase-free water according to the manufacturer's protocol. All RNA isolations were performed in triplets.

Zymo Environ Water RNA Extraction kit (Zymo) covers viral enrichment, sample homogenization, and RNA purification in one workflow protocol. We used 5 ml of wastewater that was aliquoted into five separated tubes (1 ml/each). Subsequently, we added 70 μl of Water Concentrating Buffer into each tube. Further steps were processed according to the manufacturers' recommendations.

Detection of SARS-CoV-2 viral RNA in the sample of wastewater was performed by a one-step RT-qPCR method using IVD-certificated kit gb SARS-CoV-2 Multiplex (GENERI BIOTECH s.r.o., Hradec Králové, Czech Republic). This kit allows the detection of viral E and RdRP genes within one reaction with a limit of detection of 2.13 copies of viral RNA per reaction (95 % CI). To avoid false negative results, the PCR process was verified by external positive control (EPC) added to the reaction. Reactions were prepared according to the manufacturer's instructions. Briefly, the PCR reaction with a volume of 20 μl contained 10 μl of Master Mix OneStep Multi, 5 μl of multiplexed Assay CoV-2 E-RdRP, 0.25 μl of EPC Template RNA, and 5 μl of extracted RNA. Positive control as well as NTC with distilled water was included in each run. PCR conditions were as follows: reverse transcription at 42°C for 30 min, initial denaturation at 95°C for 3 min, 50 cycles consisting of two steps (denaturation at 95°C for 10 s and annealing plus elongation at 60°C for the 30 s). The fluorescence signal was measured in the FAM channel for viral gene E, in the HEX channel for viral RdRP gene, and in the Cy5 channel for EPC. Reactions were evaluated as invalid if the signal in the Cy5 channel was not detected.

Reverse transcription-droplet digital PCR (RT-ddPCR) was performed in 20 μl reaction volume, consisting of 17 μl of master mix and 3 μl of the sample. Mastermix contained 5 μl of supermix, 2 μl of reverse transcriptase (RT), and 1 μl of 300 mM dithiothreitol (DTT) solution, all included in One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad Laboratories, Hercules, California, USA), primers and probes (Generi Biotech, Hradec Králové, Czech Republic) at a final concentration of 500 and 250 nM, respectively. Primer and probe sequences were as follows: RdRp (F): GTGAAATGGTCATGTGTGGCG, RdRp (R): AATGTTAAAAACACTATTAGCATAAGCA, RdRp: CAGGTGGAACCTCATCAGGAGATGC/HEX-IBFQ; E (F): ACAGGTACGTTAATAGTTAATAGCGT, E (R): ATATTGCAGCAGTACGCACA, E: ACACTAGCCATCCTTACTGCGCTTCG/FAM-IBFQ; GAPDH (F): AGTCAGCCGCATCTTCTTTT, GAPDH (R): CCCAATACGACCAAATCCGT, GAPDH: GCGTCGCCAGCCGAGCCACA/HEX-IBFQ. Commercially available SARS-CoV-2 Standard (Exact Diagnostics, Bio-Rad Laboratories, Fort Worth, Texas, USA) manufactured with synthetic RNA transcripts containing five gene targets (E, N, ORF1ab, RdRP, and S of SARS-CoV-2) was used as a ddPCR quantitative positive control. All samples were analyzed in duplicates for GAPDH and single wells for each viral gene, RdRp + GAPDH and E + GAPDH. Droplets were generated by an automated droplet generator (Bio-Rad Laboratories, Hercules, California, USA) according to the manufacturer's instructions. PCR was performed using a T100 thermal cycler (Bio-Rad Laboratories, Hercules, California, USA) with the following cycling conditions: reverse transcription at 50°C for 60 min, denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 94°C for 30 s, followed by annealing/extension at 54°C for 1 min, and droplet stabilization at 98°C for 10 min. Samples were then analyzed using QX200 Droplet Reader (Bio-Rad Laboratories, Hercules, California, USA). Thresholding was carried out by using QuantaSoft Software manually at the lowest amplitude that captures true negative clusters based on the signals of the negative control and positive control samples. The results were reported as positive when at least five copies of each viral gene (RdRp, E) occurred (15). Data are interpreted as copies per reaction according to previous works evaluating the presence of SARS-CoV-2 in samples by RT-ddPCR (16).

For the schematic visualization of the complete workflow, see Figure 1.

To perform the most precise detection of SARS-CoV-2 in wastewater, we compared two quantitative analysis methods, namely RT-qPCR (qTOWER—Analytic Jena) and ddPCR (QX200 Droplet digital PCR system—Biorad). All samples were analyzed in triplicates for higher statistical power of the experiment. The samples were collected three times from April to May 2022. Using filtered wastewater, RT-ddPCR identified 21 positive samples compared to 12 positive results analyzed by RT-qPCR. Furthermore, significant differences were detected in unfiltered wastewater in which RT-ddPCR identified 19 positive samples compared to 12 positive results detected by RT-qPCR (Table 1) Additional information is summarized in the Supplementary material (see Supplementary Table B in Supplementary material).

