<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2025.1648690</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Identification of <italic>Pseudocercospora mori</italic> as the causal agent of grey leaf spot disease in mulberry (<italic>Morus atropurpurea</italic>) from various localities in Guangdong Province, China</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Qazi</surname>
<given-names>Izhar Hyder</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1294185/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Yuan</surname>
<given-names>Ting</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2280324/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Xi</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Liu</surname>
<given-names>Jiping</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2390359/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding, College of Animal Science, South China Agricultural University</institution>, <addr-line>Guangzhou, Guangdong</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Carla M. R. Varanda, Research Centre for Natural Resources, Environment and Society (CERNAS), Portugal</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1532273/overview">Khuong Nguyen Quoc</ext-link>, Can Tho University, Vietnam</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/522233/overview">Shahzad Munir</ext-link>, Yunnan Agricultural University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/583078/overview">Muhammad Hayder Bin Khalid</ext-link>, Sichuan Agricultural University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Jiping Liu, <email xlink:href="mailto:liujiping@scau.edu.cn">liujiping@scau.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>04</day>
<month>09</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1648690</elocation-id>
<history>
<date date-type="received">
<day>17</day>
<month>06</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>07</day>
<month>08</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Qazi, Yuan, Liu and Liu.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Qazi, Yuan, Liu and Liu</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>During periods of high temperature and humidity, mulberry trees become susceptible to fungal leaf spot disease, which can significantly reduce both the yield and quality of their leaves. In this study, we collected samples of mulberry leaf spot disease from six regions of Guangdong province of China. The disease samples were studied using traditional morphological methods, high-throughput sequencing technology, molecular phylogenetic analysis, and pathogenicity tests. The observed morphological features of the pathogen were consistent with those of <italic>Pseudocercospora</italic>. High-throughput sequencing results revealed the presence of multiple fungal species in the samples, with <italic>Pseudocercospora</italic> spp. comprising the highest proportion. The complete rDNA and mitochondrial genome sequences of <italic>Pseudocercospora</italic> spp. were assembled. Based on the sequencing data, primers were designed to amplify and sequence barcode gene regions, including <italic>ITS</italic>, <italic>Cyt b</italic>, and <italic>COI</italic>. Phylogenetic analyses consistently placed the pathogen within the family Mycosphaerellaceae. ITS-based identification confirmed the pathogen as a member of the genus <italic>Pseudocercospora</italic>, while the <italic>Cyt b</italic> and <italic>COI</italic> sequences indicated a relatively distant relationship with the closely related genus <italic>Cercospora</italic>, thereby supporting the morphological classification of the pathogen at the molecular level. In addition, pathogenicity validation identified <italic>Pseudocercospora mori</italic> as a primary causal pathogen of leaf spot disease in mulberry. PCR primers specifically designed based on the rDNA sequence of <italic>Pseudocercospora mori</italic> achieved a detection sensitivity as low as 3 &#xd7; 10&#x207b;&#xb2; ng/&#x3bc;L. In conclusion, based on morphological and molecular phylogenetic evidence, we identified <italic>Pseudocercospora mori</italic> as the causal pathogen of mulberry leaf spot disease. This study provides useful data for practical management of mulberry leaf spot disease at the field level, aiding in the sustainable development of sericulture.</p>
</abstract>
<kwd-group>
<kwd>barcoding genes</kwd>
<kwd>high-throughput sequencing</kwd>
<kwd>leaf spot disease</kwd>
<kwd>mulberry</kwd>
<kwd>phylogenetic analysis</kwd>
<kwd>sericulture</kwd>
<kwd>sub-tropical</kwd>
</kwd-group>
<contract-sponsor id="cn001">Earmarked Fund for China Agriculture Research System<named-content content-type="fundref-id">10.13039/501100010038</named-content>
</contract-sponsor>
<counts>
<fig-count count="14"/>
<table-count count="5"/>
<equation-count count="0"/>
<ref-count count="84"/>
<page-count count="22"/>
<word-count count="11590"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Plant Pathogen Interactions</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Mulberry is a perennial herbaceous plant native to China (<xref ref-type="bibr" rid="B43">Huang et&#xa0;al., 2025</xref>). It holds great economic importance in sericulture industry, as mulberry leaves are used as the only feed resource of the domesticated silkworms (<xref ref-type="bibr" rid="B45">Ji et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B13">Chan et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B59">Nguyen et&#xa0;al., 2025</xref>). Due to the presence of essential flavonoids, oligosaccharides, proteins, and volatile compounds, mulberry and its byproducts are commonly used in human and animal medicine and food/feed industries (<xref ref-type="bibr" rid="B9">Bai et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B24">Deng et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B52">Lin et&#xa0;al., 2025</xref>; <xref ref-type="bibr" rid="B42">Hu et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B56">Mao et&#xa0;al., 2025</xref>; <xref ref-type="bibr" rid="B83">Zhang et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B36">Guo et&#xa0;al., 2025</xref>; <xref ref-type="bibr" rid="B41">Hou et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B80">Xie et&#xa0;al., 2025</xref>). Due to their above mentioned versatile medicinal and nutritional utilities, mulberry and its byproducts generate economy worth billions of yuan (CNY) annually, supporting China&#x2019;s silk industry, allied businesses, and supply chains (<xref ref-type="bibr" rid="B51">Liao and Xiao, 2013</xref>). However, the stable development and growth of sericulture and mulberry production systems continue to be affected due to several devastating diseases. For instance, during hot and humid seasons, mulberry trees are susceptible to fungal diseases (<xref ref-type="bibr" rid="B54">Luo et&#xa0;al., 2024</xref>). From these, the fungal leaf spot disease (also known as leaf stain or blight) is one of the important diseases affecting mulberry production in China and other sericulture-intensive countries. The causal pathogens of fungal leaf spot disease of mulberry are complex and diverse, with varying occurrence and severity of the disease in different parts of the world (<xref ref-type="bibr" rid="B6">Arunakumar et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B69">Saif et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B20">da Costa et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B72">Soylu et&#xa0;al., 2003</xref>). Although, the disease is caused by many different fungi, the fungal leaf spot disease often exhibits similar pattern and cycles. Importantly, the disease significantly affects the mulberry leaf quality and nutritional value (<xref ref-type="bibr" rid="B6">Arunakumar et&#xa0;al., 2023</xref>).</p>
<p>The grey leaf spot, caused by <italic>Pseudocercospora mori</italic>, is recognized as one of the most widespread mulberry diseases in China, severely impacting the leaf quality and yield of mulberry (<xref ref-type="bibr" rid="B82">Zhang, 1975</xref>; <xref ref-type="bibr" rid="B58">Mekala et&#xa0;al., 2025</xref>). Although the disease causes significant economic losses, little information is available about its distribution and occurrence in China. In addition, the exact estimation of its economic impact is difficult due to the complexities of farming practices and sericulture industry (Liu Jiping, personal communication).</p>
<p>The grey leaf spot disease is typically characterized by dark, mold-like spots and necrotic lesions on the undersides of leaves, leading to reduced leaf quality and premature leaf drop, which significantly affects sericulture and the medicinal and nutritional value of mulberry leaves (<xref ref-type="bibr" rid="B74">Teotia et&#xa0;al., 1997</xref>; <xref ref-type="bibr" rid="B71">Shree et&#xa0;al., 1997</xref>). The disease reduces chlorophyll, sugars, and proteins in leaves while increasing phenolic compounds, impairing photosynthesis and water use efficiency (<xref ref-type="bibr" rid="B47">Kumar et&#xa0;al., 2011a</xref>; <xref ref-type="bibr" rid="B71">Shree et&#xa0;al., 1997</xref>). The disease has been reported in Australia (<xref ref-type="bibr" rid="B32">Grice et&#xa0;al., 2006</xref>), Iran (<xref ref-type="bibr" rid="B39">Hesami et&#xa0;al., 2012</xref>), India (<xref ref-type="bibr" rid="B30">Govindaiah et&#xa0;al., 2002</xref>), Pakistan (<xref ref-type="bibr" rid="B60">Niaz et&#xa0;al., 2010</xref>), Thailand (<xref ref-type="bibr" rid="B64">Phengsintham et&#xa0;al., 2013</xref>), and Kenya (<xref ref-type="bibr" rid="B62">Peris et&#xa0;al., 2012</xref>).</p>
<p>
<italic>Pseudocercospora mori</italic> primarily overwinters as mycelium in infected leaf tissues, with overwintering conidia having low viability in natural conditions are insufficient to cause an infection. The following year, overwintering mycelium produces conidia that spread and initiate the primary infection, followed by secondary conidia from new lesions, leading to widespread disease (<xref ref-type="bibr" rid="B82">Zhang, 1975</xref>; <xref ref-type="bibr" rid="B77">Wang et&#xa0;al., 1994</xref>; <xref ref-type="bibr" rid="B8">Babu et&#xa0;al., 2002</xref>). It is believed that both pathogen accumulation and environmental influences contribute to the intensification of the disease (<xref ref-type="bibr" rid="B44">Huang and Zhu, 2013</xref>). Located in the subtropical climate zone with ample sunlight and rainfall, Guangdong province is one of the important sericulture and mulberry production areas in China. Mulberry trees are typically densely planted as shrubs, creating favorable conditions for grey leaf spot outbreaks, resulting in substantial losses to the farmers and industry (<xref ref-type="bibr" rid="B30">Govindaiah et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B55">Maji et&#xa0;al., 2008</xref>). Based on the traditional morphological analysis methods, <italic>Pseudocercospora mori</italic> is classified in the Deuteromycotina subphylum, with well-developed mycelium producing scattered conidia on mycelium or conidiophores, lacking sexual reproductive characteristics, and belonging to the Dematiaceae family (<xref ref-type="bibr" rid="B65">Qiu, 1998</xref>; <xref ref-type="bibr" rid="B5">&#xc1;vila et al., 2005</xref>). However, influenced by the notion that &#x201c;sericulture outweighs mulberry cultivation,&#x201d; the knowledge of this pathogen remains limited locally and globally, hindering effective identification and control of grey leaf spot disease (<xref ref-type="bibr" rid="B82">Zhang, 1975</xref>).</p>
<p>Recent technological advancement has helped in molecular identification of novel plant pathogens based on their DNA sequence analysis. The ITS sequences, rRNA sequences, and mitochondrial genes (e.g., <italic>COI</italic>, <italic>Cyt b</italic>) are targeted for rapid fungal identification (<xref ref-type="bibr" rid="B17">Crous et&#xa0;al., 2013a</xref>, <xref ref-type="bibr" rid="B18">Crous et&#xa0;al., 2013b</xref>; <xref ref-type="bibr" rid="B70">Schoch et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B78">White et&#xa0;al., 1990</xref>; <xref ref-type="bibr" rid="B38">Hebert et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B73">Stielow et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B28">Gao and Zhang, 2013</xref>). ITS sequences, with conserved flanking regions and moderate variability, are the primary barcode for fungal identification but they require integration with the host and morphological data due to high interspecies similarity or plant DNA interference (<xref ref-type="bibr" rid="B70">Schoch et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B78">White et&#xa0;al., 1990</xref>). High-throughput sequencing enhances identification accuracy, supporting population dynamics and gene function studies (<xref ref-type="bibr" rid="B75">Walkowiak et&#xa0;al., 2016</xref>). Disease epidemiology is influenced by pruning timing, shoot age, and weather conditions, yet these relationships remain underexplored (<xref ref-type="bibr" rid="B47">Kumar et&#xa0;al., 2011a</xref>; <xref ref-type="bibr" rid="B55">Maji et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B37">Hawksworth, 2003</xref>).</p>
<p>Given the economic value of mulberry leaves and the significant threat of the grey leaf spot disease in Guangdong province of China, this study integrated traditional morphological, high-throughput sequencing, and molecular analyses to systematically investigate the symptoms, describe pathogen morphology, and identify the locally prevalent causal agent of grey leaf spot disease of mulberry (<italic>Morus atropurpurea</italic>).</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Material</title>
<p>The main biological materials in this study were mulberry (<italic>Morus atropurpurea</italic>; Guisangyou 12 variety) leaves affected with leaf spot disease (see <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref> and <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). Mulberry leaves showing typical symptoms of leaf spot disease were collected from six mulberry orchards in Guangdong Province of China. Infected leaves had jet-black to dark gray lesions that were round, irregular, or oval in shape, measuring 2&#x2013;10 mm in diameter. Initially, they appeared as small, dark spots that gradually expanded and merged into larger patches. These lesions were primarily located in the lower middle side or margins of leaves. The detailed description of collected material is given in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. Briefly, the material was collected from different localities of Guangdong province including Guangzhou City, Wengyuan county, Shaoguan city, Yangshan county, Qingyuan city, Liannan Yao Autonomous county, Qingyuan city, Yingde city, Qingyuan city, Huazhou city, and Maoming city. In addition, winter soil and branch materials were collected from Yingde city, Qingyuan city, Huazhou and Mulberry demonstration base of the South China Agricultural University, Guangzhou, China.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Map showing sampling locations across Guangdong province and number of samples of leaf spot-infected mulberry leaves. This map shows the administrative divisions of Guangdong Province, China. Landmarks represent sampling locations in this study. Samples were collected in six locations across three cities: Guangzhou City, Shaoguan City, Qingyuan City, and Maoming City. Color intensity represents the number of samples collected. For further details, readers can refer to <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g001.tif">
<alt-text content-type="machine-generated">Map of regions with color gradients indicating values from twenty to sixty. Qingyuan is highlighted in dark red for sixty, Guangzhou in red for forty, and Maoming and Shaoguan in yellow for twenty. Other regions are marked as NaN.</alt-text>
</graphic>
</fig>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Number and collection location of mulberry leaf spot disease leaves.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">S. no.</th>
<th valign="middle" align="left">Collection area</th>
<th valign="middle" align="left">Geographic location (east longitude, north latitude)</th>
<th valign="middle" align="left">Number of samples</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">1</td>
<td valign="middle" align="left">Guangzhou City, Guangdong Province (GZ)</td>
<td valign="middle" align="left">113.359528, 23.170115</td>
<td valign="middle" align="left">40</td>
</tr>
<tr>
<td valign="middle" align="left">2</td>
<td valign="middle" align="left">Wengyuan County, Shaoguan City, Guangdong Province (WY)</td>
<td valign="middle" align="left">114.143277, 24.369938</td>
<td valign="middle" align="left">20</td>
</tr>
<tr>
<td valign="middle" align="left">3</td>
<td valign="middle" align="left">Yangshan County, Qingyuan City, Guangdong Province (YS)</td>
<td valign="middle" align="left">112.639911, 24.471893</td>
<td valign="middle" align="left">20</td>
</tr>
<tr>
<td valign="middle" align="left">4</td>
<td valign="middle" align="left">Liannan Yao Autonomous County, Qingyuan City, Guangdong Province (LN)</td>
<td valign="middle" align="left">112.039816, 24.548602</td>
<td valign="middle" align="left">20</td>
</tr>
<tr>
<td valign="middle" align="left">5</td>
<td valign="middle" align="left">Yingde City, Qingyuan City, Guangdong Province (YD)</td>
<td valign="middle" align="left">113.457986, 24.184965</td>
<td valign="middle" align="left">20</td>
</tr>
<tr>
<td valign="middle" align="left">6</td>
<td valign="middle" align="left">Huazhou City, Maoming City, Guangdong Province, China (HZ)</td>
<td valign="middle" align="left">110.654611, 21.664831</td>
<td valign="middle" align="left">20</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Cladosporium sp., Penicillium verruculosum, Aspergillus sp., Phanerina mellea, Schizophyllum commune, Lasiodiplodia theobromae, Candida mucifera, Phyllactinia moricola, Ciboria canrunculoides, Lecanicillium psalliotae and Pseudomonas aeruginosa were obtained from the Regional Sericulture Training Center for the Asia-Pacific, College of Animal Science, South China Agriculture University, Guangzhou, China.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<sec id="s2_1_1">
<title>Identification of causal fungal pathogen of leaf spot disease based on traditional morphological analysis</title>
<p>Mycelium, conidial peduncle, conidia, ascospores, spore producing cells, etc. were photographed and recorded, and microscopic orders of magnitude such as mycelium width, conidium size, conidial peduncle length and width, and the number of conidial septa were described and recorded in detail (<xref ref-type="bibr" rid="B79">Woudenberg et&#xa0;al., 2013</xref>). A fluorescence microscope MF30 (Guangzhou Mingmei Optoelectronics Technology Co., Ltd.) was used to obtain photographs. A ruler was added using the Mshot Image Analysis System of Mingmei Microscopic Digital Measurement and Analysis System. The length and width of conidia, width of hyphae, length and width of hyphal peduncle, and size of the septa were measured and the relevant data were counted. The mycelium and conidia of the fungi were stained and observed using dyes such as Calcofluor White Stain, Fluorescent Brightener 28 Stain, and AOPI Stain. Morphological descriptions of several possible genera of mulberry leaf spot pathogens belonging to the family Dematiaceae (dark spore family) were compared in an attempt to identify the genera of the pathogens.</p>
</sec>
<sec id="s2_1_2">
<title>Molecular identification of causal fungal pathogen of leaf spot disease</title>
<p>In this study, typical samples of grey leaf spot disease of mulberry (<italic>Morus atropurpurea</italic>; Guisangyou 12 variety) collected from Guangzhou, Guangdong Province were observed under a microscope to ensure that the diseased samples contained abundant target pathogen spores and very few other pathogens/microorganisms.</p>
