The RBR05 (wsl) is one of the five Rainbow Rice varieties obtained by crossbreeding between the white-striped leaf Jao Hom Nin mutant (wsl-JHN) and the purple leaf Kum Hom Nin (KHN) provided by Rice Science Center, Kasetsart University, Thailand. The wsl-JHN was induced by fast neutron irradiation at a dose of 33 Gy. Riceberry (RB), which exhibits dark green leaves, was included in this study as a control group. Riceberry was developed by crossing the dark green leaf variety Jao Hom Nin (JHN) and the green leaf variety KDML105, provided by the same institute. These plants were grown in a paddy field at the Rice Science Center, Kasetsart University, Thailand.

Pigment content was quantified by using the spectrophotometric method. Chlorophylls (chlorophyll a, chlorophyll b, and total chlorophyll) were determined according to the previous method (Matsuda et al., 2012). Briefly, the leaf sample was ground into fine powder in liquid nitrogen. Chlorophylls were extracted by incubating the powder in methanol. The absorbance of the mixture was measured at 470, 647, and 663 nm. The pigment content was calculated as described previously (Lichtenthaler, 1987). Total anthocyanin content was determined according to Lao and Giusti (2016) with some modifications. Anthocyanins were extracted from the leaf sample with HCl-acidified methanol. Then, the absorbance of the mixture was measured at 535 nm. The ratio between total anthocyanin and total chlorophyll content was calculated.

The flag leaves from RB and RBR05 at the early booting stage were subjected to leaf anatomical structure and TEM analyses. The leaf samples were freshly sectioned into 30 µm with a Leica VT1000s vibratome and observed with an Olympus BX43 fluorescence microscope equipped with an EP50 camera and a UV wideband filter (U-FUW). For TEM analysis, small pieces were cut from RB and the green and white sectors of RBR05. The samples were fixed in a fixative buffer containing 2.5% glutaraldehyde and 2.5% paraformaldehyde in 0.2 M cacodylate-HCl buffer (pH 7.2). Post-fixation was performed with 1% osmium tetroxide. The samples were then embedded in Spurr’s resin. The ultrathin sections were prepared and subsequently stained with 2% uranyl acetate followed by 0.01% lead citrate. The stained sections were examined using a transmission electron microscope (Hitachi HT7700).

A missense-variant (CGT/CAT) of LOC_Os01g01920 on chromosome 1 at the 929-nucleotide sequence on exon 10 was identified as the functional SNP for wsl. A functional marker was developed based on KASP (Kompetitive Allele Specific PCR).

RBR05 exhibited a white-striped leaf in a growth stage- and temperature-dependent manner ( Figure 1 , Supplementary Figure 1 ). It germinated normally like a wild-type plant. Under paddy field conditions, RBR05 exhibited green leaves during the seedling stage. It gradually developed longitudinal white stripes on the new green leaves, starting at the beginning of the tillering stage and continuing until maturity. At the early tillering stage, the newly emerging leaves from the lateral culm displayed more prominent variegation than those on the main culm. The flag leaf showed an obvious variegated phenotype, characterised by predominantly albino areas with few narrow green stripes, depending on the temperature below 25°C. Consistent with the visible phenotype, the chlorophyll content in RBR05 decreased as the proportion of white-striped leaf area increased ( Figure 2 ).

The transverse section of the RBR05 flag leaf, observed under a bright-field microscope and a fluorescence microscope equipped with a UV wideband filter (U-FUW), revealed a random distribution of chlorophyllous and non-chlorophyllous mesophyll cells ( Figure 3 ). Non-chlorophyllous mesophyll cells were characterised by their transparent appearance under the bright-field microscope and the absence of red chlorophyll autofluorescence under the fluorescence microscope. Transmission electron microscopy (TEM) was employed to examine whether the white stripes and non-chlorophyllous mesophyll cells were associated with defective chloroplast development. In Riceberry (RB) and the green sector of RBR05, mesophyll cells contained abundant chloroplasts with well-organised ultrastructure. A highly developed thylakoid membrane system was observed. Conversely, mesophyll cells in the white sector of RBR05 were dominated by large empty spaces with chloroplast-like structures presenting as flattened shapes adhered to the cell wall ( Figure 4 ).

