The cob samples showing peculiar symptoms of ear rot were collected from major maize growing areas of Punjab state viz., Gurdaspur, Hoshiarpur, Shaheed Bhagat Singh Nagar, Rupnagar, Jalandhar, Kapurthala, Ludhiana during Spring and Kharif seasons of 2020 as well as from Sirmour district of Himachal Pradesh during Kharif 2021. The isolations were performed on potato dextrose agar (PDA) medium, resulting in the recovery of 48 Fusarium isolates (Fus 1 to Fus 48). The pure cultured isolates were maintained at 4°C for further studies.

For extraction of fungal genomic DNA, the pure cultures of all 48 Fusarium isolates were grown on 100 ml Potato Dextrose Broth (PDB) medium and were incubated at 25 ± 2°C for 10 days. Ten days old fungal mycelial mat obtained through filtering on Whatman filter paper No. 1 was ground to fine powder using liquid nitrogen and transferred into 2 ml eppendorf tube containing 800 µl preheated (65°C) Cetyl trimethyl ammonium bromide (CTAB) extraction buffer and mixed thoroughly with buffer. Fungal DNA from all the isolates was isolated using CTAB method as described by Saghai-Maroof et al. (1984). The extracted DNA was subjected to RNAse (2 µl) treatment and the samples were incubated at 37°C for 45 minutes. Quantity and quality of DNA was checked on Eppendorf Bio Spectrometer and 0.8% agarose gel. The DNA samples were then stored at -20°C for further studies.

Using VERTF-1/2primers: The fumonisin producing F. verticillioides isolates were distinguished from non-producers using a set of VERTF-1/2 primers (F- GCGGGAATTCAAAAGTGGCC, R- GAGGGCGCGAAACGGATCGG) as described by Patiño et al. (2004). Polymerase chain reaction (PCR) amplification was carried out in an Eppendorf Mastercycler Pro S (Eppendorf, Germany) using the same amplification profile as stated by Patiño et al. (2004). PCR analysis was carried out in the reaction volume of 25 µl/sample containing-0.4 µl of GoTaq™ DNA polymerase (Promega Inc.), 5 µl of 1X GoTaq™ Reaction Buffer (Green), 1.5 µl of 2.5 mM MgCl₂ (Promega Inc.), 1.5 µl each of 10 pmol forward/reverse primers, 0.5 µl of 0.1 mM dNTPs (Promega Inc.), 2 µl of template DNA and 12.60 µl of nuclease free water (Promega Inc.).

Using FUM gene specific primers: The ability of Fusarium isolates to produce fumonisins was studied by amplification and sequencing of segments of two FUM genes namely- FUM1 and FUM13. Both these genes were amplified using sets of FUM1F1/R2 (F-CACATCTGTGGGCGATCC, R-ATATGGCCCCAGCTGCATA) (Stepien et al., 2011), and FUM13F/13R (F-AGTCGGGTCAAGAGCTTGT, R-TGCTGAGCCGACATCATAATC) (Ramana et al., 2011), respectively. In vitro amplification was performed in an Eppendrof master cycler Pro S (Eppendorf, Germany) using FUM1 and FUM13 gene specific primers. PCR reaction mixture consisted of 25 µl volume/sample as mentioned above. The amplification of FUM1 gene was performed with one cycle of initial denaturation at 94°C for 5 minutes followed by 35 cycles of denaturation at 94°C for 45 seconds, annealing at 55°C for 45 seconds, extension at 72°C for 2 minutes with one cycle of final extension at 72°C for 7 minutes. The FUM13 gene was amplified using same profile as stated by Ramana et al. (2011).

The amplified PCR products were visualized on 1% agarose gel under UV light and photographed using SYNGENE gel documentation system with “GeneSnap” software program. The band size of PCR products was determined by comparing with known marker (100 bp ladder, G Biosciences, USA).