</sec>
</sec>
<sec id="s2_2">
<title>DNA extraction and PCR amplification</title>
<p>The extraction of fungal genomic DNA was based on the CTAB method and/or as per the instructions of Genview GV-Filamentous Fungi Genomic DNA Extraction Kit (LOT: 61014010105). The extraction of DNA of mulberry leaves was performed using Plant Genomic DNA Extraction Kit (LOT: 69700110). The bacterial DNA (where applicable) was extracted using Shanghai Bio-Tech SanPrep Column Plasmid DNA Mini-Extraction Kit. The DNA from soil collected from around the morbid mulberry trees was extracted using the Genview kit with some modifications.</p>
<p>PCR was performed using a 2&#xd7;Taq Master Mix from Microanalysis Co., Ltd., containing Taq DNA polymerase, Tris-HCl, (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, MgCl<sub>2</sub>, and dNTPs. Primers at 0.4 &#x3bc;mol/L were provided by Sangon Biotech (Shanghai) Co., Ltd., Guangzhou Branch. Annealing temperatures were adjusted based on melting temperatures of primers. The PCR protocol included an initial denaturation at 94&#xb0;C for 5 minutes, 30 cycles of 94&#xb0;C for 30 seconds, annealing at 55-58&#xb0;C for 30 seconds, and 72&#xb0;C for 1 minute, ending with a final extension at 72&#xb0;C for 10 minutes. PCR products (3&#x2013;5 &#x3bc;L) were analyzed on 1.4% agarose gels stained with ethidium bromide and visualized with the Tanon-1200 system. Target fragments were purified using a DNA kit, involving gel dissolution, spin column processing, and ethanol washes, then eluted and stored at -20&#xb0;C. Sequencing was done by Sangon Biotech, assembled with Lasergene Seqman, and compared via NCBI BLAST for species identification.</p>
<p>Phylogenetic analyses (where applicable) were performed using the Maximum Likelihood (ML) method in MEGA12 software (<xref ref-type="bibr" rid="B48">Kumar et&#xa0;al., 2024</xref>).</p>
</sec>
<sec id="s2_3">
<title>High-throughput sequencing of mulberry leaf spot disease pathogens</title>
<p>The diseased leaves with relatively single colonies were selected and sent to Guangzhou Ruike Gene Technology Co. Ltd. for high-throughput sequencing of the whole genome of ribosomal DNA (rDNA) and mitochondrial DNA (mtDNA). The presence of fungi in the colonies was analyzed through the assembly and annotation of the sequencing results. The full length of the sequences of rDNA and mDNA of the major pathogenic fungi were also obtained.</p>
</sec>
<sec id="s2_4">
<title>DNA extraction, library construction and sequencing</title>
<p>The total DNA was extracted using the Fungal DNA Extraction Kit following the manufacturer&#x2019;s instructions, and the extracted DNA was stored at -20&#xb0;C. The total DNA was constructed into a double-ended, high-throughput sequencing library with a 500-bp insertion using the Illumina Hiseq2500/4000, and a total of 4.38 Gb of high-throughput sequencing was generated.</p>
</sec>
<sec id="s2_5">
<title>Gene sequence assembly</title>
<p>As the DNA extraction process included leaf material, therefore, in order to reduce the influence of the mulberry genomic data on the microbial sequence assembly, the genomic DNA sequences of the mulberry leaves were firstly removed before performing the microbial sequence assembly. The whole genome sequence of <italic>Morus notabilis</italic> (GCA_000414095.2) and the chloroplast genome sequence (NC_027110.1) were selected as the reference genome sequences. The data were compared and analyzed using the BWA (0.7.12-r1039) mapping software. To map the sequencing data with the reference genome of mulberry tree and to determine the sequenced fragments of the reference genome in comparison with genome sequence of mulberry tree, MEM comparison algorithm was selected using the double-end comparison method, with default parameters of the software. A computer program written in python was used to remove the mulberry sequencing data from the fastq sequencing data before proceeding to microbial sequence assembly. Microbial sequence assembly was performed using MetaVelvet (v1.2.01) assembly software.</p>
</sec>
<sec id="s2_6">
<title>Sequence annotation, species identification and species abundance analysis</title>
<p>The sequence tag annotation was performed using blastn (2.2.31+) sequence comparison analysis software. The assembled sequence tag sequences were compared with the nt database of the NCBI. The blastn comparison was set to an expectation value of &lt;1e-20, and the sequence tags were annotated based on the comparison results. The rDNA sequences are important and most commonly used molecular markers for bacterial and fungal identification, so species taxonomic identification and quantification use rDNA as the main molecular marker. Therefore, based on the results of sequence tag annotation, rDNA sequences were selected as the basis for microbial identification and quantitative analysis. Using BWA (0.7.12-r1039) + samtools (v1.2) analysis software, the average sequencing depth of rDNA fragments in the sequencing data was calculated and used as the abundance value of the species.</p>
</sec>
<sec id="s2_7">
<title>Complete ribosomal DNA assembly and experimental validation</title>
<p>The rDNA of fungi consists of 18S segment, ITS1 segment, 5.8S segment, ITS2 segment and 28S segment, with a total length of the sequence about 6 Kb. The initial sequence tag assembled by MetaVelvet (v1.2.01) was a broken ribosomal tag. Therefore, in order to obtain complete rDNA sequences, the analysis was performed using the sequence capture and <italic>de novo</italic> assembly strategy. The rDNA sequence containing the ITS sequence of the target pathogen was selected as the reference sequence, and BWA (0.7.12-r1039) software was used to perform 0 mismatch and 0 gap comparison. Based on the comparison results, the double-ended sequenced fragments were obtained from the sequencing data. The sequence was further assembled and extended using MetaVelvet (v1.2.01) assembly software. The complete rDNA sequence was obtained after multiple cycles.</p>
</sec>
<sec id="s2_8">
<title>Annotation and GC ratio analysis of ribosomal DNA sequences</title>
<p>The rDNA sequences were annotated using blastn (<ext-link ext-link-type="uri" xlink:href="https://blast.ncbi.nlm.nih.gov/">https://blast.ncbi.nlm.nih.gov/</ext-link>) software of the NCBI to compare the rDNA sequences with the nt database, and 28S region, ITS1 region, 5.8S region, ITS2 region and 28S region were annotated. The GC ratios of the sequences were analyzed using a computer program written in python language to calculate the average GC ratio of each region. The program calculates the GC ratio characteristics of rDNA with a window of 100bp and step size of 10bp.</p>
</sec>
<sec id="s2_9">
<title>Calculation of genetic distances and systematic classification</title>
<p>The 18S sequences, ITS1 + 5.8S+ITS2 sequences, 28S sequences, and complete rDNA sequences were compared with closely related species using MUSCLE (v3.8.31) package. Genetic distances between each segment of the rDNA sequence and the relatives were calculated separately using MEGA 12 software. The optimal alternative model for the phylogenetic tree was selected using jModelTest2 (<ext-link ext-link-type="uri" xlink:href="https://github.com/ddarriba/jmodeltest2">https://github.com/ddarriba/jmodeltest2</ext-link>) and this was substituted into the phylogenetic tree constructed using the maximum likelihood (ML) method, with 1,000 iterations of the evolutionary tree.</p>
</sec>
<sec id="s2_10">
<title>Molecular identification of pathogenic fungi based on DNA barcoding</title>
<p>The validation and specific detection primers for the ITS region were designed based on the complete rDNA sequence results. Based on the whole genome sequence annotation results of mtDNA, the validation and specific detection primers were designed for the amplification of partial regions of <italic>Cyt b</italic> and <italic>CO I</italic> genes. These primers were validated and used for pathogen-related gene sequence differences in different regions. Primer Premier 5.0 and NCBI Primer BLAST software were used to design primers. For PCR amplification conditions and procedures, see sub-section &#x201c;<italic>DNA extraction and PCR amplification</italic>&#x201d;.</p>
<p>The amplified sequences were compared using the BLAST function of the NCBI, taking into account Identities and Query cover, and judged according to the score in ascending (high to low) order to determine the closest species/strains. The phylogenetic analysis was performed and trees were constructed using MEGA12 software.</p>
</sec>
<sec id="s2_11">
<title>Isolation and purification of fungal spores from mulberry leaves</title>
<p>Initial attempts to isolate the fungal pathogen on Potato Dextrose Agar (PDA) were unsuccessful. As a result, we employed a serial inoculation technique using fresh mulberry (<italic>Morus atropurpurea</italic>) leaves, and the isolate&#x2019;s purity was confirmed through microscopic examination. Symptomatic leaves were rinsed, surface-sterilized with 1% sodium hypochlorite for 60 s, rinsed thrice in sterile water, and blotted dried. Infected tissue was excised, suspended in 300&#x3bc;L sterile water, vortexed for 1 min, and filtered through cheesecloth to yield a spore suspension (10<sup>4&#x2013;</sup>10<sup>5</sup> spores/mL). Healthy mulberry leaves were sterilized and placed in a double-layer petri dish system, with petioles accessing water through 5-mm holes. The suspension was diluted (1:100) and inoculated (10 &#x3bc;L, 4&#x2013;6 sites/leaf) onto leaves, incubated at 22&#x2013;25&#xb0;C with a 12-h photoperiod for 7&#x2013;14 days. Spores from resulting lesions were harvested with 300 &#x3bc;L water containing 0.01% Tween 80, filtered (40-&#x3bc;m mesh), and re-inoculated onto new leaves for three cycles. Lesions were examined (400&#xd7; magnification) to confirm spore uniformity and purity. Final spores were harvested, centrifuged at 3,000 &#xd7; g for 5 min, and resuspended to 10<sup>5&#x2013;</sup>10<sup>6</sup> spores/mL. Spores were stored at 4&#xb0;C (short-term) or &#x2212;80&#xb0;C in 20% glycerol (long-term). Pathogenicity was confirmed by inoculating spores onto healthy leaves to fulfill Koch&#x2019;s postulates, and DNA extraction for molecular identification (<xref ref-type="bibr" rid="B15">Choi et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B2">Agrios, 2005</xref>).</p>
</sec>
<sec id="s2_12">
<title>Re-inoculation experiment for verification of pathogens based on Koch&#x2019;s postulates</title>
<p>In this experiment, the conidia of the mulberry leaf spot disease pathogen were collected and used as a test material. The inoculum was prepared by eluting the conidia in sterile water and shacked evenly. The density of conidia suspension was adjusted to a concentration of 1.0 x10<sup>8</sup> spores/mL (<xref ref-type="bibr" rid="B8">Babu et&#xa0;al., 2002</xref>). Detached healthy and mature mulberry leaves were used for inoculation. The conidia suspension was applied to the back of the mulberry leaves with sterile absorbent cotton dipped in the conidia suspension. The process was repeated several times, and then the material was sealed in sterile bags, and a certain amount of spore suspension was sprayed with a spray bottle before final sealing. At an interval of 10 days, the inoculated leaves were randomly picked and observed to check pathogen infection (to check whether the pathogen infection has entered the latent stage). If conidia hyphae were observed on the leaves, they were deemed suitable for downstream analysis. The lesion part of the grafted sample was observed microscopically, and the morphological characteristics of the lesion were recorded and compared with the lesion under natural conditions to determine whether the disease state of the grafted sample was consistent with the natural disease state.</p>
</sec>
<sec id="s2_13">
<title>Detection of pathogenic fungi</title>
<p>The mycelia on diseased mulberry leaves were eluted and pure DNA of the pathogen was extracted. Mulberry leaves were collected from plants at different stages of the disease, including the early, peak and late stages. The same weight of leaves was weighed for all disease stages and used for the DNA extraction. The leaves collected at the onset (early) of the disease were treated differently to simulate the degradation process of plant leaves in the outdoor environment, including aging, air-drying and rotting treatments. In addition, the DNA was extracted from the soil around the morbid mulberry leaves in the mulberry orchard and the epidermis of the morbid mulberry branches. The specific primers were designed and used to verify the presence of the leaf spot disease pathogen in the samples.</p>
<p>In the re-inoculation experiment for the early stage of infection, the pathogenic fungus invaded into the mesophyll cells of mulberry leaves but no large number of mycelia, i.e., visible spot and lesions were formed on the surface of the mulberry leaves. The situation was similar to that of the leaves before the outbreak of the disease. The DNA was extracted from the leaves at the early stage of infection, and then subjected to standard PCR amplification and electrophoresis to observe the presence of the target bands and to confirm the infection.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Observation and comparison of symptoms of mulberry leaf spot disease in different regions of Guangdong Province of China</title>
<p>As shown in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>, the manifestation of mulberry leaf spot disease in the samples collected from six cities or counties in Guangdong Province were different in different regions and collection periods. In Guangzhou, the samples were collected during the transition from the summer and autumn to early winter, over a time period of three months. During this period, the mulberry leaf disease gradually spread from the middle and lower parts of the branches to the whole plant, and even to the top of the branches. The number of spots on each leaf was higher, and the spots were in the form of grey mold, indicating abundant mycelia. In the late stage plantation, the land was relatively dry, and the aging degree of the leaves was higher, and the diseased leaves could be seen at the top of the branches (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2a, b</bold>
</xref>). In the samples collected from Wengyuan county, the leaf spots were black, with fewer mycelia. The spots appeared like dye, and fewer discolored spots were observed on the leaf surface (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2c, d</bold>
</xref>). The samples from Yangshan county were collected in the early autumn. The management of the mulberry plantation was better, with minimal incidence of the mulberry leaf spot disease. The samples were collected from mulberry trees maintained in a low shrub form, with leaf-bearing branches located close to the ground, and the back of the leaves showing a lighter black powdery appearance (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2e, f</bold>
</xref>). In Liannan County, the samples were collected from middle of the branches mulberry trees planted in the form of shrubs. The appearance of leaves was poor with grey spots, and no discoloration spots on the leaf surfaces. At the time of sampling, there were milder episodes of mulberry leaf spot disease (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2g, h</bold>
</xref>). The samples were collected from Yingde City in the winter, and the episodes of mulberry leaf spot disease were serious. The lesions of mulberry leaf spot disease were black and almost covered the back of the leaves, but there were not many discolored spots on the leaf surface (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2i, j</bold>
</xref>). The samples from Huazhou city were collected in the summer, when the attack of mulberry leaf spot disease was mild. The samples were collected from the lower part of the branches, with lighter characteristics of the disease, a lighter degree of grey coloration, and a lesser number of leaves affected with lower number of spots on the leaves (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2k, l</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Symptoms of mulberry leaf spot disease in samples collected from different areas of Guangdong Province. <bold>(a, b)</bold> are diseased leaves collected from mulberry demonstration base of South China Agricultural University, Guangzhou city. <bold>(c, d)</bold> are diseased leaves collected from mulberry orchard of silkworm farmers in Wengyuan county, Shaoguan city. <bold>(e, f)</bold> are diseased leaves collected from mulberry orchard at the silkworm extension center of Yangshan county, Qingyuan city. <bold>(g, h)</bold> are diseased leaves collected from mulberry orchard at the silkworm extension center of Liannan Yao Autonomous county, Qingyuan city. <bold>(i, j)</bold> are diseased leaves collected from mulberry orchard at Yingde silkworm seed farm, Yingde city, Qingyuan city. <bold>(k, l)</bold> are diseased leaves collected from mulberry orchard at the silkworm extension center of Huazhou city, Maoming city.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g002.tif">
<alt-text content-type="machine-generated">A grid of twelve images labeled a to l depicting leaves from various plants. The top row (a, c, e, g, i, k) shows leaves in their natural outdoor settings; some are affected by spots and discoloration, suggesting disease. The bottom row (b, d, f, h, j, l) shows individual leaves on a flat background, displaying various stages of damage with spots, holes, and yellowing.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_2">
<title>Pathogen identification based on morphological observation after host-based purification of mulberry leaf spot pathogen spores</title>
<p>The samples of mulberry leaf spot disease collected from six areas in Guangdong Province were scraped and diluted for observation of morphology of the pathogen under the microscope. Host-based purification via three serial leaf inoculations ensured pathogen purity. The representative images are shown in shown in <xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3</bold>
</xref>, <xref ref-type="fig" rid="f4">
<bold>4</bold>
</xref>, and <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>. The microscopic observation revealed that the longer conidia had six septa crumpling inwards. The widest part of the conidia was 5.233 &#x3bc;m and the length reached 53.410 &#x3bc;m. Based on length and number of septa, it was determined that these were the conidia produced on the hyphae. The shorter conidia had three septa crumpling inwards. The widest part of the conidia was 5.436 &#x3bc;m, and the length reached 26.220 &#x3bc;m. Based on length and number of septa, it was determined that the conidia were produced on the conidiophore.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Morphological observations of pathogenic fungi of leaf spot disease. <bold>(a)</bold>. epiphytic mycelium (on the back of the leaf; scale bar is 5 mm); <bold>(b)</bold>. endophytic mycelium (inside the leaf), <bold>(c)</bold>. developed ascospores, <bold>(d)</bold>. mycelium, <bold>(e)</bold>. conidiophores on the undeveloped ascospores, (scale bar is 50 &#x3bc;m); <bold>(f)</bold>. Mature septate conidia (scale bar is 5 &#x3bc;m). These images are obtained after host-based purification of mulberry leaf spot pathogen spores.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g003.tif">
<alt-text content-type="machine-generated">a. Close-up of a green leaf with visible texture and veins. b. Microscopic view of fungal structures on a green background, scale 50 micrometers. c. Cluster of branching fungal hyphae, scale 50 micrometers. d. Isolated fungal hyphae with septa, scale 50 micrometers. e. Group of thin, elongated hyphae, scale 50 micrometers. f. Single spore with septa, scale 5 micrometers.</alt-text>