The RNA-seq approach was used to explore the molecular basis underlying the white-striped leaf (wsl) phenotype observed in RBR05. Differentially expressed genes (DEGs) between wsl RBR05 and the solid dark-green leaf (SGL) RB were identified using such criteria as log2 fold change ≥ |1| and FDR p-value < 0.05. 94 DEGs were identified, including 78 upregulated and 16 downregulated in RBR05 ( Supplementary Table 1 ). To investigate the biological functions of DEGs in RBR05, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were initially performed. Due to the small number of DEGs, the stringency of enrichment settings was adjusted, as described in the Materials and methods section. GO analysis identified significant overrepresentation of terms related to photosynthesis (light reaction) and oxidation-reduction processes ( Supplementary Figure 3 ). Within the GO term oxidation reduction, protochlorophyllide reductase A (OsPORA), a key gene in chlorophyll biosynthetic pathway, was identified ( Supplementary Table 2 ). KEGG analysis identified flavonoid biosynthesis as the only significantly enriched pathway (FDR < 0.05). Although additional pathways, such as photosynthesis-antenna protein and porphyrin metabolism, were also detected, they did not meet the significance threshold ( Supplementary Figure 3 ; Supplementary Table 3 ).

To gain a more comprehensive view, we manually classified DEGs based on sequence homology and literature-based functional annotation ( Supplementary Table 1 ). A number of these DEGs are related to chloroplast biogenesis and photosynthesis ( Table 1 ). For instance, genes associated with the photosynthetic apparatus were downregulated in RBR05, including chlorophyll A-B binding protein OsLhcb1.1, which encodes a component of the PSII light-harvesting (antenna) complex; cytochrome b6-f complex subunit IV; and a homolog of AtPsaP/AtCURT1B, which encodes a member of the Curvature Thylakoid1 (CURT1) protein family. Conversely, the photosynthetic reaction centre protein OsPsbA/D1 was upregulated in RBR05.

Furthermore, RBR05 showed increased expression of genes involved in chloroplast gene expression. These genes included OsFLN2, which is the rice homolog of AtFLN2 (a component of plastid transcriptionally active chromosome pTAC); Chloroplastic group IIA intron splicing facilitator CRS1; tRNA 3′-end processing enzyme OsTRZ2; and Chloroplast 50S ribosomal protein L16. OsDRP5B/ARC5 (Dynamin-Related Protein 5B; also known as Accumulation and Replication of Chloroplasts 5), which encodes a dynamin-related protein GTPase, was upregulated in RBR05. In alignment with the reduction of chlorophyll content, OsPORA, one of the two OsPOR genes (OsPORA and OsPORB) in the rice genome, was downregulated in RBR05. Protochlorophyllide reductase (POR) catalyses the reduction of protochlorophyllide a (Pchlide a) to chlorophyllide a (chlide a), a light-dependent reaction in the chlorophyll biosynthesis pathway. RBR05 also demonstrated the downregulation of OsPLGG1a, which encodes one of the two isoforms of plastidic glycolate/glycerate translocator 1 (OsPLGG1) in rice. PLGG1 is a key transporter in the photorespiratory pathway, facilitating the transport of glycolate and glycerate between chloroplasts and peroxisomes. Interestingly, we detected significant upregulation of OsRNRS1, which encodes the small subunit of ribonucleotide reductase (RNR) in RBR05 white-striped leaves. OsRNRS1 was also associated with the GO term oxidation-reduction (Supplementary Table 2).

The F₂ plants (RBR05 x PinK+4#78A03) were selected for white-striped and solid green lines, with 30 lines per group, by visual assessment and chlorophyll content measurements using a SPAD meter. For SPAD measurement, two measurements were made to observe the change in chlorophyll content in the leaves. SPAD values were measured in the SGL- and wsl-bulks at 90 days after germination (DAG; SPAD1) and 110 DAG (SPAD2). At 90 DAG, the SGL- and wsl-bulks showed average SPAD values of 43.2 and 28.5, respectively. For 110 DAG, the SGL- and wsl-bulks showed average values of 49.3 and 26.2, respectively (Supplementary Figure 5 and Supplementary Table 4).

The 232 F₂ individuals were derived from a cross between PinK+4#78A03 (SGL) and RBR05 (wsl). The wsl line showed white-striped leaves in the tillering stage (starting at 80 DAG) accounted for 60 of 232 individuals, while the remaining 172 of 232 individuals observed solid green leaf phenotypes. All F₁ plants exhibited SGL phenotypes similar to PinK+4 #78A03; therefore, the F₂ segregation pattern fitted a 3:1 SGL: wsl phenotypic ratio ( Supplementary Table 5 ). It indicated that a single recessive nuclear gene controlled the white-striped phenotype.

