<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2025.1489918</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Multi-omics joint analysis reveals the mechanism of flower color and fragrance variation in <italic>Lilium cernuum</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Shaopeng</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Zhiqun</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhuang</surname>
<given-names>Qianqian</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2831283"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Hewen</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Jilin Agricultural Science and Technology University, College of
Agriculture</institution>, <addr-line>Jilin</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Maria Angeles Pedreno, University of Murcia, Spain</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Ygor Jess&#xe9; Ramos, Federal University of Bahia (UFBA), Brazil</p>
<p>Li Chen, Jilin Agriculture University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Qianqian Zhuang, <email xlink:href="mailto:29665296@qq.com">29665296@qq.com</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>28</day>
<month>04</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1489918</elocation-id>
<history>
<date date-type="received">
<day>03</day>
<month>09</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>14</day>
<month>02</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Chen, Chen, Zhuang and Chen</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Chen, Chen, Zhuang and Chen</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>
<italic>Lilium cernuum</italic>, a fragrant purple-red wild lily endemic to Northeast Asia, represents both ecological significance (as a key protected species) and horticultural value. While its white variant (<italic>L. cernuum</italic> var. <italic>album</italic>) exhibits distinct flower color and fragrance traits, the molecular mechanisms underlying these variations remain poorly understood. Previous studies attributed the low anthocyanin content in the white variant to LcMYB12 downregulation, yet comprehensive analyses of associated genes and metabolic pathways are lacking.</p>
</sec>
<sec>
<title>Methods</title>
<p>This study employed integrated transcriptomics, metabolomics, and volatile metabolomics to systematically compare <italic>L. cernuum</italic> and its white variant. We analyzed differential gene expression in the phenylpropanoid and flavonoid biosynthesis pathways, quantified anthocyanin/flavonoid metabolites, and assessed volatile organic compound profiles.</p>
</sec>
<sec>
<title>Results</title>
<p>The white variant showed significant reductions in flavonoids (catechin, epicatechin) and anthocyanins (cyanidin, pelargonidin, peonidin), linked to the downregulation of 58 genes in the flavonoid pathway&#x2014;including <italic>PAL</italic>, <italic>C4H</italic>, <italic>4CL</italic>, and UFGT. Critically, UFGT suppression disrupted anthocyanin glycosylation, promoting degradation and vacuolar accumulation failure. Concurrently, phenylpropanoid pathway inhibition reduced p-coumaric acid synthesis, diminishing downstream anthocyanins and volatile compounds (eugenol/methyleugenol).</p>
</sec>
<sec>
<title>Discussion</title>
<p>Our multi-omics approach reveals that flower color loss in <italic>L. cernuum</italic> var. album results from synergistic effects of transcriptional regulation and metabolic flux redirection. The UFGT-mediated glycosylation defect provides a novel explanation for anthocyanin instability in white petals. These findings complement prior genetic studies and establish a framework for targeted breeding of ornamental traits in Lilium species.</p>
</sec>
</abstract>
<kwd-group>
<kwd>
<italic>L. cernuum</italic>
</kwd>
<kwd>transcriptomics</kwd>
<kwd>metabolomics</kwd>
<kwd>volatile metabolomics</kwd>
<kwd>phenylpropanoid pathway</kwd>
</kwd-group>
<counts>
<fig-count count="12"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="52"/>
<page-count count="18"/>
<word-count count="8410"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Plant Metabolism and Chemodiversity</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Lily (<italic>Lilium</italic> spp.) is one of the world&#x2019;s famous ornamental flowers, mainly used for cultivation and cut flowers. The ornamental characteristics of lilies are mainly in their floral organs, with lily flower colors including red, orange, white, and pink, but lacking blue and purple hues. <italic>Lilium cernuum</italic> belongs to the genus <italic>Lilium</italic>, specifically the Sect. Sinomartagon. This species is a key protected wild plant in China, with a narrow distribution and near-extinction status (<xref ref-type="bibr" rid="B6">Du et&#xa0;al., 2016</xref>). <italic>L. cernuum</italic> is distributed in northeastern China (Jilin Province, Liaoning Province), the Korean Peninsula, and the Russian Far East, with the Changbai Mountains (China, Korea) being the main distribution area of <italic>L.cernuum</italic>. It is the only fragrant purple-red wild lily species in northeastern China (<xref ref-type="bibr" rid="B20">Li et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B6">Du et&#xa0;al., 2016</xref>). According to Chung M Y, due to the altitude variation in the Changbai Mountains (known as Baekdu Mountain in Korea), plants in this area have been subject to glacial and interglacial cycles, resulting in a wide range of genetic variation among low to medium density populations, including different flower color variations in wild <italic>L.cernuum</italic> populations. The migration from south to north and the founder effect after the Last Glacial Maximum have significantly increased the genetic diversity of populations in southern Korea compared to those in northeastern China. <italic>L. cernuum</italic> growing in northeastern China or the Russian Far East is more adapted to cold climates (<xref ref-type="bibr" rid="B5">Chung et&#xa0;al., 2014</xref>), making it an important species for breeding Asian hybrid lilies (<xref ref-type="bibr" rid="B25">MacRae, 1998</xref>). Some studies suggest that the pink traits of Asian lilies may originate from <italic>L. cernuum</italic> (<xref ref-type="bibr" rid="B45">Yamagishi et&#xa0;al., 2014</xref>). Recent reports indicate that Yamagishi classified <italic>L. cernuum</italic> into two flower color types: the typical pink (<italic>L. cernuum</italic>) and the white variant (<italic>L. cernuum</italic> var. <italic>album</italic>). The anthocyanin content in the petals of the white variant is significantly low, possibly due to the downregulation of <italic>LcMYB12</italic> expression (<xref ref-type="bibr" rid="B44">Yamagishi, 2020</xref>). But it remains unclear whether other genes have changed, leading to the emergence of the white variant.</p>
<p>The main reasons for the diversity of flower color changes involve multiple factors and processes, including gene mutations and deletions, anthocyanin biosynthesis, pigment synthesis and degradation interactions, post-transcriptional regulation, hormone signaling pathways, the role of specific genes, and the regulation of fragrance compound synthesis. Different types and amounts of pigments (<xref ref-type="bibr" rid="B38">Wang and Yamagishi, 2019</xref>), including carotenoids, flavonoids, and alkaloids, are responsible for flower color formation (<xref ref-type="bibr" rid="B24">Ma et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B52">Zhu et&#xa0;al., 2019</xref>). While the purple, deep red, and pink color variations in lilies are caused by the varying content of flavonoids (anthocyanins). For example, purple-red Asian lily cultivars such as &#x2018;Holean,&#x2019; &#x2018;Monte Negro,&#x2019; and &#x2018;Red Carpet&#x2019; are colored due to the presence of flavonoids, while white lilies lack anthocyanins or flavonol substances (<xref ref-type="bibr" rid="B29">N&#xf8;rb&#xe6;k and Kondo, 1999</xref>; <xref ref-type="bibr" rid="B46">Yamagishi et&#xa0;al., 2012</xref>).</p>
<p>Many studies have pointed out that the biosynthesis of anthocyanins in flowers is mainly regulated at the transcriptional level of its biosynthetic genes, and multiple transcription factors are involved in transcriptional regulation. In lilies, <italic>LhR3MYB1</italic> and <italic>LhR3MYB2</italic> have the ability to inhibit anthocyanin accumulation, with <italic>LhR3MYB2</italic> more strongly participating in negative regulation to limit anthocyanin accumulation (<xref ref-type="bibr" rid="B31">Sakai et&#xa0;al., 2019</xref>). In <italic>Chrysanthemum&#xd7;Morifolium</italic>, <italic>CmMYB4</italic> and <italic>CmMYB5</italic> negatively regulate anthocyanin biosynthesis in chrysanthemums (<xref ref-type="bibr" rid="B13">Hong et&#xa0;al., 2019</xref>). Additionally, <italic>MYB6</italic> in <italic>Populus tomentosa</italic> (<xref ref-type="bibr" rid="B37">Wang et&#xa0;al., 2019</xref>) and <italic>VvMYBA1</italic> and <italic>VvMYBA1-1</italic> in <italic>Vitis vinifera</italic> (<xref ref-type="bibr" rid="B43">Xu et&#xa0;al., 2019</xref>). can promote the biosynthesis of anthocyanins and proanthocyanidins. The application of exogenous hormone ABA can upregulate <italic>MdMYB110a</italic> expression in <italic>Malus pumila</italic>, thereby increasing anthocyanin content in apple peels (<xref ref-type="bibr" rid="B4">Cho et&#xa0;al., 2020</xref>), suggesting that the <italic>MYB</italic> gene family and its subfamilies have both positive and negative regulatory roles in anthocyanin synthesis (<xref ref-type="bibr" rid="B1">Allan et&#xa0;al., 2008</xref>). However, the <italic>MYB</italic> gene alone cannot function; <italic>MYB</italic> regulation of anthocyanin synthesis requires the participation of <italic>bHLH</italic> and <italic>WD40</italic> to form the <italic>MBW</italic> complex to activate the promoters of anthocyanin synthesis structures (<xref ref-type="bibr" rid="B15">Jaakola, 2013</xref>). In <italic>Freesia hybrida</italic>, the <italic>FhTTG1</italic> gene in the <italic>WD40</italic> family synchronizes expression with proanthocyanidin and anthocyanin accumulation in <italic>F. hybrida</italic>, highly activating the promoters of genes related to anthocyanin biosynthesis (<xref ref-type="bibr" rid="B33">Shan et&#xa0;al., 2019</xref>). In the <italic>Ziziphus jujuba</italic> genome, 138 <italic>bHLH</italic> transcription factors were screened, with the <italic>ZjTT8</italic>, <italic>ZjGL3a</italic>, and <italic>ZjGL3b</italic> of subfamily III being highly correlated with anthocyanin synthesis (<xref ref-type="bibr" rid="B34">Shi et&#xa0;al., 2019</xref>). In the study of MBW complex regulation, in maize (Zea mays), the MYC transcription factor OsB2 can directly activate the expression of the MYB partner OsC1 gene, thereby promoting the expression of the WDR gene OsPAC1, forming the MBW complex and triggering the biosynthesis of anthocyanins. In Arabidopsis, the R2R3-MYB protein AtTT2 or AtPAP1 interacts with the WDR protein AtTTG1 to form the MW complex, which can activate the expression of its MYC partner AtTT8 gene. The accumulation of AtTT8 protein further forms the MBW complex, triggering the expression of structural genes (<xref ref-type="bibr" rid="B3">Bulanov et&#xa0;al., 2025</xref>).</p>