</graphic>
</fig>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Calcofluor white stain <bold>(a, b)</bold>, fluorescent brightener 28 <bold>(c, d)</bold>, and AOPI <bold>(e, f)</bold> staining of pathogenic fungi. <bold>(a, c)</bold> are conidia under the normal light field after staining; <bold>(b)</bold> is the conidia in the UV light field after Calcofluor White Stain staining; <bold>(d)</bold> is the conidia in the UV light field after Fluorescent Brightener 28 staining. <bold>(e)</bold> is hyphae and conidia under normal light after staining; <bold>(f)</bold> is hyphae and conidia under blue light after staining. The scale bar is 20 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g004.tif">
<alt-text content-type="machine-generated">Microscopic images displaying various views of structures. Image (a) shows elongated structures under a light microscope. Image (b) depicts the same structures illuminated in blue under fluorescence. Image (c) shows a cluster of structures in a light microscope. Image (d) features the clustered structures highlighted in blue under fluorescence. Image (e) displays dispersed elongated structures in a light microscope. Image (f) presents these structures with green fluorescence against a black background. Each image includes a scale bar of twenty micrometers.</alt-text>
</graphic>
</fig>
<p>As shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>, the mycelia were found to be epiphytic (found on the external surface of leaves; <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3a</bold>
</xref>) and endophytic (found inside the leaves; <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3b</bold>
</xref>), with well-developed (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3c</bold>
</xref>) or smaller ascospores (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3d</bold>
</xref>). According to the morphological identification methods of related fungi, there were conidiophores on the ascospores, which were clustered (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3e</bold>
</xref>), zigzag, irregular in shape, and partially branched, so <italic>Clasterosporium</italic> was ruled out. When the conidia are produced, they are produced in the form of buds, and after falling, the spore-producing cells can continue to grow and swell, which is a full-wall budding growth. Our morphological observation revealed that the conidia only had septa (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3f</bold>
</xref>), which were relatively straight stick-shaped, and the morphology didn&#x2019;t conform to the description of <italic>Sirosporium</italic>. The conidia were produced on hyphae, and the hyphae were endophytic or epiphytic, so <italic>Cercospora</italic> was ruled out. Based on foregoing typical morphological characteristics, the pathogen of mulberry leaf disease was presumed to be <italic>Pseudocercospora</italic>.</p>
<p>As shown in <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4a, b</bold>
</xref>, the pathogens produced a higher brightness when stained with the Calcofluor White, indicating that their cell wall contained cellulose or chitin, which combined well with the stain. Using fluorescent colorimetry, it was found that, in addition to mycelium and conidia, more colorable impurities can be&#xa0;seen (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4b</bold>
</xref>), most of those were the impurities that cannot be seen in the ordinary light field (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4a</bold>
</xref>). The Fluorescent Brightener 28 stained the pathogen uniformly. Under the UV light, the fluorescence brightness was weaker than that of Calcofluor staining, but the staining was more uniform (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4c, d</bold>
</xref>). The staining effect of impurities was also weaker, indicating that the stain didn&#x2019;t affect the observation of fungi and that the fungal conidia contained chitin.</p>
</sec>
<sec id="s3_3">
<title>AOPI staining to determine the activity of pathogens</title>
<p>The conidia stored at 4&#xb0;C for 60 days to simulate overwintering were stained with AOPI to test the viability of conidia when stored at low temperature for a longer period of time. As shown in <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4e, f</bold>
</xref>, except for a few, most of the conidia were stained in each field of view, (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4e</bold>
</xref>). The hyphae were weakly stained and some sections of conidia were orange-red, but there were complete green conidia (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4f</bold>
</xref>), indicating that there were still many viable conidia. However, the base number of overwintering conidia was large, and even if the survival rate was very low, the possible infection cannot be underestimated.</p>
<sec id="s3_3_1">
<title>Analysis and application of high-throughput sequencing results</title>
</sec>
</sec>
<sec id="s3_4">
<title>Sequencing data analysis and sequence assembly</title>
<p>Sequencing was performed using the Illumina Hiseq2500/4000 high-throughput sequencing platform, and a total of 18.56 M pairs of sequenced fragments were sequenced, with a double-ended 125 bp read length and a total sequencing data of 4.64 Gb. After sequence alignment with <italic>Morus notabilis</italic> whole genome sequence (GCA_000414095.2) and chloroplast genome sequence (NC_027110.1), a total of 17.11 M (4.27 Gb) sequenced fragments were aligned with the reference genome, which accounted for 92.14% of the total sequence data. The size of the remaining sequence data was 364.95 Mb, accounting for 7.86% of the total sequence data. The high-throughput sequencing data were assembled using MetaVelvet (v1.2.01), and a total of 304946 sequence tags were assembled.</p>
<sec id="s3_4_1">
<title>Sequence annotation, species identification and species abundance analysis</title>
<p>Sequence tags were annotated using blastn (2.2.31+) and the nt database. A total of 261 rRNA sequence tags were annotated. By querying the sequence tag annotation results, a total of 16 genera of fungal microorganisms were found to exist on the leaf surface. The highest relative abundance was found in the genus <italic>Pseudocercospora</italic>, whose molecular tags were sequenced to a depth of 124X, with a relative abundance of 25.10%, accounting for the highest percentage and was identified as the main fungal pathogen in samples of mulberry leaf spot disease (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>; <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Taxonomic tree of fungal microorganisms identified in samples of leaf spot disease of mulberry. Using blastn (v2.5.0+) alignment analysis, sequenced ribosomal DNA sequence tags were aligned with the NCBI nt database, the Environmental Microbiology Database, and the Ricogene Pathogen Database. Based on multiple metrics, including sequence similarity, alignment length, and sequence integrity, a similarity assessment algorithm was used to select the optimal alignment to annotate the tag sequences and analyze the microbial diversity in the tissues. Sequence tag statistics were used to calculate the average sequencing depth of the sequence tags, which was used for quantitative microbial analysis. A plot of the microbial species and numbers was generated using MEGAN (MetaGenome Analyzer; Version 11). In this phylogenetic tree, the size of the circles at each taxonomic level reflects the abundance of the corresponding taxa, with larger circles denoting greater abundance and smaller circles indicating lower abundance.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g005.tif">
<alt-text content-type="machine-generated">Phylogenetic tree showing relationships within Dikarya, including lineages such as Eurotiomycetes, Leotiomycetes, and Sordariomycetes. Highlighted genera include Pseudocercospora, Cordyceps, and Dictyma. Green circles indicate significant nodes.</alt-text>
</graphic>
</fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Fungi identified by annotation of high-throughput sequencing results.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Genus</th>
<th valign="middle" align="left">Quantities</th>
<th valign="middle" align="left">Percentage (%)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">
<italic>Cercospora</italic>
</td>
<td valign="middle" align="left">9</td>
<td valign="middle" align="left">1.84</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Mycosphaerella</italic>
</td>
<td valign="middle" align="left">4</td>
<td valign="middle" align="left">0.82</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>
<italic>Pseudocercospora</italic>
</bold>
</td>
<td valign="middle" align="left">
<bold>123</bold>
</td>
<td valign="middle" align="left">
<bold>25.10</bold>
</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Coniosporium</italic>
</td>
<td valign="middle" align="left">18</td>
<td valign="middle" align="left">3.67</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Emericella</italic>
</td>
<td valign="middle" align="left">4</td>
<td valign="middle" align="left">0.82</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Phyllactinia</italic>
</td>
<td valign="middle" align="left">7</td>
<td valign="middle" align="left">1.43</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Leotiomycetes</italic>
</td>
<td valign="middle" align="left">6</td>
<td valign="middle" align="left">1.22</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Cordyceps</italic>
</td>
<td valign="middle" align="left">55</td>
<td valign="middle" align="left">11.22</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Dicyma</italic>
</td>
<td valign="middle" align="left">86</td>
<td valign="middle" align="left">17.55</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Anthostomella</italic>
</td>
<td valign="middle" align="left">69</td>
<td valign="middle" align="left">14.08</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Circinotrichum</italic>
</td>
<td valign="middle" align="left">76</td>
<td valign="middle" align="left">15.51</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Hypsizygus</italic>
</td>
<td valign="middle" align="left">6</td>
<td valign="middle" align="left">1.22</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Cerotelium</italic>
</td>
<td valign="middle" align="left">5</td>
<td valign="middle" align="left">1.02</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Erratomyces</italic>
</td>
<td valign="middle" align="left">1</td>
<td valign="middle" align="left">0.20</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Kalmanozyma</italic>
</td>
<td valign="middle" align="left">10</td>
<td valign="middle" align="left">2.04</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Pseudozyma</italic>
</td>
<td valign="middle" align="left">11</td>
<td valign="middle" align="left">2.24</td>
</tr>
<tr>
<td valign="middle" align="left">Total</td>
<td valign="middle" align="left">490</td>
<td valign="middle" align="left">100</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>The bold font is used to highlight the abundance of Pseudocercospora in the tested samples.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
</sec>
<sec id="s3_5">
<title>Annotation and GC ratio analysis of rDNA sequence</title>
<p>Based on the results of high-throughput sequencing data assembly and experimental validation, the complete rDNA sequence of <italic>Pseudocercospora</italic> was assembled, with a length of 5469 bp (GC ratio of 50.67%) (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>). The sequence contained the 18S, ITS1, 5.8S, ITS2, and 28S regions. The 18S region was 1726 bp long (GC ratio 48.73%), ITS1 region was 150 bp long (GC ratio 58.00%), 5.8S region was 158 bp long (GC ratio 44.30%), ITS2 region was 149bp long (GC ratio 57.05%), and 28S region was 3286 bp long (GC ratio 51.37%) (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>). The 18S and 28S regions were longer, accounting for 91.64% of the total length of the sequence. While in terms of GC proportion, the average GC proportion of ITS1 (58.00%) and ITS2 (57.05%) region was significantly higher than that of other regions (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3</bold>
</xref>).</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Full sequence annotation of rDNA of <italic>Pseudocercospora</italic>.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Region</th>
<th valign="middle" align="left">Start (bp)</th>
<th valign="middle" align="left">End (bp)</th>
<th valign="middle" align="left">Length (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">18S rRNA</td>
<td valign="middle" align="left">333</td>
<td valign="middle" align="left">2059</td>
<td valign="middle" align="left">1726</td>
</tr>
<tr>
<td valign="middle" align="left">ITS1</td>
<td valign="middle" align="left">2060</td>
<td valign="middle" align="left">2225</td>
<td valign="middle" align="left">165</td>
</tr>
<tr>
<td valign="middle" align="left">5.8S rRNA</td>
<td valign="middle" align="left">2226</td>
<td valign="middle" align="left">2366</td>
<td valign="middle" align="left">140</td>
</tr>
<tr>
<td valign="middle" align="left">ITS2</td>
<td valign="middle" align="left">2367</td>
<td valign="middle" align="left">2516</td>
<td valign="middle" align="left">149</td>
</tr>
<tr>
<td valign="middle" align="left">28S rRNA</td>
<td valign="middle" align="left">2517</td>
<td valign="middle" align="left">5815</td>
<td valign="middle" align="left">3298</td>
</tr>
</tbody>
</table>
</table-wrap>
<sec id="s3_5_1">
<title>Calculation of genetic distances and phylogenetic classification</title>
<p>The p-distance between species of the genus <italic>Pseudocercospora</italic> and the mulberry leaf pathogen <italic>Pseudocercospora mori</italic> GD in the 18S, ITS1 + 5.8S+ITS2, and 28S regions and the intact rDNA was calculated using MEGA12 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). The 18S sequences were highly conserved between species with little variation between species. The ITS sequences, although shorter in length, had a higher degree of distinction due to faster interspecies variation, as well as a higher error. The 28S sequences were longer and had a certain degree of distinction between species (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Plot of genetic distance analysis (height of bar graph is p-distance, whisker line is standard deviation).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g006.tif">
<alt-text content-type="machine-generated">Bar chart comparing pairwise distances of different genetic markers across nine species, including P. pallida and P. opuntiae. The markers are 18S, 28S, ITS1-5.8S-ITS2, and whole rRNA, represented by blue, orange, yellow, and gray bars respectively. Pairwise distances generally increase from P. pallida to P. opuntiae, with notable variations in specific markers.</alt-text>
</graphic>
</fig>
<p>The rDNA sequences were statistically analyzed by jModelTest2, and the alternative model GTR+G with the smallest AIC (Akaike Information Criterion) value was taken as the optimal phylogenetic tree construction model. After 1000 iterations using ML method, the evolutionary trees based on the 18S sequences (A), ITS1 + 5.8S+ITS2 sequences (B), 28S sequences (C), and intact rDNA (D) were calculated (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). The results showed that the 18S sequences were highly conserved with low interspecies differentiation. The ITS1 + 5.8S+ITS2 sequences had large errors, and the support for the branching structure of the tree was very low. The phylogenetic tree constructed using 28S sequence was closer to the intact rDNA phylogenetic tree in terms of structure, but it was not as accurate as the intact rDNA in terms of the calculation of genetic distances (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Phylogenetic trees constructed based on 18S <bold>(A)</bold>, ITS1 + 5.8S+ITS2 <bold>(B)</bold>, 28S <bold>(C)</bold>, and intact ribosomal DNA <bold>(D)</bold>, respectively. <italic>Pseudocercospora mori</italic> GD (PV770134) represents the sample from this study, while the remaining sequences are homologous fungal sequences retrieved from the NCBI database through BLAST comparison, with GenBank accession numbers provided in parentheses. Phylogenetic trees were constructed using the Maximum Likelihood (ML) method with 1,000 bootstrap replicates in MEGA 12.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g007.tif">
<alt-text content-type="machine-generated">Four phylogenetic trees labeled A, B, C, and D, each displaying evolutionary relationships among different Pseudocercospora species and Cercospora outgroups. Branch lengths and bootstrap values indicate genetic distances and support levels. Each tree uses different scaling, emphasizing various groupings and relationships among the species.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_5_2">
<title>Application of high-throughput sequencing results</title>
<p>Based on the results of high-throughput sequencing, the genus <italic>Pseudocercospora</italic> was identified as the main fungal pathogen in the samples of mulberry leaf spot disease. Based on the rDNA and the full length of the mitochondrial genome, the NCBI Primer Blast Primer Premier software were used to design different primers required for downstream experiments (<xref ref-type="table" rid="T4">
<bold>Table&#xa0;4</bold>
</xref>).</p>
<table-wrap id="T4" position="float">
<label>Table&#xa0;4</label>
<caption>
<p>PCR validation primers designed based on rDNA high-throughput sequencing and complete mitochondrial genome sequencing results.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Primer ID</th>
<th valign="middle" align="left">Sequence (5&#x2019;-3&#x2019;)</th>
<th valign="middle" align="left">Gene</th>
<th valign="middle" align="left">Product size (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">W1724f</td>
<td valign="middle" align="left">GCTACACTGACAGAGCCAACG</td>
<td valign="middle" rowspan="2" align="left">
<italic>rDNA</italic>
</td>
<td valign="middle" rowspan="2" align="left">473</td>
</tr>
<tr>
<td valign="middle" align="left">W2196r</td>
<td valign="middle" align="left">TGAAACTCCGACGCAAAGA</td>
</tr>
<tr>
<td valign="middle" align="left">A1956f</td>
<td valign="middle" align="left">TCGGCAACGACCACCCA</td>
<td valign="middle" rowspan="2" align="left">
<italic>ITS</italic>
</td>
<td valign="middle" rowspan="2" align="left">730</td>
</tr>
<tr>
<td valign="middle" align="left">A2685r</td>
<td valign="middle" align="left">CTACCCAGAAGCATCCTCTACAAA</td>
</tr>
<tr>
<td valign="middle" align="left">1w7393F</td>
<td valign="middle" align="left">CACTGCTTCTGCTTTCTTTT</td>
<td valign="middle" rowspan="2" align="left">
<italic>Cyt b</italic>
</td>
<td valign="middle" rowspan="2" align="left">490</td>
</tr>
<tr>
<td valign="middle" align="left">1w7882R</td>
<td valign="middle" align="left">TATTAAATAGACACCACTTC</td>
</tr>
<tr>
<td valign="middle" align="left">2w25369F</td>
<td valign="middle" align="left">ATAACCGAGGTAGTCAGAGC</td>
<td valign="middle" rowspan="2" align="left">
<italic>COI</italic>
</td>
<td valign="middle" rowspan="2" align="left">700</td>
</tr>
<tr>
<td valign="middle" align="left">2w26068R</td>
<td valign="middle" align="left">CTTGTAGTGTATCTGTGTAA</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Complete mitochondrial genome of <italic>Pseudocercospora mori</italic> has been submitted to NCBI with accession number: MG543071.1.</p>
</fn>
<fn>
<p>W1724f/W2196r are primers for specific detection of <italic>Pseudocercospora mori</italic>; A1956f/A2685r are primers for amplification of fungal ITS region; 1H21668F/1H22222R, 2H13208F/2H13744R, 3H15185F/3H15896R, 5H5452F/5H6077R are primers for specific detection of <italic>Pseudocercospora mori</italic>; 1w7393F/1w7882R and 2w25369F/2w26068R are for mitochondrial <italic>Cyt b</italic> and <italic>COI</italic> genes partial segment amplification, respectively.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3_5_3">