As a result, 150-bp clean paired-end sequences were generated. In total, approximately 2,009.62 million reads for wsl-bulk, 1,692.91 million reads for SGL-bulk, 54.19 million reads for PinK+4#78A03, and 55.75 million reads for RBR05 were generated, which were equivalent to 292.55, 245.35, 7.85, and 8.09 Gb for the wsl-bulk, the SGL-bulk, PinK+4#78A03, and RBR05, respectively (Supplementary Table 6). The average sequencing depths for wsl-bulk, SGL-bulk, PinK+4#78A03, and RBR05 were 22.85, 19.5, 18.8, and 19.2, respectively. The alignment of the reads from two bulks and parents to the reference genome of Nipponbare revealed 90.27%,91.32%, 91.76%, and 91.03% of read alignments in wsl-bulk, SGL-bulk, PinK+4#78A03, and RBR05, respectively, corresponding to 92.71%, 92.46%, 91.73%, and 92.05% of rice genome coverage ( Supplementary Table 6 )

QTL-seq analysis utilised common SNP variants identified in both the wsl- and SGL-bulks, as determined by read mapping against the RBR05 parental genome. Initially, 132,950 SNPs were identified in the two bulks ( Supplementary Table 7 ), which required a read-support criterion of at least eight reads. For identifying significant QTLs, the ΔSNP index plot illustrated the differences between the SNP indexes of the SGL-bulk and the wsl-bulk. The SNP indexes in each bulk and the ∆SNP indexes were physically plotted across all rice chromosomes ( Figure 5 ). We mapped the putative qwsl1_503564 QTL to the 3.7 Mb region between 0.03 and 3.7 Mb on the short arm of chromosome 1, in which the ΔSNP index was greater than the confidence threshold intervals at 99% ( Figure 5 ).

The qwsl1_503564 is located within a genomic region containing 186 mutation sites from 104 annotated genes. Candidate genes with ΔSNP index confidence intervals greater than 95% are listed in Supplementary Table 8 . Of these, the gene LOC_Os01g01920 showed the most significant ΔSNP index within the region. This gene encodes the protein called OsSAMHD1, a metal-dependent phosphohydrolase containing HD domain, a homolog of the human dNTPase SAMHD1 and the Arabidopsis VEN4. Research indicates that SAMHD1 is crucial for dNTP catabolism in plants and mammals. SAMHD1 plays an essential role in chloroplast biogenesis in plants, including rice and Arabidopsis. We precisely identified a functional SNP located at nucleotide position 929 in exon 10, causing a G-to-A missense variant (CGT/CAT) that leads to Arg-to-His amino acid change at residue 310 ( Figure 6 ). More significantly, we can precisely differentiate wsl from SGL plants at this locus using the functional marker developed from the A-G SNP ( Figure 6 ). Therefore, we conclude that the wsl310 mutation is responsible for the low-temperature-dependent white striped leaf phenotype in RBR05.

The current mutation, named wsl310, observed in RBR05, is located in OsSAMHD1. The expression of the white-striped leaf phenotype is stage-dependent and responsive to low temperatures. Several studies have demonstrated that mutations in the OsSAMHD1 gene lead to white-striped leaf phenotypes. Allelic mutations in OsSAMHD1 have been previously reported at five different mutagenic sites ( Figure 6 ). First, the wsl3 mutant displayed a visible white-striped leaf in both young seedlings and flag leaves of mature plants (Zhao et al., 2016b). The wsl3 mutant carries a 9-bp deletion (caacttgca, residues 6524-6532) at the junction between intron 15 and exon 16, resulting in a 27-nucleotide deletion (TTCTGCAATGAATATTCTGTTCCAAAG, residues 1300-1326) in the wsl3 cDNA, causing a 9-amino acid deletion. The wild-type WSL3 is OsSAMHD1, an HD domain-containing protein involved in chloroplast biosynthesis and development in rice (Zhao et al., 2016b).

Second, the wfsl1 mutant, exhibiting a white, fine-striped leaf phenotype from the tillering stage and an abnormal chloroplast structure, contains a non-synonymous mutation (A>T) in exon 17, causing the amino acid change from Asn to Tyr (Ge et al., 2017). In the wild-type, WFSL1, OsSAMHD1 is highly expressed in mature leaves and leaf sheaths, and it was localised to the chloroplasts (Ge et al., 2017).