<p>Compared to the mechanism of flower color change, the mechanism of fragrance formation is less studied. Currently, the molecular mechanisms of fragrance production in some plants with significant aroma or special scents have been studied using transcriptomics and volatile compound profiling. The main volatile components of flower fragrance are a series of volatile organic compounds, collectively referred to as volatile organic compounds (VOCs). These compounds usually exist at low concentrations in plants and are released into the air through floral structures such as stomata and glands. The chemical composition of floral fragrance is complex and diverse, mainly including terpenes, aromatic compounds, aldehydes and ketones, esters, alcohols, and compounds containing sulfur and nitrogen (<xref ref-type="bibr" rid="B12">Ghissing and Mitra, 2022</xref>; <xref ref-type="bibr" rid="B27">Mostafa et&#xa0;al., 2022</xref>). Volatile analysis and RNA sequencing of four <italic>Paeonia suffruticosa</italic> species revealed 67 floral fragrance volatiles, with different compound contents in different <italic>P. suffruticosa</italic> varieties, and transcriptomics explained that 116 and 147 differentially expressed genes were related to terpene and benzene compound accumulation, respectively (<xref ref-type="bibr" rid="B49">Zhang et&#xa0;al., 2021</xref>). Analysis of floral scent compounds in four different flower colors of <italic>Chimonanthus praecox</italic> in Yunnan, China, identified 31 types of floral scent compounds, and principal component analysis showed that &#x3b1;-ocimene, Benzyl alcohol, Benzyl acetate, Cinnamyl acetate, Eugenol, and Indole were the main floral scent components distinguishing the four <italic>C. praecox</italic> flower colors in Yunnan (<xref ref-type="bibr" rid="B26">Meng et&#xa0;al., 2021</xref>). As an extremely important cut flower, lilies not only have beautiful and large flowers, but some lily varieties also have fragrance. Volatile substance analysis of five Oriental-trumpet hybrid lily varieties showed that the volatile composition of different types of hybrid lilies is not the same, with the floral volatile profiles of three Oriental-trumpet hybrids dominated by monoterpene hydrocarbons, monoterpene alcohols, and aldehydes, while the two Oriental hybrids were dominated by monoterpene alcohols, aldehydes, and phenylpropanoids, respectively (<xref ref-type="bibr" rid="B16">Johnson et&#xa0;al., 2016</xref>). As the only wild lily species in northeastern China with a strong and distinctive fragrance, <italic>L. cernuum</italic> has also been used in Asian lily hybridization. Yuka Inada introduced the fragrance trait of <italic>L. cernuum</italic> into Asian hybrid lilies by crossing <italic>L. cernuum</italic> twice with Asian hybrid lilies. Testing showed that the floral scent components released by <italic>L. cernuum</italic> were mainly benzene/phenylpropanoid compounds, monoterpenes, and fatty acids (<xref ref-type="bibr" rid="B14">Inada et&#xa0;al., 2023</xref>).</p>
<p>
<italic>L. cernuum</italic> is of great value in terms of plant genetic resources. In 2017, the research team discovered its white variant, <italic>L. cernuum</italic> var. <italic>Album</italic>, in the wild and successfully introduced it to the Horticulture Field of Jilin Agricultural Science and Technology College for cultivation (see <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). The emergence of this white variant provides new material for studying the mechanisms of flower color formation in lilies. It is still unclear whether the variation in flower color affects the composition of fragrance volatiles. This study aims to explore the mechanisms of flower color variation in <italic>L. cernuum</italic> through the analysis of this color variant and to examine the changes in volatile compounds to investigate the linkage mechanism between flower color and fragrance variation. Through this research, we hope to reveal deeper connections between flower color and fragrance, thereby gaining a comprehensive understanding of <italic>L. cernuum</italic> and providing more theoretical support for the conservation and utilization of its genetic resources. The study of the genetic diversity and variation within <italic>L. cernuum</italic> holds substantial value for advancing genetic improvement and conservation strategies. By comprehensively analyzing the genetic background and biological traits of various flower color variants, this research offers fresh insights into the conservation of germplasm resources within the <italic>Lilium</italic> genus and provides a solid scientific foundation for genetic enhancement. This is particularly relevant for enhancing economically significant traits, such as flower color and fragrance, thereby increasing both the ornamental and commercial value of lilies. Furthermore, due to the overexploitation of wild resources and ongoing habitat destruction, species like <italic>L. cernuum</italic> face extinction risks. face a growing risk of extinction. Preserving its genetic diversity is therefore crucial. This study advances the understanding of the species&#x2019; genetic characteristics, providing a solid scientific foundation for developing effective conservation measures, safeguarding its genetic resources, and promoting sustainable development.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Flowers of <italic>L. cernuum</italic> <bold>(a)</bold> and <italic>L. cernuum</italic> var. <italic>album</italic> <bold>(b)</bold>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g001.tif"/>
</fig>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Experimental materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Materials and preparation</title>
<p>Robust and pest-free <italic>L. cernuum</italic> specimens, cultivated at the Horticulture Field of Jilin Agricultural Science and Technology College, served as the experimental subjects. These plants originated from Huashan Village, Linjiang City, Jilin Province (41&#xb0;52&#x2019;52.60&#x2019;&#x2019;N, 126&#xb0;49&#x2019;47.97&#x2019;&#x2019;E, altitude 567.5 m). The cultivation site is situated in a temperate continental monsoon climate within the northern temperate zone, characterized by distinct seasonal variations. The annual average temperature ranges from 3&#xb0;C to 5&#xb0;C. January, the coldest month, sees average temperatures of -18&#xb0;C to -20&#xb0;C, while July, the warmest month, experiences average temperatures of 21&#xb0;C to 23&#xb0;C. The annual temperature range averages 41.2&#xb0;C. The growing season spans approximately 148.7 days per year, with an average frost-free period of 130 days. The site receives around 2,500 hours of sunlight annually and records average yearly precipitation between 650 mm and 750 mm. Freezing typically begins in October, with the frost period lasting 170 to 190 days. In June 2023, floral organs from two variants&#x2014;<italic>L. cernuum</italic> (R) and <italic>L. cernuum</italic> var. <italic>album</italic> (W)&#x2014;were collected. Samples were placed in pre-sterilized bags, with three parallel samples taken for each variant, totaling three replicates. After labeling and removing stamens and pistils, petals were immediately flash-frozen in liquid nitrogen and stored at -80&#xb0;C upon returning to the laboratory.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Transcriptome database construction</title>
<sec id="s2_2_1">
<label>2.2.1</label>
<title>RNA extraction, verification, and sequencing</title>
<p>RNA was extracted from the two lily variants using ethanol precipitation combined with the CTAB-PVIOZOL method. The extracted RNA was dissolved in 50 &#xb5;L of DEPC-treated sterile water. Quality and quantity assessments were performed using a Qubit fluorometer and a Qsep400 high-throughput bio-fragment analyzer. Qualified total RNA samples from <italic>L. cernuum</italic> (labeled as R-t) and <italic>L. cernuum</italic> var. <italic>album</italic> (labeled as W-t) underwent transcriptome sequencing, each with three biological replicates, resulting in six sample groups. Sequencing was outsourced to Wuhan Maiwei Metabolic Biotechnology Co., Ltd., utilizing the Illumina platform.</p>
</sec>
<sec id="s2_2_2">
<label>2.2.2</label>
<title>Analysis and annotation of RNA-seq data</title>