<title>Validation of rDNA high-throughput sequencing results of the mulberry leaf spot disease pathogen</title>
</sec>
</sec>
<sec id="s3_6">
<title>Identification of mulberry leaf spot disease pathogens based on barcoded genes ITS, <italic>Cyt b</italic>, <italic>COI</italic>
</title>
<p>Using the universal primers A1956f/A2685r of ITS region, mitochondrial <italic>Cyt b</italic>, and <italic>COI</italic> gene amplification primers, the DNA extracted from mulberry leaf spot disease samples was verified and identified. As shown in <xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>, the results of PCR amplification of each primer group, lanes 1 to 6 (target fragment 730 bp), lanes 7-12 (target fragment 490 bp), and lane 3 (target fragment 700 bp) were obtained with target bands consistent with the expected results, indicating that the results were credible. The PCR products obtained by amplification using different primer sets were sent to Bioengineering for sequencing, and the sequencing results were subjected to phylogenetic analysis.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Electrophoretic gels of PCR amplified products of ITS, <italic>Cyt b</italic> and <italic>CO &#x399;</italic> genes of mulberry leaf spot disease pathogens in different regions. M: TaKaRa DL2000 Marker; lanes 1 to 6 are ITS region amplification primer set A1956f/A2685r; lanes 7 to 12 are <italic>Cyt b</italic> gene region amplification primer set 1w7393F/1w7882R; lanes 13 to 18 are <italic>CO &#x399;</italic> gene region amplification primer set 2w25369F/2w26068R; the DNA templates in lanes 1, 7 and 13 are diseased leaf spot samples from Guangzhou city; 2, 8 and 14 for diseased leaf spot samples from Wengyuan county, Shaoguan city, 3, 9 and 15 are diseased leaf spot samples from Yangshan county, Qingyuan city, 4, 10 and 16 for diseased leaf spot samples from Liannan Yao Autonomous county, Qingyuan city, 5, 11 and 17 for diseased leaf spot samples from Yingde city, Qingyuan city, 6, 12 and 18 for diseased leaf spot samples from Huazhou city, Maoming city.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g008.tif">
<alt-text content-type="machine-generated">An agarose gel electrophoresis image showing DNA bands in lanes labeled with numbers one to eighteen. Lanes M represent the DNA ladder with bands at one thousand, seven hundred, five hundred, four hundred, three hundred, two hundred, and one hundred base pairs. Bright bands in various lanes indicate DNA fragments of different lengths.</alt-text>
</graphic>
</fig>
<p>As shown in <xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9</bold>
</xref>, the species with high homology and similarity to the sequencing results were all <italic>Pseudocercospora</italic>. There were no sequences in the NCBI database with 100% similarity to the present sequences, indicating that the present species might be an unreported species. Based on phylogenetic analysis of the ITS region (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9a</bold>
</xref>), <italic>CO &#x399;</italic> gene (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9b</bold>
</xref>), and <italic>Cyt b</italic> gene (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9c</bold>
</xref>), it was determined that this species belongs to <italic>Pseudocercospora</italic> genus. The identification was performed by submitting the ITS amplified sequence to the barcode database, and then identifying the species according to the barcode process. As shown in <xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9d</bold>
</xref>, most of the sequences in the ITS- <italic>Cyt b</italic>- <italic>CO &#x399;</italic> barcode database of <italic>Pseudocercospora</italic> were highly similar, but there was no complete overlap and no unique neighboring species sequences, indicating that the species could not be named according to the process. In addition, the molecular evolutionary tree constructed using ITS region (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9a</bold>
</xref>), <italic>CO &#x399;</italic> gene (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9b</bold>
</xref>), <italic>Cyt b</italic> gene (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9c</bold>
</xref>) and ITS- <italic>Cyt b</italic>- <italic>CO &#x399;</italic> (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9d</bold>
</xref>) of purified pathogenic spores collected from six locations in Guangdong province (i.e., GZ, WY, YS, LN, YD, and HZ) and the <italic>Pseudocercospora mori</italic> GD assembled by metagenomic sequencing clustered on the same branch, indicating that <italic>Pseudocercospora mori</italic> is the causal/epidemic pathogen of grey leaf spot disease of mulberry (<italic>Morus atropurpurea</italic>) in the present study.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Phylogenetic trees constructed based on the sequences of ITS segment <bold>(a)</bold>, <italic>CO&#x399;</italic> gene <bold>(b)</bold>, <italic>Cyt b</italic> gene <bold>(c)</bold>, and ITS-<italic>Cyt b-CO&#x399;</italic> <bold>(d)</bold>. GZ, Guangzhou City, Guangdong Province sample; WY, Wengyuan County, Shaoguan City sample; YS, Yangshan sample; LN, Liannan Yao Autonomous County, Qingyuan City sample; YD, Yingde City, Qingyuan City sample; HZ, Huazhou City, Maoming City sample. Phylogenetic trees were constructed using the Maximum Likelihood (ML) method with 1,000 bootstrap replicates in MEGA12. The orange arrows represent the purified pathogen spores from the six samples (isolates) collected in this study. The red arrows represent the <italic>Pseudocercospora mori</italic> GD assembled by metagenomic sequencing in this study. The rest of the sequences are the sequences that were compared by the BLAST with the reported homologous sequences of the fungi in the NCBI database. The Genbank accession numbers of sequences are shown in parentheses. ITS-<italic>Cyt b-CO&#x399;</italic> <bold>(d)</bold> reference gene accession numbers are detailed in <xref ref-type="table" rid="T5">
<bold>Table 5</bold>
</xref>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g009.tif">
<alt-text content-type="machine-generated">Phylogenetic trees (a, b, c, d) illustrating the relationships among various Pseudocercospora species and related fungi. Branch lengths and bootstrap values indicate evolutionary distances and support. Highlighted in red are Pseudocercospora mori clusters in each tree, marked with arrows. Different strains, labeled YS, GZ, LN, LJ, YD, and HZ, are shown. Trees display different groupings, with sections shaded to emphasize particular clades. Each panel represents distinct analyses or datasets, reflecting genetic relationships in the study.</alt-text>
</graphic>
</fig>
<table-wrap id="T5" position="float">
<label>Table&#xa0;5</label>
<caption>
<p>Reference sequences (with NCBI accession numbers) of ITS segment, <italic>COI</italic> gene, and <italic>Cyt b</italic> gene used to construct phylogenetic tree (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9d</bold>
</xref>).</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Species</th>
<th valign="middle" align="left">ITS</th>
<th valign="middle" align="left">Cytb</th>
<th valign="middle" align="left">COI</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">
<italic>Pseudocercospora mori</italic>
</td>
<td valign="middle" align="left">PV770134.1</td>
<td valign="middle" align="left">NC_037198.1</td>
<td valign="middle" align="left">NC_037198.1</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Pseudocercospora fuligena</italic>
</td>
<td valign="middle" align="left">GU214675.1</td>
<td valign="middle" align="left">NC_077250.1</td>
<td valign="middle" align="left">NC_077250.1</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Pseudocercospora zelkovae</italic>
</td>
<td valign="middle" align="left">LC739836.1</td>
<td valign="middle" align="left">PQ244007.1</td>
<td valign="middle" align="left">PQ244007.1</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Cercospora beticola</italic>
</td>
<td valign="middle" align="left">NR_121315.1</td>
<td valign="middle" align="left">MW458938.1</td>
<td valign="middle" align="left">NC_085455.1</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Cercospora</italic> sp. J1 LZ-2022</td>
<td valign="middle" align="left">OR122733.1</td>
<td valign="middle" align="left">CP095198.1</td>
<td valign="middle" align="left">CP095198.1</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Penicillium canescens</italic>
</td>
<td valign="middle" align="left">NR_121256.1</td>
<td valign="middle" align="left">NC_059911.1</td>
<td valign="middle" align="left">NC_059911.1</td>
</tr>
<tr>
<td valign="middle" align="left">
<italic>Cladophialophora bantiana</italic>
</td>
<td valign="middle" align="left">PV138957.1</td>
<td valign="middle" align="left">NC_030600.1</td>
<td valign="middle" align="left">NC_030600.1</td>
</tr>
</tbody>
</table>
</table-wrap>
<sec id="s3_6_1" sec-type="results">
<title>Results of re-inoculation experiments based on Koch&#x2019;s postulates</title>
<p>After identifying the existence of the suspected causal pathogen, using Koch&#x2019;s postulates, it was verified whether <italic>Pseudocercospora mori</italic> was the causal pathogen of mulberry leaf spot disease. It was determined whether it can infect leaves and cause leaf disease spot disease following re-inoculation. As shown in <xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10</bold>
</xref>, three healthy mulberry trees were selected for the validation of Koch&#x2019;s postulates in this experiment. The Mulberry leaves infected with <italic>Pseudocercospora mori</italic> were the mature leaves of the middle and lower branches, with about 20 experimental leaves in each group (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10a&#x2013;c</bold>
</xref>). In addition each mulberry tree was inoculated with about 10 leaves soaked with sterile water as a blank control group. Thirty days after inoculation, the corresponding typical symptoms appeared on leaves in all grafted samples (100%), and the diameter of the lesion varied from 0.5 to 1 cm. Discoloration spots (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10d, e</bold>
</xref>), i.e., necrosis of chloroplasts, were seen on the leaf surfaces. The discolored leaves were sectioned for further observation. It was observed that the discolored spots at the fenestrated tissue partly turned brown, indicating that the discolored spots on the leaf surface were caused by the necrosis and discoloration of the chloroplasts at the fenestrated tissue, however the spongy tissue was less affected (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10f</bold>
</xref>). A small brown discoloration was seen on the spongy tissue corresponding to the discolored fenestrated tissue (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10g</bold>
</xref>), and no mycelia (hyphae) growth was seen at the section, indicating that the existence of the discolored spots had no absolute relationship with the mycelium present on the back the leaf. Thirty days after inoculation, the infection entered the latent stage, and mycelia growth was observed within the stomata (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10h</bold>
</xref>). In contrast, the stomata of healthy mulberry leaves consisted of a pair of kidney-shaped defense cells held together and were seen to be free of any impurities (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10i</bold>
</xref>). Under the bright light, brown mycelium with a distinct color difference from the green leaf mesophyll tissue was visible (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10j</bold>
</xref>). After magnification, clear mycelium growing between the mesophyll cells was visible (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10k</bold>
</xref>). The observation of sectioned leaves in the latent phase of the re-inoculation experiment revealed that the free conidia were within the lower epidermis of the leaves (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10m</bold>
</xref>). Based on the direction of mycelium growth, it was seen that the mycelium gradually elongated into the spongy tissue from the lower epidermis (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10l</bold>
</xref>) and approached the fenestrated tissue (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10m</bold>
</xref>). No mycelium invasion into the fenestrated tissues was observed in the sections of several leaves examined in the re-inoculation experiment.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Re-inoculation experiment results based on the Koch&#x2019;s postulates. <bold>(a&#x2013;c)</bold> are three parallel samples of mulberry trees in the re-inoculation experiment. <bold>(d&#x2013;e)</bold> mulberry leaves after 30 days of inoculation with pathogenic fungi (scale bar 1 cm); <bold>(f, g)</bold> tissue sections of a large and a small discolored spots (scale bar 100 &#x3bc;m); <bold>(h, i)</bold> leaf stomata and mycelia growth within the stomata after 30 days of inoculation with pathogenic fungi, where h is the stomata of inoculated mulberry leaves (inoculated group) and <bold>(i)</bold> is the stomata of healthy mulberry leaves (control group), the arrows point to the mycelia growth in the stomata (scale bar 5 &#x3bc;m).; <bold>(j, k)</bold> internal mycelia growth of the leaf after 30 days of inoculation with pathogenic fungi, the arrows point to the mycelia growth in the mesophyll tissue [scale bar 20 &#x3bc;m in <bold>(j)</bold> and 5 &#x3bc;m in <bold>(k)</bold>]; <bold>(l, m)</bold>: cross sections of leaf showing mycelia growth in the leaf mesophyll tissue, arrows indicate the mycelia growth in the leaf mesophyll tissue (scale bar is 20 &#x3bc;m).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g010.tif">
<alt-text content-type="machine-generated">Composite image showing different stages of plant growth and detail. Panels a-c depict plants with leaves in a garden setting with protective coverings. Panels d-e show close-ups of individual leaves with apparent damage and arrows pointing to specific areas. Panels f-m display microscopic views of leaf sections with arrows indicating particular cells or structures, accompanied by scale bars such as &#x201c;5um&#x201d; and &#x201c;20um.&#x201d; Visual differences in color and texture are evident in these close-up images.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_6_2">
<title>Detection of pathogenic fungi in soil and mulberry stems</title>
</sec>
</sec>
<sec id="s3_7">
<title>Validation of specific primers designed based on rDNA sequences</title>
<p>Based on the full length rDNA sequences obtained through high-throughput sequencing, the specific primer W1724f/W2196 (<xref ref-type="table" rid="T4">
<bold>Table&#xa0;4</bold>
</xref>) was designed using the NCBI Primer software. As shown in <xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11</bold>
</xref>, only templates of <italic>Pseudocercospora mori</italic> DNA in the positive control group (lane 1), and the mulberry leaf spot disease pathogen DNA of positive control (lane 13) produced bands at about 473 bp, while the other non-<italic>Pseudocercospora mori</italic> DNA templates had no bands or produced non-specific bands with a large difference in the size of the target band. The target fragment was brighter and had a single band, and there was no primer dimer (see lanes 1 and 13), indicating that the primer could be used for the specific detection of pathogen. The sensitivity of the primer was tested and acceptable results were obtained. The primers can detect the pathogen DNA diluted to 3&#xd7;10&#x2013;<sup>2</sup> ng/&#x3bc;L (see lanes 16-19). Although the bands produced 3&#xd7;10&#x2013;<sup>2</sup> ng/&#x3bc;L concentration was weak, it was still visible when magnified.</p>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>Validation of specific PCR primers designed based on <italic>Pseudocercospora mori</italic> rDNA. M: TaKaRa DL1000 Marker; lanes 1&#x2013;15 are for primer (W1724f/W2196r) specificity test, and lanes 16&#x2013;21 are for sensitivity test. The DNA templates for each lane are: 1: DNA of <italic>Pseudocercospora mori</italic>; 2: Cladosporium sp.; 3: <italic>Penicillium verruculosum</italic>; 4 <italic>Aspergillus</italic> sp.; 5: <italic>Lecanicillium psalliotae</italic>; 6: <italic>Phanerina mellea</italic>; 7: <italic>Schizophyllum commune</italic>; 8: <italic>Candida mucifera</italic>; 9: <italic>Lasiodiplodia theobromae</italic>; 10: <italic>Pseudomonas aeruginosa</italic>; 11: <italic>Phyllactinia moricola</italic>; 12: <italic>Ciboria carunculoides</italic>; 13: DNA of mulberry leaf spot disease pathogen (positive control); 14: DNA of mulberry tree (negative control); 15 water (blank control). Lanes 16&#x2013;21 represent gradient dilutions of pathogen DNA. 16: 30 ng/&#x3bc;L; 17: 3 ng/&#x3bc;L; 18 is 3&#xd7;10&#x2013;<sup>1</sup> ng/&#x3bc;L; 19: 3&#xd7;10&#x2013;<sup>2</sup> ng/&#x3bc;L; 20: 3&#xd7;10&#x2013;<sup>3</sup> ng/&#x3bc;L; and 21: 3&#xd7;10&#x2013;<sup>4</sup> ng/&#x3bc;L.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g011.tif">
<alt-text content-type="machine-generated">Gel electrophoresis image showing DNA bands across multiple lanes with a marker ladder indicating sizes from 100 to 1000 base pairs. Lanes are numbered 1 to 21, with varying band intensities visible, particularly in lanes 12, 13, 15, and 17. Marker lanes are labeled &#x201c;M&#x201d;.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_8">
<title>Validation of presence of <italic>Pseudocercospora mori</italic> in the soil and on mulberry stems retrieved from mulberry orchards</title>
<p>In this experiment, soil samples from eight mulberry growing areas were selected for DNA extraction. The samples were tested for the presence of suspected pathogenic fungi using <italic>Pseudocercospora mori</italic> specific detection primers t1724f/W2196r. As shown in <xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12a</bold>
</xref>, the DNA templates of the soil from the incidence area of Guangzhou city (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12a</bold>
</xref>: lane 1), Yingde city (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12a</bold>
</xref>: lanes 3-4), the mulberry demonstration base of the South China Agricultural University (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12a</bold>
</xref>: lanes 5-8), and the conidia-positive control of mulberry leaf spot disease pathogen (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12a</bold>
</xref>: lanes 9-10) produced bands of about 473 bp. These results indicated that the soil samples contained conidia of mulberry leaf spot disease pathogen. No bands were produced in the soil samples collected from of the re-inoculation experimental area (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12a</bold>
</xref>: lane 2), as well as in the negative control (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12a</bold>
</xref>: lanes 11-12).</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Mulberry fouling leaf disease related materials used to extract DNA of pathogenic bacteria. <bold>(a)</bold> soil of the laboratory mulberry planting area; <bold>(b)</bold>. soil samples collected from of the re-inoculation experimental area in this study; <bold>(c, d)</bold>. soil samples of the mulberry garden of Yingde Silkworm Breeding Farm, Yingde City; <bold>(e&#x2013;h)</bold> soil samples collected from mulberry demonstration base of the South China Agricultural University; <bold>(i)</bold> mulberry twigs affected with leaf spot disease; <bold>(j)</bold> newly grown mulberry branches after winter pruning. Scale bar is 1 cm.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g012.tif">