Third, the wsl214 mutant exhibited white-striped leaves, defective chloroplast development, reduced net photosynthetic rate, and overexcitation of the photosynthetically active reaction center (Wang et al., 2023). The wsl214 mutant carries a non-synonymous mutation in exon 3, resulting in an amino acid change from Arg to Trp (Wang et al., 2023). In contrast, the wild-type WSL214, which encodes an HD domain phosphohydrolase, was widely expressed in various rice tissues, with the highest level observed in leaf tissue. WSL214 promoted the homeostasis of rice leaf cellular ROS, the reactive oxygen species, by increasing the expression of the catalase gene OsCATC and promoting chloroplast development.

Fourth, the wst1 mutant harbors a splice-site variant at nucleotide position 6972 (G>A), resulting in a 104 bp deletion in the cDNA and impairing the thylakoid membrane structure in the chloroplast (Hu et al., 2024).

Fifth, the STRIPE3 (st3) mutant exhibited white-striped leaves with reduced chlorophyll content and abnormal chloroplast development during the seedling stage, but gradually produced nearly normal green leaves as it developed (Wang et al., 2022). A single base mutation (G to A) was identified at the splicing junction in the eighth intron, resulting in abnormal splicing of the transcript. The wild-type ST3 encodes a human deoxynucleoside triphosphate triphosphohydrolase (dNTPase) in the SAMHD1 homolog (Wang et al., 2022). The wild-type ST3 was highly expressed in the third leaf at the three-leaf stage and expressed constitutively in the root, stem, leaf, sheath, and panicle, and the encoded protein, OsSAMHD1, was localised to the cytoplasm.

Therefore, OsSAMHD1 plays critical roles in chloroplast development from the seedling to the flag-leaf stage, regulating nucleotide pools for chloroplasts and maintaining homeostasis of leaf cellular ROS.

A cell maintains nucleotide homeostasis by regulating nucleotide de novo synthesis, nucleotide salvage, and nucleotide catabolism. Using QTL-seq analysis in this study, we identified a missense mutation at R310 (R310H) within the conserved domain of OsSAMHD1 as potentially responsible for the white-striped leaf phenotype in RBR05. OsSAMHD1 gene encodes a metal-dependent phosphohydrolase with an HD domain, a homolog of the human SAMHD1 and Arabidopsis VEN4. Unlike human SAMHD1, which contains both an N-terminal SAM domain and an HD domain, OsSAMHD1 and Arabidopsis VEN4 have only an HD domain (Sarmiento-Mañús et al., 2025). This conserved HD domain is essential for dNTPase activity. Human SAMHD1 forms a tetramer and functions in nucleotide catabolism and damage repair (Morris and Taylor, 2019; Coggins et al., 2020). It converts 2’-deoxynucleotide-5’-triphosphate (dNTPs) into 2’-deoxynucleoside and triphosphate. The role of OsSAMHD1 in nucleotide catabolism has been inferred based on sequence homology and nucleotide supplementation experiments (Wang et al., 2022); however, its enzymatic function remains uncharacterised. In vitro analysis has revealed that His-tagged VEN4 can convert dGTP to 2-dG (Lu et al., 2023). A recent study has shown that Arabidopsis VEN4 is involved in DNA double-strand break (DSB) repair through homologous recombination (HR), in which the deacetylation of a conserved lysine residue, K354 in human SAMHD1 and K248 in VEN4, plays a critical role (Sarmiento-Mañús et al., 2025). This conserved lysine residue is also present in OsSAMHD1, suggesting it may participate in this repair process. However, the role of OsSAMHD1 in DSB repair has not yet been characterised. Nonetheless, a proper balance of nucleotides is required for cells to function effectively. An imbalance of nucleotides can impair DNA and RNA synthesis, repair mechanisms, and genome stability, as nucleotides are fundamental elements of DNA and RNA and essential components of metabolic cofactors.