<p>To ensure high-quality data, raw reads were filtered using fastp (v0.23.2) to remove adapter-containing sequences. Clean reads were assembled into transcripts using Trinity (v2.12.2), followed by clustering and de-redundancy with Corset (v1.09) (<ext-link ext-link-type="uri" xlink:href="https://github.com/trinityrnaseq/trinityrnaseq">https://github.com/trinityrnaseq/trinityrnaseq</ext-link>). Coding sequences (CDS) were predicted from the Trinity-assembled transcripts using TransDecoder (TransDecoder5.3.0) (<ext-link ext-link-type="uri" xlink:href="https://github.com/TransDecoder/">https://github.com/TransDecoder/</ext-link>), yielding corresponding amino acid sequences. De-redundant transcript sequences were annotated by aligning them with databases such as Nr (<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/">http://www.ncbi.nlm.nih.gov/</ext-link>), GO (<ext-link ext-link-type="uri" xlink:href="http://www.geneontology.org">http://www.geneontology.org</ext-link>), SwissProt (<ext-link ext-link-type="uri" xlink:href="http://www.expasy.ch/sprot/">http://www.expasy.ch/sprot/</ext-link>), KEGG (<ext-link ext-link-type="uri" xlink:href="http://www.genome.jp/kegg/">http://www.genome.jp/kegg/</ext-link>), and EggNog (<ext-link ext-link-type="uri" xlink:href="http://eggnogdb.embl.de/">http://eggnogdb.embl.de/</ext-link>) using DIAMOND (v5.3.0). Transcription factors were predicted using iTAK software (<xref ref-type="bibr" rid="B50">Zheng et&#xa0;al., 2016</xref>).</p>
</sec>
<sec id="s2_2_3">
<label>2.2.3</label>
<title>Identification of differentially expressed genes</title>
<p>Differential expression analysis between sample groups was conducted using DESeq2 to identify genes exhibiting significant differences in expression between the two biological conditions. To account for multiple hypothesis testing, the Benjamini-Hochberg method was applied to adjust the p-values, resulting in the calculation of the false discovery rate (FDR). Genes were then filtered based on the criteria of |log2 fold change| &#x2265; 1 and FDR &lt; 0.05 to identify significantly differentially expressed genes.</p>
</sec>
<sec id="s2_2_4">
<label>2.2.4</label>
<title>Quantitative real-time PCR analysis</title>
<p>qRT-PCR was employed to validate the transcriptional levels of differentially expressed genes (DEGs) in the petals of both lily variants. Reactions were performed using SYBR Premix Ex Taq (Tli RnaseH Plus, TaKaRa), with cDNA (diluted 20-fold) serving as the template. Protocols and reaction conditions adhered to the manufacturer&#x2019;s instructions. Each qRT-PCR assay was conducted with three biological replicates, and relative gene expression levels were calculated using the 2<sup>&#x2212;&#x394;&#x394;CT</sup> method. Subsequently, a one-way analysis of variance (ANOVA) was performed to compare gene expression differences across groups. To mitigate the risk of false positives from multiple comparisons, Tukey&#x2019;s Honest Significant Difference (HSD) test was applied for pairwise comparisons, while the Benjamini-Hochberg method was utilized to control the false discovery rate (FDR). Gene-specific primers for qRT-PCR were designed using Primer Express (v3.0), with common lily actin (<italic>LhActin</italic>, NCBI accession number: JX826390) serving as the internal control. Details of the specific and internal control primers are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Specific primers and internal reference primers.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Primer Names</th>
<th valign="middle" align="center">Sequences(5&#x2019;-3&#x2019;)</th>
<th valign="middle" align="center"/>
<th valign="middle" align="center">Sequences(5&#x2019;-3&#x2019;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">Cluster-22099.11-F</td>
<td valign="middle" align="center">TCATCGGATCATGGATAGTTC</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CCAGTTGTTTCAAATGGGAG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-35249.4-F</td>
<td valign="middle" align="center">TGGCACTGGCGAAGAATC</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GCGAAAGCAGGGCACATA</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-22099.14-F</td>
<td valign="middle" align="center">TTTCATCGGATCATGGATA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">TTCATTAGGGTCATTGGTTA</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-27735.2-F</td>
<td valign="middle" align="center">TCGTCCTCTACTACCGCATCT</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">ATCCCAACACCTCTTCCAG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-28792.0-F</td>
<td valign="middle" align="center">GAGGGACTTGCCTTGGTGA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CTTGTTTCGGTTTCTGGAGTG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-31153.1-F</td>
<td valign="middle" align="center">CGCTCTGTCAAGTCCGCTTTC</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GTCGCTGGCGTCCATCTGT</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-32178.3-F</td>
<td valign="middle" align="center">GATAATCAAAGAGCAGGTCAAGC</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GACAATGCCATCCCTACCG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-34110.8-F</td>
<td valign="middle" align="center">CCTCCCAGTCATCCAGAAAG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">TGTCATAGCCAATAACACCACC</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-36742.5-F</td>
<td valign="middle" align="center">GACAGACCCAAGATTCAGCA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GCATCTCCACTCGGAACACT</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-22099.0-F</td>
<td valign="middle" align="center">ACTCTGCCAGTGCTCTAACC</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CACCATCAATTTCAGCGTCT</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-17714.3-F</td>
<td valign="middle" align="center">TCCTCCTGCGACCACCTTCC</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CCTCCCTTCTTCCCGCCTGT</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-22018.0-F</td>
<td valign="middle" align="center">CAGCCAGACCATTCTCCCG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GCCAGCTTCAGCTCCACCT</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-22018.3-F</td>
<td valign="middle" align="center">GCATCCCAGACCATCCTCC</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">ATCCAGTATTGCCGAACCC</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-24205.0-F</td>
<td valign="middle" align="center">TCGCTTCTCGTCCACATTG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GTCCTCCTGCGTCTTCTTG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-25956.0-F</td>
<td valign="middle" align="center">CCTACAACTGACTGGGCAACA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GGAAGGAGACTGGGTGAAGAG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-33883.13-F</td>
<td valign="middle" align="center">GGTGGTCCTGCGATACTGG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CGACGGTCTCGACTGTGAG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-33883.15-F</td>
<td valign="middle" align="center">CCGACTACTACTTCCGCATCA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GCTTTGGGACCTCGACAAC</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-33883.25-F</td>
<td valign="middle" align="center">TCCTCGCTGAGAACCCTAA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GCTGGTGGTGCAGAAGATG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-35293.2-F</td>
<td valign="middle" align="center">GGTAAATGGAAGGGCAAGA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">ATAGGAGTGGCAGCAGGGA</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-35293.3-F</td>
<td valign="middle" align="center">GGTAAATGGAAGGGCAAGA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GCAGCAGGGAAATGGATGG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-30144.2-F</td>
<td valign="middle" align="center">TGCCAAGTTCTGAGCCCAATG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">TCAAATGCGACACCAATCCC</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-16648.0-F</td>
<td valign="middle" align="center">CAAGTCCGAGAACTCCCTGAA</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GATGCTGCCAAAGCTGATGT</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-30144.1-F</td>
<td valign="middle" align="center">TGCCAAGTTCTGAGCCCAATG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">TCAAATGCGACACCAATCCC</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-22672.0-F</td>
<td valign="middle" align="center">CTCTGCCCACCTCAACACTG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">TTTCGGTAACTCCTTGCTCAT</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-30144.0-F</td>
<td valign="middle" align="center">GACGACCTCCTGGACTTCAT</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CATTGGGCTCAGAACTTGG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-30144.3-F</td>
<td valign="middle" align="center">GACGACCTCCTGGACTTCAT</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CATTGGGCTCAGAACTTGG</td>
</tr>
<tr>
<td valign="middle" align="center">Cluster-33203.1-F</td>
<td valign="middle" align="center">GACCATTCAGCCGCCAAGT</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">AAGCCACTCCATGTAACCACTCG</td>
</tr>
<tr>
<td valign="middle" align="center">
<italic>LhActin</italic>-F</td>
<td valign="middle" align="center">GCATCACACCTTCTACAACG</td>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GAAGAGCATAACCCTCATAGA</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<italic>LhActin</italic>-F (R) denote the qRT-PCR primers for the internal reference gene.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Volatile metabolomics measurement</title>
<sec id="s2_3_1">
<label>2.3.1</label>
<title>Sample preparation and treatment</title>
<p>The lily petals stored in a -80&#xb0;C freezer were taken out and ground into powder in liquid nitrogen. This process was performed for three biological replicates of each lily type, resulting in a total of six samples. The <italic>L. cernuum</italic> samples were labeled as R-GC, and the <italic>L. cernuum</italic> var. <italic>album</italic> samples were labeled as W-GC. 500 mg of the powder was immediately transferred to a 20 mL headspace vial (Agilent, Palo Alto, CA, USA) containing a NaCl saturated solution. The vials were sealed using crimp-top caps with TFE-silicone headspace septa (Agilent). For the SPME analysis, each vial was placed at 60&#xb0;C for 5 minutes, then a 120 &#xb5;m DVB/CWR/PDMS fiber (Agilent) was exposed to the headspace of the sample for 15 minutes at 60&#xb0;C.</p>