Four representative isolates (Fus 15, Fus 28, Fus 44 and Fus 45) showing positive amplification for both FUM1 and FUM13 genes along with Fus 48 isolate amplifying FUM1 gene were selected for sequencing. The amplified PCR products were purified by using NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Germany), following the manufacturer’s instructions. Around 18 µl of positive purified products (100ng/µl) of these five isolates were sequenced (Barcode Biosciences Bangalore). The retrieved forward and reverse sequences were aligned using BioEdit software, and saved as a single contig file. Contigs were generated and screened against online Gene DNA sequence database using BLASTn (Nucleotide Basic Local Alignment Search Tool) program available at NCBI website (https://blast.ncbi.nlm.nih.gov). Matching sequences were retrieved from BLASTn analysis and further used for phylogenetic analysis or sequence comparison.

Statistical analysis: Multiple sequence alignment (MSA) was performed using Mega X (Kumar et al., 2018) with Neighbor- Joining Tree option. The phylogenetic trees were constructed and the sequences of the identified Fusarium species were submitted to NCBI nucleotide database.

Selection of maize hybrids: Two maize hybrids- PMH 1 and PMH 2 differing in maturity groups as well as response to Fusarium spp. were selected for the quantitative analysis of fumonisins. PMH 1, late-maturity hybrid known for its resistance to F. verticillioides (Kaur et al., 2016), and PMH 2, early-duration hybrid susceptible to FER (Singh and Kaur, 2024), were selected to understand the relationship between FER infection and fumonisin accumulation.

Selection of Fusarium isolates: Among F. verticillioides isolates, the most virulent isolate- Fus 15 and F. proliferatum isolate- Fus 48 showing higher FER severity under artificially inoculated field conditions were selected for quantitative analysis of fumonisins.

Estimation of fumonisins: The fumonisin content of FB₁ and FB₂ in artificially inoculated maize grains of PMH 1 and PMH 2 was analyzed by using triple quadrupole liquid chromatography mass spectrometer (LC MS MS) on LCMS-MS-8045 (Shimadzu). The control treatment consisted of seed mixed with sterile distilled water. These inoculated grains were incubated at 25 ± 2°C and sampling for quantification of fumonisin production was done at 7, 14, 21 and 28 days after inoculations. Two dilutions of standards FB₁ and FB₂ (1 ppm and 0.1 ppm) (LGC Standards GmbH, Germany) were prepared with HPLC grade acetonitrile from stock solution for constructing a calibration curve. The sample preparation for fumonisins estimation was done as stated by Li et al. (2012). Recovery experiments were carried out to know the efficacy of the analytical method used and samples (5 g) of healthy maize grains were fortified with fumonisin B₁ and B₂ at level of 10, 50 and 100 µg kg^-1 with three replications of each. The sample was processed and per cent recovery was calculated. The chromatographic separation of analytes was done using C₁₈ (2.1 ×150 mm) 2μm (HSS) column, in positive ion mode using multiple reaction monitoring (MRM) of the transitions m/z ( Table 1 ). The mobile phase of 10 mM ammonium formate+0.1% formic acid in water: 0.1% formic acid in methanol (A: B 10: 90 v/v) was used with flow rate of 250 µL/min. MS conditions were: column temperature 40°C, interface temperature 250°C, desolvation temperature 444°C, DL temperature 250°C, heat block temperature 300°C, nebulizing gas flow rate at 2.5 L/min, heating gas flow rate at 5 L/min and drying gas flow rate at 5 L/min. The precursor ions m/z and collision energy for each of the compound is given in Table 1 . Lab solutions software was used to acquire and analyze the data. The fumonisins content were estimated by comparing peak height/peak area of the standard with that of unknown or spiked samples ran under identical conditions. The data was analyzed for mean ± standard error for both fumonisins-FB₁ and FB₂.