Moreover, the substitution at R310 in OsSAMHD1 is equivalent to R216 in Arabidopsis VEN4 and R318 in human SAMHD1 ( Supplementary Figure 6 ). Notably, Human SAMHD1 is active in the tetramer state, containing allosteric sites I and II, as well as catalytic sites (Ji et al., 2014). The mutated position is close to important residues D311, D330, and R333 in human SAMHD1. D311 is one of the conserved histidine-aspartate residues and plays a critical role in metal ion coordination at the enzyme’s catalytic site (Ji et al., 2014). D330 is a vital residue located at allosteric site II. R333 is critical in stabilising dATP binding at the allosteric site II by forming a salt bridge with E355 (Ji et al., 2014). Therefore, we speculate that R310H mutation may disrupt these conserved interactions and affect structural integrity, eventually leading to an imbalanced dNTP pool and defective chloroplast development.

RNA-seq analysis revealed the upregulation of OsRNRS1 in RBR05 compared to solid green leaf Riceberry. RNR is the rate-limiting enzyme in the de novo synthesis of dNDPs, catalysing the reduction of ribonucleotide diphosphates (rNDPs) to deoxyribonucleotide diphosphates (dNDPs) in the cytosol. These dNDPs are subsequently converted into deoxyribonucleotide triphosphates (dNTPs), the building blocks of DNA. Rice RNR comprises two large and two small subunits, forming α2β2 heterodimers (Yoo et al., 2009). RNRS1 encodes the small subunit of ribonucleotide reductase (RNR). The mutation of OsRNRS1 results in abnormal chloroplast development, white-striped leaf, altered cell cycle progression, drooping leaf, narrow leaf, dwarfism, and deformed floral organs, depending on the degree and position of mutation (Yoo et al., 2009; Chen et al., 2015; Qin et al., 2017; Shen et al., 2023). We have shown that the upregulation of OsRNRS1 was associated with a white-striped leaf phenotype in RBR05.

Interestingly, the phenotype of RBR05, characterised by white-striped leaves and aberrant chloroplast development, is similar to that of both OsSAMHD1 and OsRNRS1 mutants. These mutants, including RBR05, exhibit temperature-sensitive phenotypes, highlighting the importance of OsRNRS1 and OsSAMHD1 in chloroplast development under low-temperature (restrictive) conditions (Yoo et al., 2009; Wang et al., 2022). The upregulation of OsRNRS1 and OsSAMHD1 at low temperatures suggest a requirement for their function in such conditions. In the st3 mutant, chloroplast development-related genes were downregulated compared to the wild type under low temperature, indicating a disruption in chloroplast biogenesis at the molecular level (Wang et al., 2022). Additionally, the yeast complementation assay of OsRNRL1 in yeast rnr1rnr3 knockout line has revealed that OsRNRL1 activity is thermosensitive (Yoo et al., 2009). Notably, the mutation in OsRNRL1, which encodes the large subunit of ribonucleotide reductase, also leads to white-striped leaf phenotype and temperature sensitivity. Similarly, OsSAMHD1 activity may also be thermosensitive—reduced or unstable under low-temperature conditions—as observed for OsRNRL1. The R310H mutation in OsSAMHD1 may compromise its structural integrity. Taken together, R310H mutation may prevent OsSAMHD1 from meeting the increased demand to balance the nucleotide pool under low temperature conditions, leading to more pronounced defects in chloroplast development. However, precise biochemical mechanisms of OsSAMHD1 and its R310H mutant under restrictive temperature remain to be elucidated. Future investigation of OsSAMHD1 thermostability will provide insight into how low temperatures affect its function, thereby linking biochemical behaviour to the observed phenotype.

A functional connection between these two enzymes, SAMHD1 and RNR, has been reported (Ji et al., 2014; Sarmiento-Mañús et al., 2023). Ji et al. (2014) elucidated the structural basis for SAMHD1 regulation, revealing the similarity in enzymatic properties between SAMHD1 and RNR. Both enzymes function as oligomers and contain allosteric sites I and II and catalytic sites, enabling them to sense and respond to changes in cellular nucleotide concentrations. RNR is activated by ATP binding at the allosteric site 1, but is inhibited by dATP. In contrast, dATP serves as a key activator for SAMHD1. It has the highest affinity among dNTPs for allosteric site 2; notably, SAMHD1’s allosteric site 1 exhibits specificity for GTP or dGTP (Ji et al., 2014). A recent study has provided additional evidence supporting the role of SAMHD1 in dNTP degradation and the maintenance of dNTP homeostasis, as well as its functional interconnection with nucleotide biosynthesis (McCown et al., 2025). The catalytic efficiency of SAMHD1 is modulated by the identity of dNTP occupying its allosteric sites. For example, the availability of purine dNTPs can promote the depletion efficiency of pyrimidine dNTPs. Therefore, the elevated levels of specific dNTPs—resulting from increased de novo biosynthesis (by RNR) or the salvage pathway—can enhance the degradation of other dNTP species (McCown et al., 2025).