</sec>
<sec id="s2_3_2">
<label>2.3.2</label>
<title>GC-MS conditions</title>
<p>After sampling, desorption of the VOCs from the fiber coating was carried out in the injection port of the GC apparatus (Model 8890; Agilent) at 250&#xb0;C for 5 minutes in splitless mode. The identification and quantification of VOCs were performed using an Agilent Model 8890 GC coupled with a 7000D mass spectrometer (Agilent), equipped with a 30 m &#xd7; 0.25 mm &#xd7; 0.25 &#x3bc;m DB-5MS (5% phenyl-polymethylsiloxane) capillary column. Helium was used as the carrier gas at a linear velocity of 1.2 mL/min. The injector temperature was maintained at 250&#xb0;C. The oven temperature was programmed as follows: starting at 40&#xb0;C (held for 3.5 minutes), increasing at 10&#xb0;C/min to 100&#xb0;C, at 7&#xb0;C/min to 180&#xb0;C, and at 25&#xb0;C/min to 280&#xb0;C, where it was held for 5 minutes. Mass spectra were recorded in electron impact (EI) ionization mode at 70 eV. The quadrupole mass detector, ion source, and transfer line temperatures were set to 150&#xb0;C, 230&#xb0;C, and 280&#xb0;C, respectively. The MS was operated in selected ion monitoring (SIM) mode for the identification and quantification of analytes.</p>
</sec>
<sec id="s2_3_3">
<label>2.3.3</label>
<title>Differential metabolite screening</title>
<p>Differential metabolites between <italic>L. cernuum</italic> and <italic>L. cernuum</italic> var. <italic>album</italic> were initially identified based on the Variable Importance in Projection (VIP) scores derived from the OPLS-DA model. These metabolites were then further refined using the false discovery rate (FDR) obtained from univariate analysis. The screening criteria for significant differences were defined as VIP &gt; 1 and either a fold change &#x2265; 2 or &#x2264; 0.5.</p>
</sec>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Broad-spectrum targeted metabolomics measurement</title>
<sec id="s2_4_1">
<label>2.4.1</label>
<title>Dry sample extraction</title>
<p>The lily petals stored in a -80&#xb0;C freezer were taken out and ground into powder in liquid nitrogen. This procedure was performed for three biological replicates of each lily type, resulting in a total of six samples. The <italic>L. cernuum</italic> samples were labeled as R-MS, and the <italic>L. cernuum</italic> var. <italic>album</italic> samples were labeled as W-MS. Using vacuum freeze-drying technology, the biological samples were placed in a lyophilizer (Scientz-100F) and then ground (30 Hz, 1.5 minutes) into powder using a grinder (MM 400, Retsch). Next, 50 mg of sample powder was weighed using an electronic balance (MS105DM) and 1200 &#x3bc;L of -20&#xb0;C pre-cooled 70% methanolic aqueous internal standard extract was added (for samples weighing less than 50 mg, the extract was added at a rate of 1200 &#x3bc;L per 50 mg sample). The mixture was vortexed for 30 seconds every 30 minutes, for a total of six times. After centrifugation (12,000 rpm, 3 minutes), the supernatant was aspirated, filtered through a microporous membrane (0.22 &#x3bc;m pore size), and stored in an injection vial for UPLC-MS/MS analysis.</p>
</sec>
<sec id="s2_4_2">
<label>2.4.2</label>
<title>UPLC conditions</title>
<p>The sample extracts were analyzed using a UPLC-ESI-MS/MS system (UPLC, ExionLC&#x2122; AD, <ext-link ext-link-type="uri" xlink:href="https://sciex.com.cn/">https://sciex.com.cn/</ext-link>) coupled with a tandem mass spectrometry system (<ext-link ext-link-type="uri" xlink:href="https://sciex.com.cn/">https://sciex.com.cn/</ext-link>). The analytical conditions were as follows: UPLC column, Agilent SB-C18 (1.8 &#xb5;m, 2.1 mm &#xd7; 100 mm); the mobile phase consisted of solvent A (pure water with 0.1% formic acid) and solvent B (acetonitrile with 0.1% formic acid). Sample measurements were performed using a gradient program starting at 95% A and 5% B. Over 9 minutes, a linear gradient to 5% A and 95% B was programmed, and this composition was maintained for 1 minute. Subsequently, the composition was adjusted to 95% A and 5% B within 1.1 minutes and held for 2.9 minutes. The flow rate was set to 0.35 mL/min; the column oven was set to 40&#xb0;C; the injection volume was 2 &#x3bc;L. The effluent was alternately connected to an ESI-triple quadrupole-linear ion trap (QTRAP)-MS.</p>
</sec>
<sec id="s2_4_3">
<label>2.4.3</label>
<title>ESI-Q TRAP-MS/MS</title>
<p>The ESI source operation parameters were as follows: source temperature 550&#xb0;C; ion spray voltage (IS) 5500 V (positive ion mode)/-4500 V (negative ion mode); ion source gas I (GSI), gas II (GSII), and curtain gas (CUR) were set at 50, 60, and 25 psi, respectively; and the collision-activated dissociation (CAD) was set to high. QQQ scans were acquired as MRM experiments with collision gas (nitrogen) set to medium. The DP (declustering potential) and CE (collision energy) for individual MRM transitions were optimized. A specific set of MRM transitions was monitored for each period according to the metabolites eluted during that period.</p>
<p>The ESI source operation parameters were as follows: source temperature 550&#xb0;C; ion spray voltage (IS) 5500 V (positive ion mode)/-4500 V (negative ion mode); ion source gas I (GSI), gas II(GSII), curtain gas (CUR) were set at 50, 60, and 25 psi, respectively; the collision-activated dissociation(CAD) was high. QQQ scans were acquired as MRM experiments with collision gas (nitrogen) set to medium. DP(declustering potential) and CE(collision energy) for individual MRM transitions was done with further DP and CE optimization. A specific set of MRM transitions were monitored for each period according to the metabolites eluted within this period.</p>
</sec>
<sec id="s2_4_4">
<label>2.4.4</label>
<title>Differential metabolite screening</title>
<p>The procedure for differential metabolite screening was identical to that outlined in Section 2.3.3.</p>
</sec>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Analysis of Volatile Metabolomics and Broad-Spectrum Targeted Metabolomics</title>
<sec id="s2_5_1">
<label>2.5.1</label>
<title>PCA</title>
<p>Unsupervised PCA (principal component analysis) was performed using the &#x2018;prcomp&#x2019; statistics function within R (<ext-link ext-link-type="uri" xlink:href="http://www.r-project.org">www.r-project.org</ext-link>). The data was unit variance scaled before performing the unsupervised PCA.</p>
</sec>
<sec id="s2_5_2">
<label>2.5.2</label>
<title>Hierarchical cluster analysis and pearson correlation coefficients</title>
<p>The HCA (hierarchical cluster analysis) results of samples and metabolites were presented as heatmaps with dendrograms, while Pearson correlation coefficients (PCC) between samples were calculated using the &#x2018;cor&#x2019; function in R and presented as heatmaps only. Both HCA and PCC were performed using the R package &#x2018;ComplexHeatmap&#x2019;. For HCA, normalized signal intensities of metabolites (unit variance scaling) were visualized as a color spectrum.</p>
</sec>
<sec id="s2_5_3">
<label>2.5.3</label>
<title>Differential metabolites selection</title>
<p>For two-group analysis, differential metabolites were determined by VIP (VIP &gt; 1) and absolute Log2FC (|Log2FC| &#x2265; 1.0). VIP values were extracted from OPLS-DA results, which also contained score plots and permutation plots, generated using the R package &#x2018;MetaboAnalystR&#x2019;. The data was log-transformed (log2) and mean-centered before OPLS-DA. To avoid overfitting, a permutation test (200 permutations) was performed.</p>
</sec>
<sec id="s2_5_4">
<label>2.5.4</label>
<title>KEGG annotation and enrichment analysis</title>
<p>Identified metabolites were annotated using the KEGG Compound database (<ext-link ext-link-type="uri" xlink:href="http://www.kegg.jp/kegg/compound/">http://www.kegg.jp/kegg/compound/</ext-link>), and annotated metabolites were then mapped to the KEGG Pathway database (<ext-link ext-link-type="uri" xlink:href="http://www.kegg.jp/kegg/pathway.html">http://www.kegg.jp/kegg/pathway.html</ext-link>). Pathways with significantly regulated metabolites were then fed into MSEA (metabolite sets enrichment analysis), and their significance was determined by hypergeometric test p-values.</p>
</sec>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results and analysis</title>
<sec id="s3_1">
<label>3.1</label>
<title>Transcriptomic analysis</title>
<sec id="s3_1_1">
<label>3.1.1</label>
<title>Sequencing quality and differential gene screening</title>
<p>Through transcriptomic analysis of the petals of two lily color varieties, R-t generated 46,676,986 clean reads, and W-t generated 42,606,872 clean reads. The error rate was kept below 0.02%. The Q30 values ranged between 94.70% and 95.31%, and the GC content ranged between 49.47% and 50.60%. The PCA plot showed that PC1 and PC2 contributed 63.07%, with the two lily varieties clearly separated (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2a</bold>
</xref>). The annotation rate reached 73.81% after comparing the reads with six databases: KEGG, NR, SwissProt, KOG, GO, and Pfam, indicating that the transcriptomic analysis is reliable and can be used for subsequent analysis. Differential gene screening of the obtained clean reads revealed 12,174 differentially expressed genes (DEGs) between R-t and W-t, with 6,055 genes downregulated and 6,119 genes upregulated (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2b</bold>
</xref>). According to K-means clustering analysis, the DEGs were divided into 10 subclasses. Compared to R-t, W-t showed higher gene expression levels in subclasses 1, 6, 7, and 8, while in subclasses 2, 3, 4, 5, 9, and 10, W-t exhibited lower gene expression levels compared to R-t (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2c</bold>