<alt-text content-type="machine-generated">Grid of images showing different soil samples on red backgrounds labeled a to h, depicting varying textures and compositions. To the right, images i and j feature plant stems on a white background with a scale indicating one centimeter.</alt-text>
</graphic>
</fig>
<p>Next, the twigs from the diseased mulberry (<xref ref-type="fig" rid="f12">
<bold>Figures&#xa0;12i, j</bold>
</xref>) were collected for DNA extraction and tested for the presence of the suspected pathogen using the specific detection primers W1724f/W2196r.</p>
<p>As shown in <xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13b</bold>
</xref>, the specific bands were obtained at 473 bp for the diseased mulberry samples (13B, lanes 1, 3, 4, 5, and 6), as well as for the conidia-positive control of the mulberry leaf spot disease pathogen (13B, lanes 7-12). In contrast, no bands were obtained for the undiseased mulberry twigs (13B, lane 2), as well as for the negative control (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13b</bold>
</xref>: lanes 13-15), suggesting the presence of the suspected mulberry leaf spot pathogen in the mulberry samples.</p>
<fig id="f13" position="float">
<label>Figure&#xa0;13</label>
<caption>
<p>Detection of mulberry leaf spot disease pathogens in soil and twigs samples collected from different sources. <bold>(a)</bold> Mulberry leaf spot disease pathogen detection in soil from different sources. The DNA templates were as follows: 1. soil from the mulberry planting area in the laboratory; 2. soil samples collected from the re-inoculation experimental area; 3. soil from the mulberry garden of Yingde Silkworm Breeding Farm in Yingde City; 4. soil from the Yingde City; 5-8: soil samples from the demonstration base of the South China Agricultural University (taken from the four mulberry planting areas in the Mulberry Garden); Lanes 9-10. Mulberry leaf spot disease DNA (positive control); lane 11: Mulberry DNA (negative control); lane 13: sterile water (blank control). M TaKaRa DL5000 Marker; <bold>(b)</bold> Detection of the presence of pathogenic fungi in diseased mulberry trees. The DNA templates for each lane were extracted from the following materials: 1 and 3: diseased mulberry branches; 2: newly grown (non-diseased) mulberry branches; 4-5: mulberry leaves collected from re-inoculation experiment; 6. diseased mulberry leaves; 7&#x2013;12 mulberry leaf spot disease pathogen DNA (positive control); 13&#x2013;14 mulberry DNA (negative control); 15. sterile water (blank control); M TaKaRa DL5000 Marker.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g013.tif">
<alt-text content-type="machine-generated">Gel electrophoresis results in two panels labeled &#x201c;a&#x201d; and &#x201c;b&#x201d;. Panel &#x201c;a&#x201d; has lanes M and 1 to 13, with bright bands mainly around the 500 base pairs mark. Panel &#x201c;b&#x201d; has lanes M and 1 to 15, with distinct bands near 400 to 500 base pairs. Molecular weight markers are labeled on the left side of each gel.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Mulberry grey leaf spot is an important disease that causes significant damages to mulberry production and sericulture industry (<xref ref-type="bibr" rid="B46">Kumar et&#xa0;al., 2011b</xref>). This study provides the first comprehensive characterization of grey leaf spot disease in mulberry caused by <italic>Pseudocercospora mori</italic> in multiple regions of Guangdong Province of China. The pathogen was consistently isolated from the diseased samples. We systematically investigated mulberry grey leaf spot disease through detailed observation of affected leaves, rigorous combination of morphological and molecular identification of the pathogen, isolation, and high-throughput sequencing. The pathogenicity of the suspected causal pathogen was confirmed through re-inoculation experiments, fulfilling the Koch&#x2019;s postulates. This finding represents either a new geographic report or a previously undocumented association in this region, emphasizing the geographical variations in disease occurrence, pathogen diversity, the expanding distribution and potential impact of <italic>Pseudocercospora mori</italic> on mulberry cultivation. Our results substantially expand the known diversity of fungal pathogens causing leaf spot disease in <italic>Morus</italic> spp. and have important implications for disease diagnosis and management. <italic>Pseudocercospora mori</italic> has been previously identified as a causal pathogen of the grey leaf spot disease of mulberry in Japan, Democratic Republic of the Congo, the US, India, Pakistan, and Australia (<xref ref-type="bibr" rid="B8">Babu et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B32">Grice et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B1">Abbas et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B60">Niaz et&#xa0;al., 2010</xref>). Tellingly, the disease symptoms and pathogen characteristics vary depending on the disease onset period, mulberry variety, environmental conditions, and management practices. Although, <italic>Pseudocercospora mori</italic> has been previously documented in different parts of the world, our work makes a significant contribution to the phytopathological mapping of <italic>Pseudocercospora mori</italic>, particularly as its role has remained underreported in subtropical regions of China despite increasing foliar disease incidence in mulberry plantations. Based on the data obtained in our experiments, we have simulated the infection cycle of mulberry grey leaf spot pathogen in <xref ref-type="fig" rid="f14">
<bold>Figure&#xa0;14</bold>
</xref>.</p>
<fig id="f14" position="float">
<label>Figure&#xa0;14</label>
<caption>
<p>Simulated infection cycle of the mulberry leaf spot disease pathogen.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1648690-g014.tif">
<alt-text content-type="machine-generated">Diagram illustrating the life cycle of Pseudocercospora mori on plants. Healthy plants become initially infected by spores. The invasion leads to incubation and diseased plants, which release more spores. These spores diffuse through wind and rainwater or are carried by animals, causing re-infection. Spores can also overwinter in soil and plant branches, awaiting release.</alt-text>
</graphic>
</fig>
<sec id="s4_1">
<title>Symptoms of mulberry grey leaf spot disease</title>
<p>Mulberry grey leaf spot disease is characterized by diverse symptoms including grayish mold-like patches, black sooty spots, light gray areas, and powdery dark gray coatings (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>) (<xref ref-type="bibr" rid="B30">Govindaiah et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B55">Maji et&#xa0;al., 2008</xref>). This variability stems not only from the characteristics of the pathogen <italic>Pseudocercospora mori</italic> but also from the interplay of climate, season, orchard management, mulberry variety, cultivation practices, and pest influences (<xref ref-type="bibr" rid="B11">Biswas et&#xa0;al., 1995</xref>; <xref ref-type="bibr" rid="B14">Chattopadhyay et&#xa0;al., 2011</xref>). The composition of foliar fungal communities significantly influences disease expression. For instance, <xref ref-type="bibr" rid="B57">Mati&#x107; et&#xa0;al. (2019)</xref> found that traditionally saprophytic fungi, such as <italic>Paramyrothecium foliicola</italic>, can induce leaf spot diseases, suggesting that fungal ecological roles may shift with environmental conditions. Similarly, there may be mechanisms that regulate the different colors and causes of mulberry gray leaf spot disease symptoms.</p>
<p>Fungal community structure is shaped by host plant species and geographic location, which in turn influence disease manifestations. <xref ref-type="bibr" rid="B21">Darcy et&#xa0;al. (2020)</xref> demonstrated that leaf fungal communities in Hawaiian dicotyledonous plants correlate with host phylogeny and environmental factors (e.g., elevation), with geographic distance driving community divergence. Likewise, <xref ref-type="bibr" rid="B22">David et&#xa0;al. (2015)</xref> reported that aboveground fungal communities in the U.S. coastal dune ecosystems are constrained by host species and geographic barriers, while belowground communities are more influenced by environmental filtering. These findings suggest that regional variations in mulberry grey leaf spot symptoms may partly arise from differences in mulberry varieties and local fungal assemblages. For example, shrub-type and herbaceous mulberry differ in leaf surface microenvironments, affecting pathogen adhesion and infection efficiency (<xref ref-type="bibr" rid="B30">Govindaiah et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B49">Li et&#xa0;al., 2024</xref>).</p>
<p>Climate and season are pivotal drivers of symptom diversity. Optimal temperatures (20&#x2013;30&#xb0;C) and high humidity typically enhance fungal spore germination and infection (<xref ref-type="bibr" rid="B84">Zhao et&#xa0;al., 2022</xref>). However, extreme heat (&gt;35&#xb0;C) can impair spore viability, and excessive humidity (e.g., prolonged leaf wetness) may hinder mycelial growth by washing off spores or creating unfavorable conditions (<xref ref-type="bibr" rid="B32">Grice et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B70">Schoch et&#xa0;al., 2012</xref>). Effective orchard management, such as pruning and fertilization, significantly reduces disease severity, with well-maintained orchards exhibiting milder symptoms (<xref ref-type="bibr" rid="B30">Govindaiah et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B67">Rohela et&#xa0;al., 2025</xref>). Pests and concurrent diseases, like brown leaf spot, exacerbate symptom variability by compromising mulberry resistance (<xref ref-type="bibr" rid="B11">Biswas et&#xa0;al., 1995</xref>; <xref ref-type="bibr" rid="B34">Guha, 2025</xref>). This study observed no consistent correlation between leaf-back lesions and leaf-surface discoloration (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10d, e</bold>
</xref>), with discoloration linked to palisade cell necrosis (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10f, g</bold>
</xref>). While partially attributed to the pathogen, leaf aging and pest damage also contribute to disease progression (<xref ref-type="bibr" rid="B11">Biswas et&#xa0;al., 1995</xref>). Thus, the complexity of mulberry grey leaf spot symptoms reflects the synergistic effects of biotic and abiotic factors, necessitating an ecological approach for accurate diagnosis and management.</p>
<p>
<italic>Pseudocercospora</italic> spp., including <italic>Pseudocercospora mori</italic>, have a broader ecological range and greater adaptability to diverse microclimatic conditions (<xref ref-type="bibr" rid="B18">Crous et&#xa0;al., 2013b</xref>; <xref ref-type="bibr" rid="B61">Nzioki et&#xa0;al., 2020</xref>). Importantly, mulberry leaf spot disease caused by <italic>Phloeospora maculans</italic> has been associated to high rainfall and humid environment in Korea, Turkey, and Nigeria (<xref ref-type="bibr" rid="B72">Soylu et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B10">Baiyewu et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B40">Hong et&#xa0;al., 2011</xref>). Previously, our group has reported mulberry zonate leaf spot disease, caused by fungal pathogen <italic>Gonatophragmium mori</italic>, occurring during the hot and humid months in Guangxi province of China (<xref ref-type="bibr" rid="B54">Luo et&#xa0;al., 2024</xref>). Similarly, <italic>Pseudocercospora fijiensis</italic> in banana and <italic>Pseudocercospora musae</italic> in plantain have been reported to have an affinity with humid microenvironments (<xref ref-type="bibr" rid="B7">Arzanlou et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B16">Churchill, 2011</xref>; <xref ref-type="bibr" rid="B18">Crous et&#xa0;al., 2013b</xref>). This adaptability of the related fungal pathogens may&#xa0;explain the prevalence and widespread distribution of <italic>Pseudocercospora mori</italic> observed in different localities surveyed in this study.</p>
</sec>
<sec id="s4_2">
<title>Morphological and molecular identification of the pathogen</title>
<p>In the present study, the isolated pathogen causing mulberry grey leaf spot exhibited characteristic <italic>Pseudocercospora</italic> morphology, including internal hyphae, external hyphae, stromata and clavate conidia (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). <italic>Pseudocercospora</italic>, belonging to the Mycosphaerellaceae (Ascomycota), typically produces dark, elongated, multi-septate conidia with simple stromatic structures and hyphae that often invade hosts via stomata (<xref ref-type="bibr" rid="B17">Crous et&#xa0;al., 2013a</xref>; <xref ref-type="bibr" rid="B25">Dobbs et&#xa0;al., 2024</xref>). Through morphological analysis and host specificity, this study excluded related genera such as <italic>Clasterosporium</italic>, <italic>Sirosporium</italic>, and <italic>Cercospora</italic>, initially identifying the pathogen as <italic>Pseudocercospora mori</italic> (<xref ref-type="bibr" rid="B53">Liu and Guo, 1998</xref>). This aligns with reports of mulberry gray leaf spot caused by <italic>Pseudocercospora mori</italic> in Australia (<xref ref-type="bibr" rid="B32">Grice et&#xa0;al., 2006</xref>), Iran (<xref ref-type="bibr" rid="B39">Hesami et&#xa0;al., 2012</xref>), and Pakistan (<xref ref-type="bibr" rid="B60">Niaz et&#xa0;al., 2010</xref>), indicating its global occurrence in mulberry (<italic>Morus</italic> spp.).</p>
<p>The infection process further reveals the pathogen&#x2019;s morphology. <italic>Pseudocercospora mori</italic> produces primary infection hyphae, internal hyphae, and secondary infection hyphae (<xref ref-type="bibr" rid="B8">Babu et&#xa0;al., 2002</xref>). Primary hyphae, derived from conidia, penetrate leaves directly or via stomatopodia, which swell into vesicle-like structures in stomatal chambers. Internal hyphae form compact stromata in substomatal cavities, each bearing 1&#x2013;5 conidia on short, unbranched conidiophores. Secondary hyphae, arising from internal hyphae or stromata, emerge onto the leaf surface, branching extensively and producing single conidia morphologically similar to stromatic conidia. Conidia are obclavate to cylindrical, with 3&#x2013;17 cells, measuring 4&#x2013;35 &#xd7; 1.5&#x2013;2 &#x3bc;m (<xref ref-type="bibr" rid="B8">Babu et&#xa0;al., 2002</xref>). In the present study, we recorded elongated conidia (33.779&#x2013;68.286 &#xd7; 3.638&#x2013;5.649 &#x3bc;m, 6 septa) and short conidia (20.368&#x2013;36.605 &#xd7; 3.560&#x2013;5.310 &#x3bc;m, 3 septa), partially overlapping with report of <xref ref-type="bibr" rid="B8">Babu et&#xa0;al., 2002</xref>, with septa number and aspect ratio varying by environment (<xref ref-type="bibr" rid="B35">Guo and Liu, 2005</xref>). Calcofluor White and Fluorescent Brightener 28 staining confirmed chitin in conidial walls (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4a&#x2013;d</bold>
</xref>), while AOPI staining showed that some conidia remain viable (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4e, f</bold>
</xref>), suggesting prolonged survival and dispersal under favorable conditions (<xref ref-type="bibr" rid="B12">Canto-Canch&#xe9; et&#xa0;al., 2023</xref>).</p>
<p>Although morphological identification methods are indispensable for preliminary assessments, they often fall short when dealing with morphologically complex and underreported fungal taxa. Morphological identification relies on phenotypes, whereas molecular approaches reveal interspecies differences through DNA sequences (<xref ref-type="bibr" rid="B66">Raja et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B81">Zaman et&#xa0;al., 2025</xref>). Therefore, for confirming taxonomic placement of the causal pathogen with high resolution, the present study employed molecular identification through high-throughput sequencing and validated the pathogen identity, with <italic>Pseudocercospora</italic> sequences showing the highest abundance (25.10%, <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). The rDNA sequence (5469 bp, GC content 50.67%) included 18S, ITS1, 5.8S, ITS2, and 28S regions, with ITS lacking a 100% match, suggesting potential species-level variation (<xref ref-type="bibr" rid="B68">Romanelli et&#xa0;al., 2014</xref>). Additionally, <italic>Cyt b</italic> and <italic>COI</italic> sequences indicated close affinity to <italic>Pseudocercospora</italic>, but limited <italic>COI</italic> database coverage hindered species-level resolution (<xref ref-type="bibr" rid="B17">Crous et&#xa0;al., 2013a</xref>). The 18S region was highly conserved, ITS showed high variability with increased error rates, and 28S was more reliable (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;2</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>3</bold>
</xref>). Combining high-throughput sequencing and host traits, the pathogen was confirmed as <italic>Pseudocercospora mori</italic> (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9</bold>
</xref>). This study used ITS, <italic>Cyt b</italic>, and <italic>COI</italic> to confirm genus-level classification, but ITS conservation and database limitations necessitate additional genes like <italic>EF-1&#x3b1;</italic> for species-level resolution (<xref ref-type="bibr" rid="B17">Crous et&#xa0;al., 2013a</xref>; <xref ref-type="bibr" rid="B29">Gonz&#xe1;lez-Sayer et&#xa0;al., 2022</xref>).</p>
<p>Initially, we employed PDA as the basic medium to isolate the target fungal pathogen from diseased mulberry leaves exhibiting leaf spot symptoms, however, artificial culturing of <italic>Pseudocercospora mori</italic> proved challenging, likely due to its specific growth requirements (<xref ref-type="bibr" rid="B33">Groenewald et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B23">de Jesus et&#xa0;al., 2025</xref>). We were successful in isolating a number of other filamentous fungi (data not shown). None of those were confirmed as the primary mulberry leaf spot pathogen based on pathogenicity tests and symptom reproduction, indicating that PDA medium was unsuitable for isolating the target (<italic>Pseudocercospora mori</italic>) pathogen. The successful purification of viable spores via host-based inoculation on fresh mulberry leaves suggests that the pathogen has host-specific growth requirements rather than inherent unculturability.</p>
<p>High-throughput sequencing overcame above limitations, verifying the pathogen&#x2019;s presence (<xref ref-type="bibr" rid="B50">Li et&#xa0;al., 2021</xref>). Genomic studies of other <italic>Pseudocercospora</italic> species, such as <italic>Pseudocercospora macadamiae</italic> and <italic>Pseudocercospora ceratoniae</italic>, have elucidated genetic diversity and pathogenicity mechanisms, guiding future molecular classification of <italic>Pseudocercospora mori</italic> (<xref ref-type="bibr" rid="B3">Akinsanmi and Carvalhais, 2020</xref>; <xref ref-type="bibr" rid="B63">Perrotta et&#xa0;al., 1998</xref>). Integrating morphology and molecular data is critical for confirming <italic>Pseudocercospora mori</italic>, though environmental impacts on conidial morphology warrant further investigation to clarify taxonomic significance as argued for other pathogenic fungi. Additionally, the specific impacts of environmental factors, such as temperature and humidity on conidial germination, remain underexplored. Future research should focus on developing portable diagnostic tools for rapid detection, integrating multi-gene sequencing (e.g., <italic>EF-1&#x3b1;</italic>, <italic>RPB2</italic>) to refine taxonomic classification, and investigating the molecular interactions between <italic>Pseudocercospora mori</italic> and mulberry hosts to better understand pathogenesis and inform control strategies.</p>
</sec>
<sec id="s4_3">
<title>Pathogen detection and dissemination</title>