A study in Arabidopsis has further demonstrated a genetic interaction between VEN4 and TSO2 (Sarmiento-Mañús et al., 2023), which are homologs of rice OsSAMHD1 and OsRNRS1, respectively. TSO2 appeared to play a more critical role in dNTP metabolism than VEN4, as suggested by differences in phenotype observed in reciprocal sesquimutants (Sarmiento-Mañús et al., 2023). In addition, coordination between OsSAMHD1 and genes in both the de novo and salvage nucleotide biosynthetic pathways has been discussed in the st3 mutant, which carries a mutation in OsSAMHD1 (Wang et al., 2022). In the st3 mutant, the decreased expression of OsSAMHD1 and de novo biosynthetic genes, including OsRNRS1, was observed in parallel with the increased expression of salvage pathway genes (Wang et al., 2022), suggesting a compensatory adjustment in nucleotide metabolism. Our findings, along with the studies in Arabidopsis and st3 mutant, emphasise the functional interdependence of OsSAMHD1 and OsRNRS1 in nucleotide metabolism, genome stability and maintaining chloroplast integrity. Although nucleotide content was not directly quantified in our study, the decrease in dGTP has been reported in the st3 mutant (Wang et al., 2022), supporting the idea of disrupted nucleotide homeostasis. Incorporating nucleotide profiling in future investigation would help clarify the biochemical relationship between these genes and their role in maintaining nucleotide homeostasis.

Notably, we did not find a mutation in OsRNRS1 based on the QTL-seq analysis, nor did we observe differential gene expression of OsSAMHD1 between RBR05 and RB in the RNA-seq analysis. The expression patterns of OsSAMHD1 and OsRNRS1 have been studied in two OsSAMHD1 mutants, st3 and wsl214 (Wang et al., 2022; 2023). While both mutants exhibited decreased expression of OsSAMHD1, OsRNRS1 expression was increased in wsl214 but decreased in st3. The variation in expression patterns may reflect differences in the severity of mutations and their impact on OsSAMHD1 protein function. Notably, wsl214 carries a missense mutation, similar to RBR05, whereas st3 carries a mutation that leads to an alternative transcript variant. In Arabidopsis, the transcript abundance of VEN4, a homolog of OsSAMHD1, remained unchanged in the ven4-0 mutant, which carries a point mutation E249L (Sarmiento-Mañús et al., 2023). The E249L substitution occurs at a critical residue required for salt-bridge formation, altering the structural rigidity of the VEN4 protein. This finding demonstrates that the mutation can disrupt protein function without altering transcript abundance, highlighting the importance of post-transcriptional and post-translational regulation. In the case of SAMHD1, enzymatic activity is tightly controlled by allosteric regulation through nucleotide binding as discussed above. In addition, post-translational modifications have been reported in humans SAMHD1 (Coggins et al., 2020).

The increased expression of OsRNRS1 in our study was probably a compensatory mechanism in response to the disruption of cytosolic nucleotide metabolism caused by malfunctional OsSAMHD1. A similar interplay among genes involved in nucleotide metabolism has been described in the st3 (Wang et al., 2022). The functional interaction between OsSAMHD1 and OsRNRS1 may imply the essence of a balanced nucleotide pool for proper cellular function. Along with OsRNRS1, we also identified upregulation of OsDRP5B, Dynamin-Related Protein 5B, also known as Accumulation and Replication of Chloroplasts 5 (ARC5), which encodes a dynamin-related protein GTPase, a cytosolic component of the chloroplast division machinery. Therefore, maintaining the nucleotide pools is essential for chloroplast division and propagation during leaf development.

The white-striped leaf phenotype in the RBR05 was primarily caused by aberrant chloroplast development. This defect led to the formation of non-chlorophyllous mesophyll cells characterised by their transparent appearance and lack of chlorophyll. These cells were found randomly throughout the leaf tissue. Consistent with the aberrant chloroplast ultrastructure, transcriptome analysis revealed the downregulation of OsLhcb1.1, the AtCURT1B homolog, and cytochrome b6-f complex subunit 4 in RBR05, suggesting the suppression of photosynthetic apparatus formation. AtPsaP/AtCURT1B can form oligomers with AtCURT1A, AtCURT1C, and AtCURT1D to modulate the grana structure by inducing membrane curvature at the grana margin (Armbruster et al., 2013).