</xref>). These genes may play a crucial role in flower color change.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Differential gene screening and expression clustering analysis. <bold>(a)</bold> PCA plot of R-t and W-t. <bold>(b)</bold> Volcano plot of differential genes. <bold>(c)</bold> K-means clustering analysis of differential genes.The horizontal axis represents the samples, and the vertical axis represents the normalized expression levels.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g002.tif"/>
</fig>
</sec>
<sec id="s3_1_2">
<label>3.1.2</label>
<title>GO annotation classification and KEGG analysis</title>
<p>The GO annotation statistics of differential genes revealed several key biological processes and molecular functions related to flower color variation during pigment biosynthesis. In the Biological Process (BP) category, differential genes were mainly concentrated in Cellular and Metabolic Processes. The Cellular Component (CC) category data indicated significant changes in molecular components within organelles related to pigment synthesis and storage, possibly implying regulation of plastid formation or function in petals. In the Molecular Function (MF) category, genes involved in catalytic activation and protein binding were highly enriched, suggesting their potential roles in regulating anthocyanin biosynthesis and transport (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3a</bold>
</xref>). The KEGG annotation of differential genes showed distinct differential expressions in multiple metabolic pathways. These differential genes were mainly concentrated in Flavonoid biosynthesis (Ko00941), Biosynthesis of secondary metabolites (Ko01110), and Metabolic pathways (Ko01100) in the Metabolism process. Among these, the RichFactor value was the highest in the Flavonoid biosynthesis pathway. In this pathway, 58 differential genes were upregulated and 13 were downregulated in R-t compared to W-t (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3b</bold>
</xref>). In flavonoid biosynthesis, these differentially expressed genes mainly belong to the transferase family, reductase family, synthetase family, isomerase family, and oxidoreductase family. Key genes include flavanone 3-hydroxylase and chalcone synthase. Among them, genes related to the chalcone and stilbene synthases, N-terminal domain account for 26.8%, playing a crucial role in the biosynthesis of flavonoids and anthocyanin pigments.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>GO annotation classification statistics and KEGG analysis. <bold>(a)</bold> The horizontal axis represents the secondary GO terms, and the vertical axis shows the number of differential genes in each GO term. <bold>(b)</bold> From outer to inner, the first ring represents the KEGG pathway, with different colors representing different KEGG classifications; the second ring shows the number of genes in the background within this classification and the q-value. The longer the bar, the more genes there are, and the redder it is, the more significant the enrichment; the third ring shows the proportion of upregulated and downregulated genes, with light red representing the proportion of upregulated genes and light blue representing the proportion of downregulated genes; specific values are shown below; the fourth ring shows the RichFactor values for each classification, with each small grid of the background auxiliary line representing 0.2.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g003.tif"/>
</fig>
</sec>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Differential analysis of petals volatile organic compounds and petal metabolomics</title>
<sec id="s3_2_1">
<label>3.2.1</label>
<title>Differential analysis of petals volatile organic compounds</title>
<p>This study performed an overlay analysis of the total ion chromatograms (TIC) obtained from mass spectrometry detection of various quality control samples. The results showed a high degree of overlap in the TIC curves, with consistent retention times and peak intensities. This consistency indicates that the mass spectrometry signals remained stable across different detection times for the same sample, confirming their reliability for subsequent analysis. A total of 540 VOCs were detected in the petals, which were classified into 16 categories. Among these, terpenoids were the most abundant, with 97 types accounting for 18% of the total. This was followed by esters, with 84 types accounting for 15.6%, and heterocyclic compounds, with 80 types accounting for 14.8%. Together, these three classes of compounds accounted for 48.4% of the total (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4a</bold>
</xref>). Comparing the fold changes in VOCs quantification between W-GC and R-GC, 120 of the 540 VOCs showed changes. Compared to R-GC, 110 VOCs were significantly downregulated in W-GC, while only 10 VOCs were significantly upregulated (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4b</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Differential analysis of VOCs between W-GC and R-GC. <bold>(a)</bold> Composition ratio of metabolites. <bold>(b)</bold> The horizontal axis represents the cumulative number of substances arranged in order of fold change from small to large, and the vertical axis represents the logarithmic value of fold change with a base of 2. Each point represents a substance, with green points representing the top 10 downregulated substances and red points representing the top 10 upregulated substances.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g004.tif"/>
</fig>
</sec>
<sec id="s3_2_2">
<label>3.2.2</label>
<title>KEGG functional annotation and enrichment analysis of petal VOCs</title>
<p>KEGG annotation was performed on the 120 VOCs, and 21 of these VOCs were annotated to 11 metabolic pathways. The classification of these results is shown in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>. Among the annotated VOCs, 12 were concentrated in the Metabolic pathways process, accounting for 57.14%, followed by the Biosynthesis of secondary metabolites process, which included 5 significantly different VOCs, accounting for 23.81% (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5a</bold>
</xref>). Based on the results of the differential metabolites, KEGG pathway enrichment analysis was performed. The metabolic pathways were ranked and displayed according to their P-value, from smallest to largest across the 11 metabolic processes (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5b</bold>
</xref>). The results indicated that in the Phenylpropanoid biosynthesis process, the enrichment index of volatile differential metabolites was relatively high, and the difference was extremely significant.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Comparison and enrichment of VOCs Pathways between W-GC and R-GC. <bold>(a)</bold> The proportion in the pie chart represents the ratio of differential metabolites annotated to that pathway out of the total annotated differential metabolites. <bold>(b)</bold> The horizontal axis indicates the Rich Factor for each pathway, and the vertical axis lists the pathway names (sorted by P-value). The color of the points reflects the P-value, with redder points indicating more significant enrichment, and the size of the points representing the number of enriched differential metabolites.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g005.tif"/>
</fig>
</sec>
<sec id="s3_2_3">
<label>3.2.3</label>
<title>Sensory flavor characterization of differential VOCs in petals</title>
<p>By comparing the differential metabolites identified based on the screening criteria in W-GC and R-GC and their annotated sensory flavor characteristics, a radar chart was drawn for the top 10 sensory flavors with the highest number of annotations (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). The results showed that the differential VOCs between W-GC and R-GC were mainly concentrated in sweetness and floral aroma. In sweetness, 22 VOCs were annotated, including Acetophenone, 4&#x2019;-hydroxy-, BenzAldehyde, BenzAldehyde, 2-methyl-, Hydrocinnamic Acid and Methyleugenol, with five VOCs being annotated to the Metabolic pathways, Phenylalanine metabolism, and Phenylpropanoid biosynthesis pathways, all of which were reduced in content. In floral aroma, 21 VOCs were annotated, including BenzeneacetAldehyde, Benzeneacetic acid, Eugenol, and trans-Isoeugenol, with four VOCs also annotated to the Metabolic pathways, Phenylalanine metabolism, and Phenylpropanoid biosynthesis pathways, all of which were also reduced in content. This suggests that during the transition of <italic>L. cernuum</italic> from red to white, some of the sweetness and floral aroma characteristics change.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Sensory flavor characterization analysis of differential VOCs in petals.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g006.tif"/>
</fig>
<p>The outermost circle names represent sensory flavor characteristics. The numbers corresponding to the green points indicate the number of occurrences of each sensory flavor characteristic, i.e., the number of differential metabolites annotated to that sensory flavor characteristic.</p>
</sec>
<sec id="s3_2_4">
<label>3.2.4</label>
<title>Differential metabolite analysis of petals</title>
<p>The overlay analysis of the TIC revealed a high degree of overlap in the curves for metabolite detection, with consistent retention times and peak intensities. This demonstrates excellent signal stability, confirming that the data is reliable and suitable for subsequent analysis. A total of 1,243 metabolites were detected in the petals, which were classified into 13 categories. Among these, Flavonoids were the most abundant, with 319 metabolites accounting for 25.7%, followed by Phenolic acids with 174 metabolites, accounting for 14.0% (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7a</bold>