<p>Given the limitations of morphological identification and the cryptic nature of symptom expression in early infection stages, we&#xa0;developed a PCR-based detection method specific for <italic>Pseudocercospora mori</italic>. The PCR detection with <italic>rDNA</italic> sequence of <italic>Pseudocercospora mori</italic> W1724f/W2196r primers was sensitive and specific, as no cross-reactivity was observed with DNA extracted from other pathogens, including related fungal species. Given the long procedural time of culture-based isolation methods, which require 5&#x2013;7 days for fungal isolation and sporulation, PCR-based detection offers a faster turnaround time, enhancing the feasibility of field diagnostics. Importantly, in the present study, PCR with W1724f/W2196r primers enabled detection of <italic>Pseudocercospora mori</italic> during the early phase. This is particularly critical for narrowing the control window and the timely implementation of disease management measures (<xref ref-type="bibr" rid="B50">Li et&#xa0;al., 2021</xref>). From a practical perspective, the whole genome sequences obtained and assembled, along with the primer set (W1724f/W2196r) developed and validated in this study, could be utilized to develop quantitative PCR (qPCR) and field-friendly LAMP assays, thereby enhancing the scalability and practicality of <italic>Pseudocercospora mori</italic> monitoring, especially in large-scale mulberry production systems.</p>
<p>Soil serves as a critical reservoir for microbes and plant debris, facilitating their survival and spread. Like other fungal pathogen, <italic>Pseudocercospora mori</italic> remains viable in surrounding soil and fallen mulberry tissues. This study employed fungus-specific primers to extract DNA from mulberry orchard soil (<xref ref-type="fig" rid="f12">
<bold>Figures&#xa0;12a&#x2013;h</bold>
</xref>), optimizing the protocol to minimize OD measurement errors and ensure reliable detection. The DNA concentration of <italic>Pseudocercospora mori</italic> in soil ranged from 3&#xd7;10&#x207b;&#xb3; to 3&#xd7;10&#x207b;&#xb9; ng/&#x3bc;L, corresponding to an estimated spore density of 10&#xb2;&#x2013;10&#xb3; spores/g. This suggests that 10<sup>6</sup>&#x2013;10<sup>7</sup> spores may accumulate around each mulberry tree, far exceeding the threshold for disease outbreaks (<xref ref-type="bibr" rid="B19">Crous et&#xa0;al., 2023</xref>). These findings highlight soil as a primary dissemination source for <italic>Pseudocercospora mori</italic>, particularly in high-density orchards (<xref ref-type="bibr" rid="B11">Biswas et&#xa0;al., 1995</xref>). AOPI staining revealed that spores retained viability under cold storage (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4e, f</bold>
</xref>), and the mild, humid climate of Guangdong (20&#x2013;30&#xb0;C, high humidity) further prolongs spore survival, amplifying dissemination risks (<xref ref-type="bibr" rid="B27">Furuya et&#xa0;al., 2025</xref>). Infected leaves and twig debris contribute to persistent disease cycles by dispersing spores via rain splash or wind (<xref ref-type="bibr" rid="B32">Grice et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B26">Dofuor et&#xa0;al., 2024</xref>). Based on this evidence, it is recommended that, in addition to removing diseased leaves, winter field management in mulberry orchards should include disinfection and sterilization of both soil and twig surfaces to effectively prevent the occurrence of grey leaf spot disease.</p>
<p>The Koch&#x2019;s postulates confirmed the pathogenicity of <italic>Pseudocercospora mori</italic> (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10</bold>
</xref>). Thirty days post-inoculation, leaves exhibited characteristic discoloration spots (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10d, e</bold>
</xref>), with hyphae penetrating spongy tissue via stomata but not reaching palisade tissue, indicating a preference for superficial and mid-layer infection (<xref ref-type="bibr" rid="B8">Babu et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B4">Alves et&#xa0;al., 2021</xref>). The DNA detection verified the presence of <italic>Pseudocercospora mori</italic> nucleic acids in diseased leaves (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13b</bold>
</xref>), soil (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13a</bold>
</xref>), and twigs (<xref ref-type="fig" rid="f13">
<bold>Figure&#xa0;13b</bold>
</xref>), confirming its persistence beyond leaves in soil residues and woody debris (<xref ref-type="bibr" rid="B30">Govindaiah et&#xa0;al., 2002</xref>). Twigs, as potential source of infection, may spread the pathogen through pruning or transport, warranting special attention (<xref ref-type="bibr" rid="B76">Wang, 2009</xref>). This multi-pathway survival complicates disease management, particularly in continuous cropping systems.</p>
<p>Although <italic>Pseudocercospora mori</italic> rarely infects beyond the Moraceae family, cross-infection risks among Moraceae plants (e.g., <italic>Morus</italic> and <italic>Ficus</italic>) remain a concern (<xref ref-type="bibr" rid="B39">Hesami et&#xa0;al., 2012</xref>). Avoiding cultivation of other Moraceae crops near mulberry orchards is recommended to limit host availability. Future research should investigate antagonistic interactions between soil microbial communities and <italic>Pseudocercospora mori</italic>, alongside quantifying the effects of rainfall and soil moisture on spore dispersal (<xref ref-type="bibr" rid="B21">Darcy et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B84">Zhao et&#xa0;al., 2022</xref>). Integrating molecular diagnostics, ecological management, and sustainable control measures will pave the way for effective, long-term management of mulberry grey leaf spot disease in the Guangdong region.</p>
</sec>
</sec>
<sec id="s5" sec-type="conclusions">
<title>Conclusion</title>
<p>In this study, traditional morphological methods, high-throughput sequencing, molecular phylogenetic analysis, and pathogenicity tests were used to identify the main causal pathogen of grey leaf spot disease in mulberry samples collected from different localities of Guangdong province of China. We obtained the full sequences of rDNA and mitochondrial genome of <italic>Pseudocercospora</italic> spp. Based on the sequencing results, primers sets were designed for PCR amplification and sequencing of ITS, <italic>Cyt b</italic>, and <italic>CO I</italic> gene segment sequences, and phylogenetic analysis. The molecular phylogenetic results showed that the pathogenic fungi belonged to the family Mycosphaerellaceae and genus <italic>Pseudocercospora</italic>. Combing morphological features and molecular evidence and the host, <italic>Pseudocercospora mori</italic> was identified as a main causal pathogen of mulberry leaf spot disease. PCR primers&#xa0;specifically designed based on the rDNA sequence of <italic>Pseudocercospora mori</italic> achieved a detection sensitivity as low as 3 &#xd7; 10&#x207b;&#xb2; ng/&#x3bc;L. This assay enables early-stage diagnosis from infected leaf tissue and is also applicable for pathogen detection on the surface of mulberry twigs and in orchard soil. These results substantially expand the known diversity of fungal pathogens associated with leaf spot disease in <italic>Morus</italic> spp., with important implications for disease diagnosis and management at the field level. Future studies should focus on elucidating the mechanisms of infection and host&#x2013;pathogen interactions.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>All data generated or analyzed during this study are included&#xa0;in&#xa0;this article and its supplementary information files. Metagenomic&#xa0;data&#xa0;have been submitted to NCBI with the accession numbers:&#xa0;PRJNA1272820, SAMN48924798, and SRR33885040. <italic>Pseudocercospora mori</italic> GD mitochondria complete genome have been submitted to NCBI with the accession number: NC_037198.1. <italic>Pseudocercospora mori</italic> GD nuclear rRNA/ITS complete genome have been submitted to the NCBI with the accession number: PV770134. <italic>COI</italic> (GenBank PV780452-PV780457); <italic>Cytb</italic> (GenBank PV806600-PV806605); ITS (GenBank PX062118-PX062123).</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>IQ: Formal analysis, Visualization, Writing &#x2013; original draft, Data curation, Investigation, Methodology, Validation, Conceptualization, Writing &#x2013; review &amp; editing. TY: Formal analysis, Methodology, Validation, Data curation, Investigation, Writing &#x2013; original draft. XL: Methodology, Formal analysis, Writing &#x2013; review &amp; editing, Data curation, Investigation, Validation. JL: Resources, Writing &#x2013; review &amp; editing, Validation, Methodology, Visualization, Conceptualization, Supervision, Funding acquisition.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research and/or publication of this article. The research was financially supported by the China Agriculture Research System (CARS-18-ZJ0304).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We thank all lab mates who supported during this project.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
<p>The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.</p>
</sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors&#xa0;and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2025.1648690/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2025.1648690/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abbas</surname> <given-names>S. Q.</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Niaz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ayesha</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Iftikhar</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>New fungal records on Morus alba from Faisalabad Pakistan I</article-title>. <source>Pak. J. Bot.</source> <volume>42</volume>, <fpage>583</fpage>&#x2013;<lpage>592</lpage>.</citation></ref>
<ref id="B2">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Agrios</surname> <given-names>G. N.</given-names>
</name>
</person-group> (<year>2005</year>). <source>Plant Pathology</source>. <edition>5th ed</edition> (<publisher-loc>United States of America</publisher-loc>: <publisher-name>Academic Press, Elsevier</publisher-name>).</citation></ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Akinsanmi</surname> <given-names>O. A.</given-names>
</name>
<name>
<surname>Carvalhais</surname> <given-names>L. C.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Draft genome of the macadamia husk spot pathogen, <italic>Pseudocercospora macadamiae</italic>
</article-title>. <source>Phytopathology</source> <volume>110</volume>, <fpage>1623</fpage>&#x2013;<lpage>1629</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO-12-19-0460-A</pub-id>, PMID: <pub-id pub-id-type="pmid">32343617</pub-id></citation></ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alves</surname> <given-names>R. F.</given-names>
</name>
<name>
<surname>Marques</surname> <given-names>J. P. R.</given-names>
</name>
<name>
<surname>Appezzato-da-Gl&#xf3;ria</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Sp&#xf3;sito</surname> <given-names>M. B.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Process of infection and colonization of <italic>Pseudocercospora kaki</italic> in persimmon leaves</article-title>. <source>J. Phytopathol.</source> <volume>169</volume>, <fpage>168</fpage>&#x2013;<lpage>175</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jph.12971</pub-id>
</citation></ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>&#xc1;vila</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Groenewald</surname> <given-names>J. Z.</given-names>
</name>
<name>
<surname>Trapero</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Crous</surname> <given-names>P. W.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Characterisation and epitypification of <italic>Pseudocercospora cladosporioides</italic>, the causal organism of <italic>Cercospora</italic> leaf spot of olives</article-title>. <source>Mycological Res.</source> <volume>109</volume>, <fpage>881</fpage>&#x2013;<lpage>888</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S0953756205003503</pub-id>, PMID: <pub-id pub-id-type="pmid">16175790</pub-id></citation></ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arunakumar</surname> <given-names>G. S.</given-names>
</name>
<name>
<surname>NR</surname> <given-names>N. P. M.</given-names>
</name>
<name>
<surname>Arya</surname> <given-names>N. R.</given-names>
</name>
<name>
<surname>Monika</surname> <given-names>B. M.</given-names>
</name>
<name>
<surname>Sherpa</surname> <given-names>D. C.</given-names>
</name>
<name>
<surname>Anupama</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Diversity of fungal pathogens in leaf spot disease of Indian mulberry and its management</article-title>. <source>Heliyon</source> <volume>9</volume>, <elocation-id>e21750</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.heliyon.2023.e21750</pub-id>, PMID: <pub-id pub-id-type="pmid">38027777</pub-id></citation></ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arzanlou</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Groenewald</surname> <given-names>J. Z.</given-names>
</name>
<name>
<surname>Fullerton</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Abeln</surname> <given-names>E. C.</given-names>
</name>
<name>
<surname>Carlier</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zapater</surname> <given-names>M. F.</given-names>
</name>
<etal/>
</person-group>. (<year>2008</year>). <article-title>Multiple gene genealogies and phenotypic characters differentiate several novel species of Mycosphaerella and related anamorphs on banana</article-title>. <source>Persoonia-Molecular Phylogeny Evol. Fungi</source> <volume>20</volume>, <fpage>19</fpage>&#x2013;<lpage>37</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3767/003158508X302212</pub-id>, PMID: <pub-id pub-id-type="pmid">20467484</pub-id></citation></ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Babu</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>V.</given-names>
</name>
<name><surname>Govindaiah</surname></name>
</person-group>. (<year>2002</year>). <article-title>Surface ultrastructural studies on the infection process of <italic>Pseudocercospora mori</italic> causing grey leaf spot disease in mulberry</article-title>. <source>Mycological Res.</source> <volume>106</volume>, <fpage>938</fpage>&#x2013;<lpage>945</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S095375620200624X</pub-id>
</citation></ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bai</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>He</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Mulberry leaf compounds and gut microbiota in Alzheimer&#x2019;s disease and diabetes: A study using network pharmacology, molecular dynamics simulation, and cellular assays</article-title>. <source>Int. J. Mol. Sci.</source> <volume>25</volume>, <fpage>4062</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms25074062</pub-id>, PMID: <pub-id pub-id-type="pmid">38612872</pub-id></citation></ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baiyewu</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Amusa</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Idowu</surname> <given-names>J. B.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Leaf spot in mulberry plant (Morus alba) in the lowland humid tropics of southwestern Nigeria</article-title>. <source>Plant Pathol. J</source>. <volume>4</volume> (<issue>2</issue>), <fpage>103</fpage>-<lpage>106</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3923/ppj.2005.103.106</pub-id>
</citation></ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Biswas</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Das</surname> <given-names>N. K.</given-names>
</name>
<name>
<surname>Qadri</surname> <given-names>S. M. H.</given-names>
</name>
<name>
<surname>Saratchandra</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>Evaluating different plant extracts against three major diseases of mulberry</article-title>. <source>Indian Phytopathol.</source> <volume>48</volume>, <fpage>342</fpage>&#x2013;<lpage>346</lpage>.</citation></ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Canto-Canch&#xe9;</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Burgos-Canul</surname> <given-names>Y. Y.</given-names>
</name>
<name>
<surname>Chi-Chuc</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Tzec-Sim&#xe1;</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ku-Gonz&#xe1;lez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Brito-Arg&#xe1;ez</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Moonlight-like proteins are actually cell wall components in <italic>Pseudocercospora Fijiensis</italic>
</article-title>. <source>World J. Microbiol. Biotechnol.</source> <volume>39</volume>, <fpage>232</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11274-023-03676-3</pub-id>, PMID: <pub-id pub-id-type="pmid">37349471</pub-id></citation></ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname> <given-names>E. W.</given-names>
</name>
<name>
<surname>Lye</surname> <given-names>P. Y.</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>S. K.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Phytochemistry, pharmacology, and clinical trials of Morus alba</article-title>. <source>Chin. J. Natural Med.</source> <volume>14</volume>, <fpage>17</fpage>&#x2013;<lpage>30</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3724/SP.J.1009.2016.00017</pub-id>, PMID: <pub-id pub-id-type="pmid">26850343</pub-id></citation></ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chattopadhyay</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Doss</surname> <given-names>S. G.</given-names>
</name>
<name>
<surname>Das</surname> <given-names>N. K.</given-names>
</name>
<name>
<surname>Aggarwal</surname> <given-names>R. K.</given-names>
</name>
<name>
<surname>Bandopadhyay</surname> <given-names>T. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Association of leaf micro-morphological characters with powdery mildew resistance in field-grown mulberry (<italic>Morus</italic> spp.) germplasm</article-title>. <source>AoB Plants</source> <volume>2011</volume>, <fpage>plr002</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/aobpla/plr002</pub-id>, PMID: <pub-id pub-id-type="pmid">22476473</pub-id></citation></ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Choi</surname> <given-names>Y. W.</given-names>
</name>
<name>
<surname>Hyde</surname> <given-names>K. D.</given-names>
</name>
<name>
<surname>Ho</surname> <given-names>W. H.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Single spore isolation of fungi</article-title>. <source>Fungal Diversity</source>. <volume>3</volume>, <fpage>29</fpage>-<lpage>38</lpage>.</citation></ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Churchill</surname> <given-names>A. C. L.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Mycosphaerella Fijiensis, the black leaf streak pathogen of banana: Progress toward understanding pathogen biology and detection, disease development, and the challenges of control</article-title>. <source>Mol. Plant Pathol.</source> <volume>12</volume>, <fpage>307</fpage>&#x2013;<lpage>328</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1364-3703.2010.00672.x</pub-id>, PMID: <pub-id pub-id-type="pmid">21453427</pub-id></citation></ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname> <given-names>P. W.</given-names>
</name>
<name>
<surname>Braun</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Hunter</surname> <given-names>G. C.</given-names>
</name>
<name>
<surname>Wingfield</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Verkley</surname> <given-names>G. J.M.</given-names>
</name>
<name>
<surname>Shin</surname> <given-names>H. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>a). <article-title>Phylogenetic lineages in <italic>pseudocercospora</italic>