Chlorophyll is the primary photosynthetic pigment and a significant factor in determining leaf greenness. In this study, OsPORA, which encodes one of the two isoforms of protochlorophyllide reductase (POR), was the only gene in the chlorophyll biosynthetic pathway that exhibited differential expression between the solid green leaf Riceberry and RBR05 (downregulated in RBR05). POR catalyses light-dependent reduction of protochlorophyllide, a photosensitive compound, into chlorophyllide. Their expression analysis has suggested that OsPORA primarily functions during the early stage of leaf development, whereas OsPORB maintains a threshold level of chlorophyll throughout leaf development (Sakuraba et al., 2013; Kwon et al., 2017). Although the function of OsPORA is not fully understood, the decreased expression of OsPORA points to a reduction in chlorophyll biosynthesis, which contributes to the reduced chlorophyll content and the presence of non-chlorophyllous cells in RBR05. Chlorophyll metabolism and the assembly of photosynthetic apparatus are tightly synchronised. Chlorophylls form pigment-protein complexes, which are embedded in the thylakoid membranes. Unbound chlorophyll and its intermediates can induce photooxidative damage (Sun et al., 2011; Wang et al., 2015; Liu et al., 2022, 2023; Zhao et al., 2023). Several studies have shown that the disruption of chlorophyll biosynthetic genes cause not only a decline in photosynthetic pigment content but also aberrations in chloroplast ultrastructure (Zhang et al., 2006, 2015; Liu et al., 2007, 2021a; Wang et al., 2010, 2017b, 2021; Tian et al., 2013; Ruan et al., 2017; Long et al., 2022; Shim et al., 2023; Yao et al., 2023).

Interestingly, an interconnection between POR and CURT1 has been demonstrated. Both are the components of the prolamellar body (PLB) in the etioplast and play vital roles in chloroplast development during de-etiolation (Sandoval-Ibáñez et al., 2021; Liang et al., 2022). Notably, POR proteins are the most abundant protein in etioplast (Blomqvist et al., 2008; Floris and Kühlbrandt, 2021). Disruption of PLB organisation was reported in Arabidopsis PORA and PORB mutants (Franck et al., 2000; Frick et al., 2003; Paddock et al., 2012). In addition to regulating thylakoid margin architecture, a recent study revealed that CURT1 also contributes to maintaining PLB structure and modulating the maturation of thylakoid membrane during de-etiolation (Sandoval-Ibáñez et al., 2021; Liang et al., 2022). The CURT1 mutant exhibited PLB disorganisation and decreased POR accumulation (Sandoval-Ibáñez et al., 2021).

RBR05 showed increased expression of genes related to plastid gene transcription (OsFLN2), post-transcriptional processing (Chloroplastic group IIA intron splicing facilitator CRS1 and OsTRZ2), and translation (Chloroplast 50S ribosomal protein L16). Functional studies and phenotypic characterisation of these genes or their homologs have demonstrated their critical roles in chloroplast development and leaf colouration. For example, OsFLN2 mutants exhibited albino or white-striped phenotypes (Qiu et al., 2018). OsTRZ2 knockout mutant displayed a seedling-lethal albino phenotype, while its knockdown mutant showed pale green leaves (Long et al., 2013). The increased expression of these genes, along with the chloroplast division gene OsDRP5B/OsARC5, suggests that RBR05 may enhance the expression of chloroplast-encoded genes and chloroplast division as compensatory mechanisms to alleviate the defective chloroplast development in the white leaf region. Meanwhile, OsFLN2 was reported to interact with thioredoxin OsTrx-Z, a PEP-associated protein, forming a TRx-FLN regulatory complex to regulate PEP-dependent gene expression (Qiu et al., 2018). Additionally, a recent study has revealed the interaction between OsSAMHD1 and catalase OsCATC, as well as an increased accumulation of reactive oxygen species (ROS) in the OsSAMHD1 mutant, pointing to the critical role of OsSAMHD1 in maintaining cellular ROS homeostasis (Wang et al., 2023). Taken together, the upregulation of OsFLN2 and other genes involved in chloroplast gene expression is probably not only compensating for the malfunctioning chloroplast development but also fine-tuning the expression of PEP-dependent genes in response to the altered chloroplast redox status in RBR05.