</xref>). Comparing the fold change in metabolite quantification between R-MS and W-MS, there were 419 significantly different metabolites (DMs) among the 1,243 metabolites in the petals. Compared to R-MS, W-MS had 235 metabolites that were significantly down-regulated, of which 119 were Flavonoids, accounting for 50.64%. On the other hand, 184 metabolites were significantly up-regulated (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7b</bold>
</xref>), among which Lipids were the most abundant, reaching 50 metabolites, accounting for 42.02%.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Differential analysis of metabolites between R-MS and W-MS. <bold>(a)</bold> Composition proportion of metabolites. <bold>(b)</bold> The horizontal axis represents the cumulative number of substances ranked by fold change from small to large, and the vertical axis represents the logarithm of the fold change with a base of 2. Each point represents a substance, with green points representing the top 10 down-regulated substances and red points representing the top 10 up-regulated substances.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g007.tif"/>
</fig>
</sec>
<sec id="s3_2_5">
<label>3.2.5</label>
<title>KEGG functional annotation and enrichment analysis of differential metabolites in petals</title>
<p>KEGG pathway enrichment analysis was performed on the 419 DMs (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8a</bold>
</xref>), and the top 20 pathways ranked by P-value were displayed from smallest to largest. The results indicated that DMs related to the synthesis of anthocyanins and flavonoids were mainly concentrated in the Arginine biosynthesis (ko00942) and Flavone and flavonol biosynthesis (ko00944) pathways. Cluster analysis of the DMs in these two metabolic pathways revealed that in Arginine biosynthesis (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8b</bold>
</xref>), Delphinidin-3,5,3&#x2019;-Tri-O-glucoside and Delphinidin-3-O-glucoside (Mirtillin) showed significantly increased content in W-MS, while they were significantly decreased in R-MS. Conversely, Cyanidin 3-O-sophoroside, Pelargonidin-3-O-glucoside, and Peonidin-3-O-glucoside showed significantly decreased content in W-MS and significantly increased in R-MS. In the Flavone and flavonol biosynthesis pathway (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8c</bold>
</xref>), Vitexin-2&#x2019;&#x2019;-O-rhamnoside, Kaempferol-3-O-rhamnoside (Afzelin) (Kaempferin), Quercetin-3-O-rhamnoside (Quercitrin), and Kaempferol-3-O-rutinoside (Nicotiflorin) showed significantly increased content in R-MS and significantly decreased in W-MS.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>KEGG functional annotation and enrichment analysis of differential metabolites in petals. <bold>(a)</bold> The horizontal axis represents the Rich Factor for each pathway, and the vertical axis lists the pathway names (sorted by P-value). The color of the points reflects the P-value, with redder points indicating more significant enrichment, and the size of the points representing the number of enriched DMs. <bold>(b, c)</bold> The horizontal axis represents the sample names, and the vertical axis represents DMs. Different colors represent the different values obtained from normalized relative content (red indicates high content, green indicates low content). The annotation bar above the heatmap corresponds to the sample grouping (Group), and the dendrogram on the left of the heatmap represents the hierarchical clustering results of differential metabolites. The annotation bar to the right of the clustering tree corresponds to the primary classification of substances (Class), with different colors representing different substance categories.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g008.tif"/>
</fig>
</sec>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Joint analysis</title>
<sec id="s3_3_1">
<label>3.3.1</label>
<title>Joint analysis of transcriptome and volatile organic metabolome</title>
<p>In this study, the correlation between DEGs (Differentially Expressed Genes) and VOCs (Volatile Organic Compounds) was analyzed. By calculating the Pearson correlation coefficient between DEGs and VOCs, we selected those with an absolute correlation coefficient greater than 0.8 and a p-value less than 0.05. Then, based on the KEGG annotation results for genes and volatile metabolites, the relevant data were screened (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9a</bold>
</xref>). The genes and VOCs in the Phenylpropanoid biosynthesis (ko00940) and Phenylalanine metabolism (ko00360) pathways were selected for analysis. In these two pathways, when comparing R-GC and W-GC, the content of Eugenol and Methyleugenol in W-GC significantly decreased. There were 66 genes associated with these two metabolites, 59 of which were common to both Eugenol and Methyleugenol. Comparing these 59 genes with the PFam database, they mainly belong to three protein families: Peroxidase (13 genes), Aromatic amino acid lyase (10 genes), and AMP-binding enzyme (7 genes). Comparing with the Nr database, the 59 associated genes were mainly annotated to five gene families: Peroxidase Family (8 genes), Cinnamoyl-CoA Reductase Family (8 genes), 4-Coumarate&#x2013;CoA Ligase Family (4 genes), Phenylalanine Ammonia-Lyase Family (3 genes), and Caffeoyl-CoA O-Methyltransferase Family (3 genes). All 59 associated genes in W-GC were down-regulated (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9b</bold>
</xref>).</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Jointanalysis of transcriptome sequencing and volatile metabolomie. <bold>(a)</bold> The horizontal axis represents the enrichment factor (Diff/Background) of the pathway in different omics, and the vertical axis represents the KEGG pathway name. The red-yellow-green gradient indicates the level of enrichment significance, represented by the p-value, The deeper the red color, the higher the abundance of metabolites and gene expression. The shape of the bubbles represents different omics, and the size of the bubbles represents the number of differential metabolites or genes, with larger points representing more substantial numbers. <bold>(b)</bold> The expression changes of 59 genes associated with Eugenol and Methyleugenol in <italic>L.cernuum</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g009.tif"/>
</fig>
</sec>
<sec id="s3_3_2">
<label>3.3.2</label>
<title>Joint analysis of the transcriptome and metabolome</title>
<p>The correlation between DEGs and DMs in L.cernuum was analyzed using their quantitative values. By calculating the Pearson correlation coefficient between DEGs and DMs, we selected those with an absolute correlation coefficient greater than 0.8 and a p-value less than 0.05. Then, based on the KEGG annotation results for genes and metabolites, relevant data were screened. As shown in <xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10</bold>
</xref>, the number of DEGs and DMs in the Anthocyanin biosynthesis (ko00942) pathway reached a highly significant level. Additionally, DEGs and DMs in the Phenylpropanoid biosynthesis (ko00940) and Flavonoid biosynthesis (ko00941) pathways were also selected for analysis.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>KEGG enrichment map of joint analysis of the transcriptome and metabolome.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g010.tif"/>
</fig>
<p>When comparing R-MS and W-MS, in the Phenylpropanoid biosynthesis pathway, 37 genes and the metabolites Chlorogenic acid (3-O-Caffeoylquinic acid), Sinapinaldehyde, and p-Coumaric acid showed changes, with both gene expression and metabolite content being down-regulated in W-MS. These 37 genes belong to the Phenylpropanoid Pathway Enzymes, Carbohydrate Metabolism Enzymes, and Aldehyde Dehydrogenase Family categories, with the Phenylpropanoid Pathway Enzymes mainly including the Phenylalanine Ammonia Lyase (PAL), 4-Coumarate&#x2013;CoA Ligase (4CL), and Cinnamoyl-CoA Reductase (CCR) families. It is worth noting that these 37 genes are also associated with the VOCs Eugenol and Methyleugenol.</p>
<p>In the Flavonoid biosynthesis pathway, a larger number of genes showed changes. A total of 71 genes and 7 metabolites, including Aromadendrin (Dihydrokaempferol), Catechin, Chlorogenic acid (3-O-Caffeoylquinic acid), Epicatechin, Hesperetin, Hesperetin-7-O-neohesperidoside (Neohesperidin), and Naringenin-7-O-glucoside (Prunin), showed changes. Compared to R-MS, 58 of the 71 genes in W-MS were down-regulated, and 13 were up-regulated. Among the 7 metabolites, the content of Aromadendrin and Hesperetin increased, while the other 5 metabolites decreased. These 71 genes mainly belong to the Flavonoid Biosynthesis Enzymes and Phenylpropanoid Pathway Enzymes categories, with the Flavonoid Biosynthesis Enzymes primarily including Chalcone Synthase (CHS), Chalcone Isomerase (CHI), Flavanone 3-Hydroxylase (F3H), Flavonol Synthase (FLS), Flavonoid 3&#x2019;-Hydroxylase (F3&#x2019;H), Dihydroflavonol 4-Reductase (DFR), Anthocyanidin Synthase (ANS), and Anthocyanidin Reductase (ANR).</p>
<p>In the Anthocyanin biosynthesis pathway, 7 genes and 9 metabolites showed changes. Compared to R-MS, 6 of the 7 genes in W-MS were down-regulated, and 2 were up-regulated. Among these 7 genes, 5 belonged to UDP-glucose: anthocyanidin 3-O-glucosyltransferase (UFGT), while 2 were unclassified. The 9 metabolites can be categorized into 4 types, with the content of Cyanidin, Pelargonidin, and Peonidin decreasing in W-MS, but the content of Delphinidin increasing.</p>
<p>The horizontal axis represents the KEGG pathway names, and the vertical axis represents the significance test p-value for enrichment in the pathway. Red and green indicate metabolomics and transcriptomics, respectively.</p>