</article-title>. <source>Stud. Mycology</source> <volume>75</volume>, <fpage>37</fpage>&#x2013;<lpage>114</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3114/sim0005</pub-id>, PMID: <pub-id pub-id-type="pmid">24014898</pub-id></citation></ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname> <given-names>P. W.</given-names>
</name>
<name>
<surname>Braun</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Hunter</surname> <given-names>G. C.</given-names>
</name>
<name>
<surname>Wingfield</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Verkley</surname> <given-names>G. J. M.</given-names>
</name>
<name>
<surname>Groenewald</surname> <given-names>J. Z.</given-names>
</name>
</person-group> (<year>2013</year>b). <article-title>Phylogenetic lineages in pseudocercospora</article-title>. <source>Stud. Mycology</source> <volume>75</volume>, <fpage>1</fpage>&#x2013;<lpage>49</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3114/sim0015</pub-id>, PMID: <pub-id pub-id-type="pmid">24014900</pub-id></citation></ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname> <given-names>P. W.</given-names>
</name>
<name>
<surname>Osieck</surname> <given-names>E. R.</given-names>
</name>
<name>
<surname>Shivas</surname> <given-names>R. G.</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>Y. P.</given-names>
</name>
<name>
<surname>Bishop-Hurley</surname> <given-names>S. L.</given-names>
</name>
<name>
<surname>Esteve-Ravent&#xf3;s</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Fungal Planet description sheets: 1478&#x2013;1549</article-title>. <source>Persoonia-Molecular Phylogeny Evol. Fungi</source> <volume>50</volume>, <fpage>158</fpage>&#x2013;<lpage>310</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3767/persoonia.2023.50.05</pub-id>, PMID: <pub-id pub-id-type="pmid">38567263</pub-id></citation></ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>da Costa</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Veloso</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>de Oliveira</surname> <given-names>B. F.</given-names>
</name>
<name>
<surname>Lourenco</surname> <given-names>V.</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Reis</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>First report of Neophloeospora maculans causing leaf spots in Morus nigra and M. alba in Brazil</article-title>. <source>J. Plant Dis. Prot.</source> <volume>128</volume>, <fpage>317</fpage>&#x2013;<lpage>321</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s41348-020-00370-6</pub-id>
</citation></ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Darcy</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Swift</surname> <given-names>S. O. I.</given-names>
</name>
<name>
<surname>Cobian</surname> <given-names>G. M.</given-names>
</name>
<name>
<surname>Zahn</surname> <given-names>G. L.</given-names>
</name>
<name>
<surname>Perry</surname> <given-names>B. A.</given-names>
</name>
<name>
<surname>Amend</surname> <given-names>A. S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Fungal communities living within leaves of native Hawaiian dicots are structured by landscape-scale variables as well as by host plants</article-title>. <source>Mol. Ecol.</source> <volume>29</volume>, <fpage>865</fpage>&#x2013;<lpage>878</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/mec.15544</pub-id>, PMID: <pub-id pub-id-type="pmid">32640084</pub-id></citation></ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>David</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Seabloom</surname> <given-names>E. W.</given-names>
</name>
<name>
<surname>May</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Plant host species and geographic distance affect the structure of aboveground fungal symbiont communities, and environmental filtering affects belowground communities in a coastal dune ecosystem</article-title>. <source>Microbial Ecol.</source> <volume>71</volume>, <fpage>912</fpage>&#x2013;<lpage>925</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00248-015-0712-6</pub-id>, PMID: <pub-id pub-id-type="pmid">26626912</pub-id></citation></ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Jesus</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Monteiro</surname> <given-names>S. L. C.</given-names>
</name>
<name>
<surname>Bragan&#xe7;a</surname> <given-names>C. A. D.</given-names>
</name>
<name>
<surname>Rocabado</surname> <given-names>J. M.A.</given-names>
</name>
<name>
<surname>D&#x2019;&#xc1;vila</surname> <given-names>L. S.</given-names>
</name>
<name>
<surname>da Invencao</surname> <given-names>D. R.S.</given-names>
</name>
<etal/>
</person-group>. (<year>2025</year>). <article-title>
<italic>Pseudocercospora Fijiensis</italic> and <italic>Pseudocercospora musae</italic>: Understanding the relationship between biology and epidemiology</article-title>. <source>Fungal Biol. Rev.</source> <volume>51</volume>, <fpage>100408</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.fbr.2024.100408</pub-id>
</citation></ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Chemical profile and aroma effects of major volatile compounds in new mulberry leaf fu brick tea and traditional fu brick tea</article-title>. <source>Foods</source> <volume>13</volume>, <fpage>1808</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/foods13121808</pub-id>, PMID: <pub-id pub-id-type="pmid">38928750</pub-id></citation></ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dobbs</surname> <given-names>J. T.</given-names>
</name>
<name>
<surname>Caballero</surname> <given-names>J. R. I.</given-names>
</name>
<name>
<surname>Ata</surname> <given-names>J. P.</given-names>
</name>
<name>
<surname>Babiker</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Copes</surname> <given-names>W. E.</given-names>
</name>
<name>
<surname>Stewart</surname> <given-names>J. E.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Genomic and transcriptomic comparisons of the twig blight pathogen, <italic>Passalora sequoiae</italic>, with Mycosphaerellaceae foliar and conifer pathogens</article-title>. <source>Phytopathology</source> <volume>114</volume>, <fpage>732</fpage>&#x2013;<lpage>742</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO-08-23-0271-R</pub-id>, PMID: <pub-id pub-id-type="pmid">37942864</pub-id></citation></ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dofuor</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Obeng</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Sossah</surname> <given-names>F. L.</given-names>
</name>
<name>
<surname>Osabutey</surname> <given-names>A. F.</given-names>
</name>
<name>
<surname>Lutuf</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Osei&#x2010;Owusu</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>A comprehensive review of <italic>Pseudocercospora</italic> fruit and leaf spot (angular leaf spot): Current status, advances and future directions for sustainable citrus production</article-title>. <source>Plant Pathol.</source> <volume>73</volume>, <fpage>1708</fpage>&#x2013;<lpage>1718</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/ppa.13947</pub-id>
</citation></ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Furuya</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Shimizu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kamijima</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Influence of daily temperature and relative humidity durations on lesion development of black leaf mold (<italic>Pseudocercospora fuligena</italic>) in greenhouse-grown tomato</article-title>. <source>PhytoFrontiers</source> <volume>4</volume>, <fpage>123</fpage>&#x2013;<lpage>132</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTOFR-02-24-0007-R</pub-id>
</citation></ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Potential of DNA barcoding for detecting quarantine fungi</article-title>. <source>Phytopathology</source>. <volume>103</volume> (<issue>11</issue>), <fpage>1103</fpage>&#x2013;<lpage>1107</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO-12-12-0321-R</pub-id>, PMID: <pub-id pub-id-type="pmid">23718836</pub-id></citation></ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gonz&#xe1;lez-Sayer</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Oggenfuss</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Garc&#xed;a</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Aristizabal</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Croll</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Ria&#xf1;o-Pachon</surname> <given-names>D. M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>High-quality genome assembly of <italic>Pseudocercospora ulei</italic>, the main threat to natural rubber trees</article-title>. <source>Genet. Mol. Biol.</source> <volume>45</volume>, <elocation-id>e50510051</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1590/1678-4685-GMB-2021-0051</pub-id>, PMID: <pub-id pub-id-type="pmid">35037932</pub-id></citation></ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Govindaiah</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Naik</surname> <given-names>V. N.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>D. D.</given-names>
</name>
<name>
<surname>Gupta</surname> <given-names>V. P.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Occurrence of grey leaf spot disease caused by <italic>Pseudocercospora mori</italic> (Hara) Deighton, affecting mulberry in South India</article-title>. <source>Indian J. Sericulture</source> <volume>41</volume>, <fpage>64</fpage>&#x2013;<lpage>65</lpage>.</citation></ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2005</year>). <source>Chinese Fungi. Vol. 24: Cercospora</source> (<publisher-loc>Beijing</publisher-loc>: <publisher-name>Science Press</publisher-name>), pp. <fpage>195</fpage>&#x2013;<lpage>327</lpage>.</citation></ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grice</surname> <given-names>K. R. E.</given-names>
</name>
<name>
<surname>Beilharz</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Shivas</surname> <given-names>R. G.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>First record of <italic>Pseudocercospora mori</italic> causing grey leaf spot on mulberry in Australia</article-title>. <source>Australas. Plant Dis. Notes</source> <volume>1</volume>, <fpage>9</fpage>&#x2013;<lpage>10</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1071/DN06005</pub-id>
</citation></ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Groenewald</surname> <given-names>J. Z.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y. Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Roux</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Shin</surname> <given-names>H. D.</given-names>
</name>
<name>
<surname>Shivas</surname> <given-names>R. G.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Species diversity in <italic>pseudocercospora</italic>
</article-title>. <source>Fungal Systematics Evol.</source> <volume>13</volume>, <fpage>29</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3114/fuse.2024.13.03</pub-id>, PMID: <pub-id pub-id-type="pmid">39135885</pub-id></citation></ref>
<ref id="B34">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Guha</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2025</year>). <source>Common Diseases of Field Crops and Their Management</source>. <publisher-name>Educohack Press</publisher-name>.</citation></ref>
<ref id="B35">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>Yinglan</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Xijin</given-names>
</name>
</person-group> (<year>2005</year>). <source>Chinese Fungi (Volume 24): Cercospora</source>. <publisher-loc>Beijing</publisher-loc>: <publisher-name>Science Press</publisher-name>, <fpage>195</fpage>&#x2013;<lpage>327</lpage>. (in Chinese)</citation></ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Qian</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Effects of dietary addition of mulberry leaf powder on blood metabolites and fecal microbiota composition in Hu sheep</article-title>. <source>Front. Anim. Sci.</source> <volume>5</volume>, <elocation-id>1469850</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fanim.2024.1469850</pub-id>
</citation></ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hawksworth</surname> <given-names>D. L.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Mycological research news</article-title>. <source>Mycological Res.</source> <volume>107</volume>, <fpage>1249</fpage>&#x2013;<lpage>1250</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S0953756203219158</pub-id>
</citation></ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hebert</surname> <given-names>P. D. N.</given-names>
</name>
<name>
<surname>Ratnasingham</surname> <given-names>S.</given-names>
</name>
<name>
<surname>de Waard</surname> <given-names>J. R.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species</article-title>. <source>Proc. R. Soc. B</source> <volume>270</volume>, <fpage>96</fpage>&#x2013;<lpage>99</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rsbl.2003.0025</pub-id>, PMID: <pub-id pub-id-type="pmid">12952648</pub-id></citation></ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hesami</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Khodaparast</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Zare</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>New reports on <italic>Cercospora</italic> and <italic>Pseudocercospora</italic> from Guilan province (N Iran)</article-title>. <source>Rostaniha</source> <volume>13</volume>, <fpage>95</fpage>&#x2013;<lpage>100</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.22092/botany.2012.101391</pub-id>
</citation></ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hong</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>W. G.</given-names>
</name>
<name>
<surname>Sung</surname> <given-names>G. B.</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>H. W.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>Y. K.</given-names>
</name>
<name>
<surname>Shim</surname> <given-names>H. S.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Occurrence of leaf spot on mulberry caused by Phloeospora maculans in Korea</article-title>. <source>Plant Pathol. J.</source> <volume>27</volume>, <fpage>193</fpage>&#x2013;<lpage>193</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5423/PPJ.2011.27.2.193</pub-id>
</citation></ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hou</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Chu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Mulberry leaf dietary supplementation can improve the lipo-nutritional quality of pork and regulate gut microbiota in pigs: A comprehensive multi-omics analysis</article-title>. <source>Animals</source> <volume>14</volume>, <fpage>1233</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ani14081233</pub-id>, PMID: <pub-id pub-id-type="pmid">38672381</pub-id></citation></ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>G.</given-names>
</name>
<name>
<surname>An</surname> <given-names>K.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Structural elucidation of mulberry leaf oligosaccharide and its selective promotion of gut microbiota to alleviate type 2 diabetes mellitus</article-title>. <source>Food Sci. Hum. Wellness</source> <volume>13</volume>, <fpage>2161</fpage>&#x2013;<lpage>2173</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.26599/FSHW.2022.9250180</pub-id>
</citation></ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Qazi</surname> <given-names>I. H.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Analysis of causal pathogens of mulberry bacterial blight in samples collected from eight provinces of China using culturomics and metagenomic sequencing methods</article-title>. <source>Front. Plant Sci.</source> <volume>16</volume>, <elocation-id>1517050</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2025.1517050</pub-id>, PMID: <pub-id pub-id-type="pmid">40093613</pub-id></citation></ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>Z. Y.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>X. K.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Investigation and control of mulberry leaf blight in Nanyao Village, Hanyin County</article-title>. <source>Northern Sericulture</source> <volume>34</volume>, <fpage>27</fpage>&#x2013;<lpage>28</lpage>.</citation></ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ji</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Gai</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Mu</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Biological control against bacterial wilt and colonization of mulberry by an endophytic Bacillus subtilis strain</article-title>. <source>FEMS Microbiol. Ecol.</source> <volume>65</volume>, <fpage>565</fpage>&#x2013;<lpage>573</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1574-6941.2008.00543.x</pub-id>, PMID: <pub-id pub-id-type="pmid">18631174</pub-id></citation></ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>P. M. P.</given-names>
</name>
<name>
<surname>Qadri</surname> <given-names>S. M. H.</given-names>
</name>
<name>
<surname>Pal</surname> <given-names>S. C.</given-names>
</name>
</person-group> (<year>2011</year>b). <article-title>Factors influencing development and severity of grey leaf spot of mulberry (Morus spp.)</article-title>. <source>Int. J. Ind. Entomology Biomaterials</source> <volume>22</volume>, <fpage>11</fpage>&#x2013;<lpage>15</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.7852/ijie.2011.22.1.11</pub-id>
</citation></ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>P. M. P.</given-names>
</name>
<name>
<surname>Qadri</surname> <given-names>S. M. H.</given-names>
</name>
<name>
<surname>Pal</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Pal</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Misra</surname> <given-names>A. K.</given-names>
</name>
</person-group> (<year>2011</year>a). <article-title>Quantification of relation between disease intensities and physiological and biochemical changes in mulberry due to grey leaf spot</article-title>. <source>Indian J. Sericulture</source> <volume>50</volume>, <fpage>28</fpage>&#x2013;<lpage>33</lpage>.</citation></ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Stecher</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Suleski</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sanderford</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tamura</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>MEGA12: Molecular Evolutionary Genetic Analysis version 12 for adaptive and green computing</article-title>. <source>Mol. Biol. Evol.</source> <volume>41</volume>, <fpage>msae263</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molbev/msae263</pub-id>, PMID: <pub-id pub-id-type="pmid">39708372</pub-id></citation></ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ahmed</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Abdulraheem</surname> <given-names>M. I.</given-names>
</name>
<name>
<surname>Hussain</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Plant microbe interaction&#x2014;Predicting the pathogen internalization through stomata using computational neural network modeling</article-title>. <source>Foods</source> <volume>13</volume>, <fpage>3848</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/foods13233848</pub-id>, PMID: <pub-id pub-id-type="pmid">39682918</pub-id></citation></ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Miao</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>B.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>High-throughput metagenomics for identification of pathogens in the clinical settings</article-title>. <source>Small Methods</source> <volume>5</volume>, <fpage>2000792</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/smtd.202000792</pub-id>, PMID: <pub-id pub-id-type="pmid">33614906</pub-id></citation></ref>
<ref id="B51">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Liao</surname> <given-names>S. T.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>G. S.</given-names>