In our study, we compared three different methods for virus concentration and purification (Vivaspin and PEG) and RNA isolation, including NucleoSpin RNA Virus, Mini kit for viral RNA (Macherey-Nagel), and Zymo Environ Water RNA Kit (Zymo) to select the appropriate protocol for subsequent downstream analyses. Using PEG-8000 and NucleoSpin RNA Virus Mini kit, we identified eight positive results in filtered wastewater and nine positive results in unfiltered wastewater using RT-ddPCR. RT-qPCR detected three positive samples (in filtered wastewater), while only one sample was positive for SARS-CoV-2 in unfiltered wastewater. Virus separation using Vivaspin columns and subsequent isolation by NucleoSpin RNA Virus Mini kit detected SARS-CoV-2 positivity in four cases (filtered wastewater) compared to two positive outputs after RT-ddPCR analysis identified in unfiltered wastewater. The same workflow applied for RT-qPCR detected the absence of positivity in filtered wastewater; only two positive samples were confirmed in unfiltered wastewater. The protocol for virus purification and RNA isolation (Zymo Environ Water RNA Kit) identified positivity in all samples after RT-ddPCR as well as RT-qPCR analysis in both filtered and unfiltered wastewater (Table 1).

In accordance with our experiment workflow, the collected wastewater included: (1) filtrated with a 0.22 mm strainer or (2) used for further analysis without requiring a filtration step. In the next step, both wastewater samples (filtered/unfiltered) were processed by the aforementioned separation and isolation protocols (Table 1). Data were assessed as copies of viral RNA per reaction using RT-ddPCR. We observed a significantly lower number of copies of viral RdRp between samples processed by PEG and samples processed by Vivaspin columns and Zymo kit (p < 0.05) using filtered wastewater in the first analysis. Moreover, the level of GAPDH copies was significantly lower in samples isolated by Zymo kit compared to samples processed by PEG (p < 0.05). In unfiltered wastewater, the number of GAPDH copies was significantly lower (p < 0.01) in samples purified and isolated by Zymo kit than in samples after PEG precipitation and subsequent RNA isolation by the NucleoSpin RNA Virus kit. The second analysis of wastewater showed a significant decrease in the number of gene E (p < 0.05), RdRp (p < 0.05), and GAPDH (p < 0.05) copies in the samples concentrated by Vivaspin columns compared to samples after PEG precipitation and RNA isolation. Statistical significance was also observed in the number of gene E (p < 0.05), RdRp (p < 0.01), and GAPDH (p < 0.01) copies in samples processed by Zymo kit compared to samples after PEG-mediated virus precipitation and RNA isolation in unfiltered wastewater in the second round of analysis. In addition, a comparison between a number of gene copies in samples processed using Vivaspin and Zymo kit showed significant differences in RdRp (p < 0.05) and GAPDH (p < 0.01) (in filtered water) and RdRp (p < 0.001), E (p < 0.01), and GAPDH (p < 0.001) in unfiltered wastewater. The third analysis showed similar results between samples processed via Vivaspin and Zymo kit. The number of RdRp (p < 0.05) and GAPDH (p < 0.01) copies was significantly higher in filtered wastewater after the Zymo purification and isolation step. Also, there was statistical significance between RdRp (p < 0.05), E (p < 0.01), and GAPDH (p < 0.05) in unfiltered wastewater processed by Vivaspin and Zymo workflow. Finally, a significantly increased number of RdRp copies (p < 0.05) was observed in samples after Zymo processing than those after PEG separation in the third analysis. All data are summarized in Figure 2.

According to previous results, we compared unfiltered and filtered wastewater processed by Zymo Environ Water RNA kit. In the first analysis, there was no statistical significance between filtered and unfiltered wastewater in the number of viral gene copies (E, RdRp) as well as in housekeeping gene GAPDH. The second analysis evaluated by RT-ddPCR revealed differences between the amount of GAPDH copies (p < 0.05) in unfiltered wastewater compared to filtered wastewater. In the third analysis, we observed a significantly increased level of viral gene E (p < 0.05) in unfiltered wastewater (Figure 3).

To determine the impact of thaw/freeze on the stability of viral RNA in wastewater samples, we analyzed frozen filtered and unfiltered wastewater (frozen aliquots from the first three collections). In the filtered fraction of wastewater, we observed a significantly decreased number of GAPDH copies in samples processed by Vivaspin protocol compared to PEG processing (p < 0.05) and an increased number of GAPDH in wastewater processed by Zymo kit compared to Vivaspin (p < 0.05) in the second analysis. On the other hand, unfiltered fractions manifested more diverse results. In the first analysis, the level of GAPDH was decreased in samples processed by both Vivaspin (p < 0.05) and Zymo kit (p < 0.01) protocols compared to PEG workflow. Moreover, the level of RdRp was lower (p < 0.01) in samples concentrated by Vivaspin columns than in those processed by PEG precipitation. The second analysis revealed a decrease in GAPDH (p < 0.01) in samples after Vivaspin centrifugation and Zymo kit processing compared to samples after PEG-mediated precipitation. Furthermore, significance was confirmed between a number of RdRp (p < 0.05) and GAPDH (p < 0.05) copies after purification and RNA isolation mediated by Zymo kit and samples selected for Vivaspin centrifugation. The last analysis of unfiltered frozen wastewater showed a significantly decreased level of GAPDH in samples after processing by Vivaspin (p < 0.01) and Zymo kit (p < 0.001) workflow than in samples processed by PEG precipitation (Figure 4).

We received total 10 samples (analyzed as triplicates) of wastewater collected over the 2-month period between May 2022 and July 2022. Except for one replicate, all 10 samples were positive for SARS-CoV-2, analyzed by RT-ddPCR. On the other hand, results from RT-qPCR showed inconsistency characterized by negative and invalid results or the presence of different coronavirus (Table 2).

Long-term monitoring revealed an increased amount of SARS-CoV-2 viral gene copies in wastewater samples compared to expectations based on national data acquired by individual testing using RT-qPCR (17). This trend was consistent throughout the last 5 weeks of the analysis (Figure 5).