</sec>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Validation of related genes</title>
<p>To confirm the key DEGs involved in the Phenylpropanoid Pathway, Flavonoid biosynthesis, and Anthocyanin biosynthesis pathways, RNA sequencing results were used. The three most significantly differentially expressed DEGs from each pathway were selected for expression pattern analysis using real-time quantitative PCR. The results from qRT-PCR showed that the expression of 27 DEGs in <italic>L. cernuum</italic> and <italic>L. cernuum</italic> var. <italic>album</italic> was down-regulated, with a highly significant difference. These results indicate that not only is the expression trend of qRT-PCR data consistent with RNA-seq data, but they also validate the differential expression of these key genes in different samples (<xref ref-type="fig" rid="f11">
<bold>Figure&#xa0;11</bold>
</xref>).</p>
<fig id="f11" position="float">
<label>Figure&#xa0;11</label>
<caption>
<p>Real-time quantitative PCR validation of 27 DEGs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g011.tif"/>
</fig>
<p>Different lowercase letters represent significant differences.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Research on the biosynthetic pathways of plant pigments and fragrances primarily focuses on the anthocyanin and flavonoid biosynthetic pathways (<xref ref-type="bibr" rid="B21">Liu et&#xa0;al., 2021</xref>), as well as the biosynthesis of terpenoids, phenylpropanoids, and fatty acid-derived VOCs (<xref ref-type="bibr" rid="B30">Picazo-Aragon&#xe9;s et&#xa0;al., 2020</xref>). In the biosynthetic pathway of plant pigments, anthocyanins and flavonoids are the primary pigments responsible for determining flower color (<xref ref-type="bibr" rid="B7">Enaru et&#xa0;al., 2021</xref>). The biosynthesis of anthocyanins and flavonoids begins with the conversion of phenylalanine to cinnamic acid by PAL, followed by the catalysis of chalcone formation from cinnamoyl-CoA and three molecules of malonyl-CoA by CHS. This is then converted into flavanone by CHI. Subsequently, flavanone undergoes a series of enzymatic reactions, including those catalyzed by DFR and ANS, ultimately producing anthocyanins. Other flavonoid derivatives are formed through enzymatic modifications such as hydroxylation, methylation, and glycosylation, contributing to the diversity and vividness of plant colors. The biosynthetic pathways of floral fragrances primarily involve the synthesis of terpenoids, phenylpropanoids, and fatty acid-derived compounds (<xref ref-type="bibr" rid="B23">Lv et&#xa0;al., 2024</xref>). Terpenoids are synthesized through the methylerythritol phosphate (MEP) pathway and the mevalonate (MVA) pathway (<xref ref-type="bibr" rid="B2">Bergman et&#xa0;al., 2024</xref>), with key enzymes including geranyl diphosphate synthase (GPPS) and terpene synthases (TPS). Phenylpropanoid compounds are derived from cinnamic acid, produced by PAL, and are further synthesized into aromatic substances such as eugenol and vanillin. Fatty acid derivatives are synthesized through the lipoxygenase (LOX) pathway (<xref ref-type="bibr" rid="B36">Viswanath et&#xa0;al., 2020</xref>), producing green leaf volatiles (GLVs) such as cis-3-hexenal and cis-3-hexenol. These pathways collectively generate a complex array of floral fragrance compounds, contributing to the distinctive scents of plants.</p>
<p>To better understand the relationship between gene expression and the production of volatile metabolites, flavonoids, and anthocyanins, transcriptomic and metabolomic data were mapped onto the Phenylpropanoid Pathway, Flavonoid Biosynthesis, and Anthocyanin Biosynthesis pathways (<xref ref-type="fig" rid="f12">
<bold>Figure&#xa0;12</bold>
</xref>).</p>
<fig id="f12" position="float">
<label>Figure&#xa0;12</label>
<caption>
<p>Integrated analysis of transcriptomic and metabolomic data in the biosynthesis pathways of volatile metabolites, flavonoids, and anthocyanins circles represent metabolites, squares represent predicted proteins, and the color intensity reflects the abundance of metabolites and gene expression.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1489918-g012.tif"/>
</fig>
<p>Through the joint analysis of transcriptomics, metabolomics, and volatolomics, it was found that compared to <italic>L. cernuum</italic> var. <italic>album</italic>, <italic>L. cernuum</italic> had higher contents of flavonoids, anthocyanins, and volatile organic compounds related to floral fragrance and sweetness. The Phenylpropanoid Pathway plays a crucial role not only in plant resistance and lignin biosynthesis but also in the formation and variation of flower color and fragrance. Changes in this pathway directly affect the synthesis of precursors for anthocyanins and volatile metabolites (<xref ref-type="bibr" rid="B9">Feng et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B17">Khan et&#xa0;al., 2022</xref>). p-Coumaric acid is a key intermediate in the Phenylpropanoid Pathway. Phenylalanine, under the action of PAL, the initial enzyme in the phenylpropanoid metabolism pathway, is deaminated and converted to Cinnamic acid, which is then transformed into p-Coumaric acid by C4H. 4CL further converts p-Coumaric acid into p-Coumaroyl-CoA. This intermediate is then subjected to a series of enzymatic reactions&#x2014;demethylation, reduction, and methylation&#x2014;to ultimately produce Eugenol, which subsequently leads to the formation of Methyleugenol (<xref ref-type="bibr" rid="B18">Kumari et&#xa0;al., 2017</xref>). Both of these metabolites are essential components of lily fragrance (<xref ref-type="bibr" rid="B40">Wei et&#xa0;al., 2022</xref>) and are also major volatile active substances in many aromatic plants and flowers (<xref ref-type="bibr" rid="B12">Ghissing and Mitra, 2022</xref>). For instance, the fragrance of <italic>Ocimum basilicum</italic> is attributed to Eugenol, Eugenol and Methyleugenol are also the primary components of the fragrance in (<xref ref-type="bibr" rid="B32">Shah et&#xa0;al., 2022</xref>) <italic>Lonicera japonica</italic> (<xref ref-type="bibr" rid="B19">Li et&#xa0;al., 2022</xref>), <italic>Tillandsia</italic> (<xref ref-type="bibr" rid="B22">Lo et&#xa0;al., 2021</xref>) and <italic>Rosa hybrid</italic> (<xref ref-type="bibr" rid="B10">Feng et&#xa0;al., 2022</xref>). In different color groups of Chimonanthus praecox, Eugenol is one of the main components of the fragrance, with significant variation in content across different flower colors, thereby impacting the floral scent characteristics. Eugenol also interacts with other fragrance components, imparting each flower color of <italic>C.praecox</italic> with unique aromatic features (<xref ref-type="bibr" rid="B26">Meng et&#xa0;al., 2021</xref>). In this study, the reduced fragrance and color change to pure white in <italic>L. cernuum</italic> var. <italic>album</italic> were linked to the downregulation of key genes (such as PAL, 4CL, and CCR) in the Phenylpropanoid Pathway. This downregulation led to a significant decrease in the levels of volatile organic compounds like Eugenol and Methyleugenol, as well as pigments like anthocyanins and flavonoids, thus affecting both fragrance and flower color. The reduction in p-Coumaric acid, a crucial intermediate in this pathway, directly impacted the synthesis of precursor compounds for fragrance and color, contributing to the diminished scent and altered color of <italic>L. cernuum</italic> var. <italic>album</italic>.</p>
<p>p-Coumaric acid also serves as a key precursor in the biosynthesis pathways of anthocyanins and flavonoids. It is first catalyzed by 4CL to form p-Coumaroyl-CoA, which then undergoes a condensation reaction with three molecules of malonyl-CoA under the action of CHS to form Chalcone. Chalcone is subsequently isomerized into flavanone by CHI. Flavanone is then converted into dihydrokaempferol via a hydroxylation reaction catalyzed by F3H. Dihydrokaempferol is further reduced to leucoanthocyanidin by DFR, which is then oxidized into Anthocyanidin by ANS. Finally, anthocyanidin is glycosylated by UFGT to form a stable anthocyanin, cyanidin-3-glucoside. Through these enzymatic reactions, p-Coumaric acid connects Flavonoid Biosynthesis to the biosynthesis of anthocyanins and flavonoids, directly influencing flower color variation in plants (<xref ref-type="bibr" rid="B8">Fatihah et&#xa0;al., 2022</xref>).</p>
<p>In the comparison between <italic>L. cernuum</italic> and <italic>L. cernuum</italic> var. <italic>album</italic>, five metabolites&#x2014;Catechin, Chlorogenic acid, Epicatechin, Neohesperidin, and Prunin&#x2014;were found to decrease in the Flavonoid Biosynthesis pathway in <italic>L. cernuum</italic> var. <italic>album</italic>. These metabolites are closely related to color changes, with Catechin and Epicatechin being intermediates in the anthocyanin synthesis pathway that directly affect anthocyanin accumulation and color expression (<xref ref-type="bibr" rid="B42">Xiong et&#xa0;al., 2013</xref>). Chlorogenic acid not only acts as a precursor in anthocyanin synthesis but also may regulate color stability through its antioxidant properties (<xref ref-type="bibr" rid="B47">Ye et&#xa0;al., 2019</xref>). Neohesperidin and Prunin participate in the synthesis of flavonoids and flavonols, influencing the hue and intensity of flower color (<xref ref-type="bibr" rid="B51">Zhou et&#xa0;al., 2022</xref>). Correspondingly, 58 genes were downregulated in the Flavonoid Biosynthesis pathway, including key genes involved in the entire anthocyanin and flavonoid synthesis process, such as CHS, CHI, F3H, and FLS. The downregulation of these genes directly resulted in a reduced synthesis of anthocyanins and flavonoids, further impacting the Anthocyanin Biosynthesis pathway. &#x201c;Through the study of flower development stages in white-flowered Lilium longiflorum, the results showed that the absence of two structural genes, F3H and DFR, as well as the bHLH2 transcription factor, led to the inability or insufficient synthesis of anthocyanins. This is similar to the findings of this study (<xref ref-type="bibr" rid="B8">Fatihah et&#xa0;al., 2022</xref>).</p>