</name>
</person-group> (<year>2013</year>). <source>Mulberry: A plant with homologous origins of medicine, food, and feed</source> (<publisher-loc>Beijing</publisher-loc>: <publisher-name>China Agricultural Science and Technology Press</publisher-name>), <fpage>4</fpage>&#x2013;<lpage>16</lpage>.</citation></ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>Z. X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C. J.</given-names>
</name>
<name>
<surname>Tu</surname> <given-names>H. W.</given-names>
</name>
<name>
<surname>Tsai</surname> <given-names>M. T.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>M. H.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>H. P.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>The neuroprotective effects of primary functional components mulberry leaf extract in diabetes-induced oxidative stress and inflammation</article-title>. <source>J. Agric. Food Chem</source>. <volume>73</volume> (<issue>6</issue>), <fpage>3680</fpage>-<lpage>3691</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jafc.4c09422</pub-id>, PMID: <pub-id pub-id-type="pmid">39893686</pub-id></citation></ref>
<ref id="B53">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>X. J.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Y. L.</given-names>
</name>
</person-group> (<year>1998</year>). <source>Flora Fungorum Sinicorum, Volume 9: Pseudocercospora</source> (<publisher-loc>Beijing</publisher-loc>: <publisher-name>Science Press</publisher-name>), <fpage>1</fpage>&#x2013;<lpage>225</lpage>.</citation></ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Identification of gonatophragmium mori causing mulberry zonate leaf spot disease and characterization of their biological enemies in Guangxi, China</article-title>. <source>Plant Dis.</source> <volume>108</volume>, <fpage>162</fpage>&#x2013;<lpage>174</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PDIS-04-23-0738-RE</pub-id>, PMID: <pub-id pub-id-type="pmid">37552161</pub-id></citation></ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maji</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Banerjee</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Das</surname> <given-names>N. K.</given-names>
</name>
<name>
<surname>Chakraborty</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Bajpai</surname> <given-names>A. K.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Role of meteorological factors on the incidence of mulberry diseases</article-title>. <source>Indian J. Sericulture</source> <volume>47</volume>, <fpage>193</fpage>&#x2013;<lpage>196</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5555/20093135008</pub-id>
</citation></ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Protective effects of supercritical CO2-extracted mulberry leaf extract against non-alcoholic fatty liver disease in mice</article-title>. <source>J. Pharm. Innovation</source> <volume>20</volume>, <fpage>32</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12247-025-09942-1</pub-id>
</citation></ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mati&#x107;</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Gilardi</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Gullino</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Garibaldi</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Emergence of leaf spot disease on leafy vegetable and ornamental crops caused by <italic>Paramyrothecium</italic> and <italic>Albifimbria</italic> species</article-title>. <source>Phytopathology</source> <volume>109</volume>, <fpage>1053</fpage>&#x2013;<lpage>1061</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO-10-18-0396-R</pub-id>, PMID: <pub-id pub-id-type="pmid">30667339</pub-id></citation></ref>
<ref id="B58">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Mekala</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Muhilan</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Ragul</surname> <given-names>R. K.</given-names>
</name>
<name>
<surname>Rithika</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2025</year>). &#x201c;<article-title>Mulberry leaf disease detection system</article-title>,&#x201d; in <source>2025 3rd International Conference on Intelligent Data Communication Technologies and Internet of Things (IDCIoT)</source> (<publisher-loc>Bengaluru, India</publisher-loc>: <publisher-name>IEEE</publisher-name>), <fpage>1886</fpage>&#x2013;<lpage>1892</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1109/IDCIOT64235.2025.10915157</pub-id>
</citation></ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nguyen</surname> <given-names>H. H.</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>T. N.</given-names>
</name>
<name>
<surname>Pham</surname> <given-names>T. P.</given-names>
</name>
<name>
<surname>Le</surname> <given-names>T. T.C.</given-names>
</name>
<name>
<surname>Bui</surname> <given-names>T. K.</given-names>
</name>
<name>
<surname>Jang</surname> <given-names>D. C.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Leaf position of mulberry (<italic>Morus alba</italic> L.) affects silkworm growth, silk cocoon yield and quality</article-title>. <source>Vegetos</source>. <volume>38</volume>, <fpage>1681</fpage>&#x2013;<lpage>1688</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s42535-024-00965-6</pub-id>
</citation></ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niaz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Abbas</surname> <given-names>S. Q.</given-names>
</name>
<name>
<surname>Ayesha</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Iftikhar</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>New fungal records on <italic>Morus alba</italic> from Faisalabad Pakistan II</article-title>. <source>Pakistan J. Bot.</source> <volume>42</volume>, <fpage>1949</fpage>&#x2013;<lpage>1958</lpage>.</citation></ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nzioki</surname> <given-names>H. S.</given-names>
</name>
<name>
<surname>Oyoo</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Monda</surname> <given-names>E. O.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Diversity and pathogenicity of Pseudocercospora species infecting fruit trees in East Africa</article-title>. <source>Mycological Prog.</source> <volume>19</volume>, <fpage>967</fpage>&#x2013;<lpage>975</lpage>.</citation></ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peris</surname> <given-names>N. W.</given-names>
</name>
<name>
<surname>Lucas</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Miriam</surname> <given-names>K. G.</given-names>
</name>
<name>
<surname>Theophillus</surname> <given-names>M. M.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Field evaluation of mulberry accessions for susceptibility to foliar diseases in Uasin-Gishu district, Kenya</article-title>. <source>Afr. J. Biotechnol.</source> <volume>11</volume>, <fpage>3569</fpage>&#x2013;<lpage>3574</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5897/AJB11.2495</pub-id>
</citation></ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perrotta</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Cacciola</surname> <given-names>S. O.</given-names>
</name>
<name>
<surname>Pane</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Faedda</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Outbreak of a leaf disease caused by <italic>Pseudocercospora ceratoniae</italic> on carob in Sicily</article-title>. <source>Plant Dis.</source> <volume>103</volume>, <fpage>2958</fpage>&#x2013;<lpage>2965</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PDIS.1998.82.12.1401C</pub-id>, PMID: <pub-id pub-id-type="pmid">30845479</pub-id></citation></ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Phengsintham</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Braun</surname> <given-names>U.</given-names>
</name>
<name>
<surname>McKenzie</surname> <given-names>E. H. C.</given-names>
</name>
<name>
<surname>Chukeatirote</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Hyde</surname> <given-names>K. D.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Monograph of cercosporoid fungi from Thailand</article-title>. <source>Plant Pathol. Quarantine</source> <volume>3</volume>, <fpage>67</fpage>&#x2013;<lpage>138</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5943/ppq/3/2/2</pub-id>
</citation></ref>
<ref id="B65">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Qiu</surname> <given-names>W. F.</given-names>
</name>
</person-group> (<year>1998</year>). <source>Mycology</source> (<publisher-loc>Beijing</publisher-loc>: <publisher-name>Science Press</publisher-name>), <fpage>10</fpage>&#x2013;<lpage>11</lpage>.</citation></ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raja</surname> <given-names>H. A.</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>A. N.</given-names>
</name>
<name>
<surname>Pearce</surname> <given-names>C. J.</given-names>
</name>
<name>
<surname>Oberlies</surname> <given-names>N. H.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Fungal identification using molecular tools: A primer for the natural products research community</article-title>. <source>J. Natural Products</source> <volume>80</volume>, <fpage>756</fpage>&#x2013;<lpage>770</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jnatprod.6b01085</pub-id>, PMID: <pub-id pub-id-type="pmid">28199101</pub-id></citation></ref>
<ref id="B67">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Rohela</surname> <given-names>G. K.</given-names>
</name>
<name>
<surname>Saini</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Syam</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Roy</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Gonal</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Aziz</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2025</year>). &#x201c;<article-title>Mulberry trees: A sustainable solution for urban forestry and improved air quality</article-title>,&#x201d; in <source>Sustainable urban environment and waste management: Theory and practice</source> (<publisher-name>Springer Nature Singapore</publisher-name>, <publisher-loc>Singapore</publisher-loc>), <fpage>223</fpage>&#x2013;<lpage>246</lpage>.</citation></ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Romanelli</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Herrera</surname> <given-names>M. L.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>A universal DNA extraction and PCR amplification method for fungal rDNA sequence-based identification</article-title>. <source>Mycoses</source> <volume>57</volume>, <fpage>612</fpage>&#x2013;<lpage>634</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/myc.12208</pub-id>, PMID: <pub-id pub-id-type="pmid">24865530</pub-id></citation></ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saif</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Ashraf</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Mir</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Paddar</surname> <given-names>B. A.</given-names>
</name>
<name>
<surname>Nabi</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Morpho-cultural, pathological and molecular variability in Phloeospora maculans causing leaf spot of mulberry (Morus species) in India</article-title>. <source>Mol. Biol. Rep.</source> <volume>50</volume>, <fpage>8337</fpage>&#x2013;<lpage>8348</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11033-023-08677-x</pub-id>, PMID: <pub-id pub-id-type="pmid">37592179</pub-id></citation></ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schoch</surname> <given-names>C. L.</given-names>
</name>
<name>
<surname>Seifert</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Huhndorf</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Robert</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Spouge</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Levesque</surname> <given-names>C. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi</article-title>. <source>Proc. Natl. Acad. Sci. United States America</source> <volume>109</volume>, <fpage>6241</fpage>&#x2013;<lpage>6246</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.1117018109</pub-id>, PMID: <pub-id pub-id-type="pmid">22454494</pub-id></citation></ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shree</surname> <given-names>M. P.</given-names>
</name>
<name>
<surname>Shivakumar</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Shanthi</surname> <given-names>K. R.</given-names>
</name>
<name>
<surname>Nataraja</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Influence of powdery mildew and leaf spot disease on the enzyme activity in mulberry varieties</article-title>. <source>Geobios</source> <volume>24</volume>, <fpage>98</fpage>&#x2013;<lpage>102</lpage>.</citation></ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soylu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kurt</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Soylu</surname> <given-names>E. M.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>First report of phloeospora leaf spot on mulberry caused by Phloeospora maculans (= Cylindrosporium maculans) in the East Mediterranean region of Turkey</article-title>. <source>Plant Pathol.</source> <volume>52</volume>, <fpage>415</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1046/j.1365-3059.2003.00837.x</pub-id>
</citation></ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stielow</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Levesque</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Seifert</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Meyer</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Irinyi</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Smits</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes</article-title>. <source>Persoonia</source> <volume>35</volume>, <fpage>242</fpage>&#x2013;<lpage>263</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3767/003158515X689135</pub-id>, PMID: <pub-id pub-id-type="pmid">26823635</pub-id></citation></ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Teotia</surname> <given-names>R. S.</given-names>
</name>
<name>
<surname>Sengupta</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Das</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Biochemical changes in the leaves of mulberry (<italic>Morus alba</italic> L.) infected by <italic>Pseudocercospora mori</italic> (Hara) Deighton</article-title>. <source>Indian J. Sericulture</source> <volume>36</volume>, <fpage>158</fpage>&#x2013;<lpage>160</lpage>.</citation></ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walkowiak</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rowland</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Rodrigue</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Whole genome sequencing and comparative genomics of closely related Fusarium Head Blight fungi: <italic>Fusarium graminearum</italic>, <italic>F. meridionale</italic> and <italic>F. asiaticum</italic>
</article-title>. <source>BMC Genomics</source> <volume>17</volume>, <fpage>1014</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12864-016-3371-1</pub-id>, PMID: <pub-id pub-id-type="pmid">27938326</pub-id></citation></ref>
<ref id="B76">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>X. D.</given-names>
</name>
</person-group> (<year>2009</year>). <source>Prevention and control of pests and diseases of mulberry</source> (<publisher-loc>Chengdu</publisher-loc>: <publisher-name>Southwest Jiaotong University Press</publisher-name>), <fpage>126</fpage>&#x2013;<lpage>129</lpage>.</citation></ref>
<ref id="B77">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>W. F.</given-names>
</name>
<name>
<surname>He</surname> <given-names>N. J.</given-names>
</name>
<name>
<surname>You</surname> <given-names>C. P.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>X. N.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>A preliminary report on the incidence of mulberry leaf blight</article-title>. <source>J. Jiangxi Agric. Univ.</source> <volume>16</volume>, <fpage>123</fpage>&#x2013;<lpage>125</lpage>.</citation></ref>
<ref id="B78">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>White</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Bruns</surname> <given-names>T. D.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>S. B.</given-names>
</name>
<name>
<surname>Taylor</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>1990</year>). &#x201c;<article-title>Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics</article-title>,&#x201d; in <source>PCR protocols&#x2014;A guide to methods and applications</source>. Ed. <person-group person-group-type="editor">
<name>
<surname>Innis</surname> <given-names>M. A.</given-names>
</name>
<etal/>
</person-group> (<publisher-loc>London, UK</publisher-loc>: <publisher-name>Academic Press</publisher-name>), <fpage>315</fpage>&#x2013;<lpage>322</lpage>.</citation></ref>
<ref id="B79">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Woudenberg</surname> <given-names>J. H. C.</given-names>
</name>
<name>
<surname>Groenewald</surname> <given-names>J. Z.</given-names>
</name>
<name>
<surname>Binder</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Crous</surname> <given-names>P. W.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Alternaria redefined</article-title>. <source>Stud. Mycology</source> <volume>75</volume>, <fpage>171</fpage>&#x2013;<lpage>212</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3114/sim0015</pub-id>, PMID: <pub-id pub-id-type="pmid">24014900</pub-id></citation></ref>
<ref id="B80">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>B.</given-names>
</name>
<etal/>
</person-group>. (<year>2025</year>). <article-title>Preparation and characterization of a new food-grade Pickering emulsion stabilized by mulberry-leaf protein nanoparticles</article-title>. <source>J. Sci. Food Agric.</source> <volume>105</volume>, <fpage>1080</fpage>&#x2013;<lpage>1090</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jsfa.13898</pub-id>, PMID: <pub-id pub-id-type="pmid">39271605</pub-id></citation></ref>
<ref id="B81">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zaman</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Ayaz</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Integrating morphological and molecular data in plant taxonomy</article-title>. <source>Pak. J. Bot.</source> <volume>57</volume>(<issue>4</issue>), <fpage>1453</fpage>&#x2013;<lpage>1466</lpage>. doi:<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.30848/PJB2025-4(27)">10.30848/PJB2025-4(27</ext-link>
</citation></ref>
<ref id="B82">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y. J.</given-names>
</name>
</person-group> (<year>1975</year>). <article-title>A preliminary study on the overwintering mode and pathogenesis of mulberry leaf stain</article-title>. <source>Sci. Technol. Bull.</source> <volume>7</volume>, <fpage>16</fpage>&#x2013;<lpage>22</lpage>.</citation></ref>
<ref id="B83">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Hao</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Positive effects and mechanism of mulberry leaf extract on alleviating fatty liver hemorrhagic syndrome in laying hens</article-title>. <source>Poultry Sci.</source> <volume>103</volume>, <fpage>103998</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.psj.2024.103998</pub-id>, PMID: <pub-id pub-id-type="pmid">39018653</pub-id></citation></ref>
<ref id="B84">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Temperature and humidity regulate sporulation of <italic>Corynespora cassiicola</italic> that is associated with pathogenicity in cucumber (<italic>Cucumis sativus</italic> L.)</article-title>. <source>Biology</source> <volume>11</volume>, <fpage>1675</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/biology11111675</pub-id>, PMID: <pub-id pub-id-type="pmid">36421389</pub-id></citation></ref>
</ref-list>
</back>
</article>