Out of 48 Fusarium isolates collected from maize ear rot samples, 40 showed a successful amplification with VERTF-1/2 primers, producing a 400 bp band, confirming them as fumonisin-producing F. verticillioides strains ( Figure 1 ). Additionally, FUM1 gene specific primers amplified a band of 1126 bp in 41 isolates ( Figure 2 ). Moreover, FUM13 specific primer produced a band of 998 bp in 36 Fusarium isolates, and the rest of 12 isolates lacking this gene did not show any amplification ( Figure 3 ). Data in Table 2 showed that five isolates (Fus 8, Fus 18, Fus 20, Fus 24 and Fus 40) did not show any amplification with VERTF-1/2 primers, FUM1 and FUM13 genes. Only six isolates viz., Fus 12, Fus 16, Fus 17, Fus 21, Fus 26 and Fus 30 showed amplification with VERTF-1/2 primers and FUM1 gene and only two isolates viz. Fus 13 and Fus 25 gave amplification with FUM13F/13R primers. One F. proliferatum isolate -Fus 48 showed amplification only with FUM1F1/R2 primer; there was no amplification with VERTF-1/VERTF-2 and FUM13F/13R primers ( Table 2 ).

The sequences of FUM1 gene for Fus 15, Fus 28, Fus 44 and Fus 45 submitted to BLAST revealed 99-100% similarity with F. verticillioides (having reference id XM_018886754.1). However, Fus 48 had shown 98% similarity with F. proliferatum (reference id CP128308.1) when subjected to BLAST. The FUM13 gene sequences of Fus 15, Fus 28, Fus 44 and Fus 45 isolates showed 99-100% similarity with F. verticillioides (reference id XM_018886761.1). The phylogenetic analysis of Fusarium isolates for both FUM1 (5 isolates) and FUM13 (4 isolates) genes resulted in 99-100% similarity with respective species ( Supplementary Figures S4 , S5 ). The above studies confirmed that FUM1 and FUM13 genes were present in 85.41% and 75% of the isolates, respectively. Since these genes are essential for fumonisin biosynthesis, their presence suggests a potential for toxin production. Furthermore, to assess and confirm the mycotoxin production potential of these isolates fumonisin content was analyzed using LC MS MS method.

Recovery of fumonisins: The average recoveries of FB₁ from maize grains fortified at 10, 50, and 100 µg/kg were 75.67%, 90.63%, and 85.14%, respectively. For FB₂, the recoveries were 73.01%, 98.40%, and 82.04% at the same fortification levels ( Table 3 ). The control samples from untreated grains and reagent blanks were also processed in the same way so as to find out the interferences, if any, due to the substrate and reagents, respectively and no interferences were observed at the retention time (RT) of FB₁ and FB₂ ( Figure 4 ). The recoveries obtained were within the international acceptable levels. The limit of quantitation (LOQ) of the method was 10 µg kg^-1 ( Figure 5 ). The linearity curves for both the fumonisins standards (FB₁ and FB₂) were constructed by injecting 10, 20, 30, 40 and 50 ng/ml of each of the standard and the response was found to be linear with R² values of 0.9935 and 0.9951 for FB₁ and FB₂, respectively ( Figures 6 , 7 ).

Fumonisin content in maize samples: The data presented in Table 4 and Table 5 revealed that FB₁ and FB₂ were produced by both the isolates of Fusarium species. When comparing the isolates, F. verticillioides isolate (Fus 15) produced greater quantity of fumonisins than F. proliferatum isolate (Fus 48) across all four sampling intervals. Seven days after inoculation, Fus 15 isolate produced lower concentration of FB₁ in the PMH 1 (0.03 mg kg^-1) and PMH 2 (1.06 mg kg^-1) hybrids. By 21 days after inoculation, FB₁ levels rose to 17.29 mg kg^-1 in PMH 1 and 96.93 mg kg^-1 in PMH 2 ( Table 4 ) ( Supplementary Figure S6 ). A similar trend was observed with Fus 48 isolate. The perusal of data presented in Table 5 revealed that at seven days after inoculation, Fus 15 isolate produced FB₂ only in PMH 2 grains (0.22 mg kg^-1), however its quantity in PMH 1 hybrid was below LOQ. Upto 14 days after inoculation, FB₂ production by Fus 48 isolate was below LOQ in both hybrids.

PMH 2 consistently exhibited higher levels of fumonisins (FB₁ and FB₂) than PMH 1 across all sampling days. In both hybrids, fumonisin levels gradually increased with inoculation time, reaching their peak at 21 days, with PMH 2 showing the highest FB₁ (96.93 mg/kg) and FB₂ (22.61 mg/kg) accumulation.