<p>In the Anthocyanin Biosynthesis pathway, the levels of three metabolites&#x2014;Cyanidin, Pelargonidin, and Peonidin&#x2014;were found to decrease. These metabolites play crucial roles in the coloration of flowers, with Cyanidin associated with red and purple, Pelargonidin with orange or red, and Peonidin with purple-red (<xref ref-type="bibr" rid="B39">Wang et&#xa0;al., 2023</xref>). The reduction in these metabolites directly led to the transformation of the purple-red flowers of <italic>L. cernuum</italic> into white. These metabolites are substrates of UFGT, and in the Anthocyanin Biosynthesis pathway, five out of seven downregulated genes belong to UFGT, indicating that the glycosylation process of anthocyanins was inhibited. This inhibition likely caused anthocyanins to degrade or convert into other colorless compounds, preventing their accumulation in petal cell vacuoles, leading to the weakening or loss of color (<xref ref-type="bibr" rid="B41">Wu et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B28">Muhammad et&#xa0;al., 2022</xref>). Although Delphinidin levels increased in this pathway, it did not exhibit color, possibly due to its poor thermal stability. Some studies suggest that an increased number of substituents on the &#x3b2;-ring reduces thermal stability. Delphinidin contains three hydroxyl substituents and is considered less stable (<xref ref-type="bibr" rid="B35">Sinela et&#xa0;al., 2017</xref>), while Pelargonidin, with only one hydroxyl substituent, is regarded as the most stable aglycone (<xref ref-type="bibr" rid="B11">Fleschhut et&#xa0;al., 2006</xref>). In the study of Lilium chinense var. rubrum, it was found that the high expression level of the UFGT gene in pink leaves was consistent with the stable formation of anthocyanins. The UFGT gene directly participates in the stable synthesis process of anthocyanins (<xref ref-type="bibr" rid="B48">Zhang et&#xa0;al., 2022</xref>).</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusion</title>
<p>This study comprehensively analyzed the transcriptomic, metabolomic, and volatolomic data of <italic>L. cernuum</italic> var. <italic>album</italic> and <italic>L. cernuum</italic>, revealing the molecular mechanisms underlying the coordinated changes in flower color and fragrance. The experimental results indicate that the pure white color and subtle fragrance of <italic>L. cernuum</italic> var. <italic>album</italic> are primarily attributed to the low expression of key genes in the Phenylpropanoid Pathway and the reduction in related metabolites. Metabolomic analysis showed that the flavonoid and anthocyanin content in <italic>L. cernuum</italic> var. <italic>album</italic> was significantly lower than in <italic>L. cernuum</italic>. This difference is driven by the downregulation of multiple key genes in the Phenylpropanoid Pathway, including PAL, C4H, and 4CL, which led to decreased accumulation of p-Coumaric acid, subsequently affecting the synthesis of downstream anthocyanins and volatile organic compounds. In terms of volatile metabolites, the contents of Eugenol and Methyleugenol were significantly lower in <italic>L. cernuum</italic> var. <italic>album</italic> compared to <italic>L. cernuum</italic>, indicating a weakening or alteration of fragrance. This reduction in volatile organic compounds is closely related to the downregulated expression of genes in the Phenylpropanoid Pathway.</p>
<p>Moreover, in <italic>L. cernuum</italic> var. <italic>album</italic>, the decreased content of metabolites such as Catechin, Chlorogenic acid, Epicatechin, Neohesperidin, and Prunin in the Flavonoid Biosynthesis pathway also contributed to the weakening of flower color. Specifically, the reduced levels of the intermediate metabolites Catechin and Epicatechin in the anthocyanin synthesis pathway likely directly impacted anthocyanin accumulation and color expression. Gene expression data further support this view, as 58 genes involved in the Flavonoid Biosynthesis pathway were downregulated in <italic>L. cernuum</italic> var. <italic>album</italic>, affecting the entire process of anthocyanin and flavonoid synthesis. The downregulation of these genes led to a reduction in the synthesis of anthocyanins and flavonoids, which in turn affected flower color. In the Anthocyanin Biosynthesis pathway, the contents of Cyanidin, Pelargonidin, and Peonidin were significantly reduced in <italic>L. cernuum</italic> var. <italic>album</italic>, directly explaining the color change from purple-red to white. Particularly, the downregulation of the UFGT gene inhibited the glycosylation process of anthocyanin molecules, leading to their degradation or conversion into other colorless compounds.</p>
<p>In summary, this study elucidated the reasons behind the differences in flower color and fragrance between <italic>L. cernuum</italic> var. <italic>album</italic> and <italic>L. cernuum</italic> through detailed analysis of gene expression and metabolite changes. The expression levels of key genes in the Phenylpropanoid Pathway determined the synthesis of p-Coumaric acid and its downstream metabolites, thereby influencing the coordinated changes in flower color and fragrance. These findings provide an important theoretical foundation for further understanding the molecular regulatory mechanisms of flower color and scent and offer valuable insights for the breeding and improvement of superior lily cultivars.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, Further inquiries can be directed to the corresponding author/s.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>SC: Writing &#x2013; original draft. ZC: Methodology, Writing &#x2013; original draft. QZ: Data curation, Writing &#x2013; review &amp; editing. HC: Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This work was financially supported by Science and Technology Project of the Jilin Provincial Education Department (Grant No. JJKH20230457KJ), Jilin Agricultural Science and Technology University Student Science and Technology Innovation and Entrepreneurship Training Program (Grant No. GJ202411439004) and Natural Science Foundation of Jilin Province (Grant No. YDZJ202201ZYTS454).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We thank Xinjie He (Jilin Agricultural Science and Technology University) for providing help in the experiments.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Allan</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Hellens</surname> <given-names>R. P.</given-names>
</name>
<name>
<surname>Laing</surname> <given-names>W. A.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>MYB transcription factors that colour our fruit</article-title>. <source>Trends Plant Sci.</source> <volume>13</volume>, <fpage>99</fpage>&#x2013;<lpage>102</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tplants.2007.11.012</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bergman</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Kortbeek</surname> <given-names>R. W. J.</given-names>
</name>
<name>
<surname>Gutensohn</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Dudareva</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Plant terpenoid biosynthetic network and its multiple layers of regulation</article-title>. <source>Prog. Lipid Res.</source> <volume>95</volume>, <elocation-id>101287</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plipres.2024.101287</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bulanov</surname> <given-names>A. N.</given-names>
</name>
<name>
<surname>Andreeva</surname> <given-names>E. A.</given-names>
</name>
<name>
<surname>Tsvetkova</surname> <given-names>N. V.</given-names>
</name>
<name>
<surname>Zykin</surname> <given-names>P. A.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Regulation of flavonoid biosynthesis by the MYB-bHLH-WDR (MBW) complex in plants and its specific features in cereals</article-title>. <source>Int. J. Mol. Sci.</source> <volume>26</volume>, <elocation-id>734</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms26020734</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cho</surname> <given-names>H. J.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>G. H.</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Differential gene expression and epigenetic analyses between striped and blushed skinned sports of &#x2018;Fuji&#x2019; apple</article-title>. <source>Sci. Hortic.</source> <volume>261</volume>, <elocation-id>108944</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2019.108944</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chung</surname> <given-names>M. Y.</given-names>
</name>
<name>
<surname>Chung</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>L&#xf3;pez-Pujol</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>M.-X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z.-Y.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>S. J.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Were the main mountain ranges in the Korean Peninsula a glacial refugium for plants? Insights from the congeneric pair <italic>Lilium cernuum&#x2013;Lilium amabile</italic>
</article-title>. <source>Biochem. Syst. Ecol.</source> <volume>53</volume>, <fpage>36</fpage>&#x2013;<lpage>45</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bse.2013.12.019</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Du</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Bi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Xue</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>The complete chloroplast genome of <italic>Lilium cernuum</italic>: genome structure and evolution</article-title>. <source>Conserv. Genet. Resour.</source> <volume>8</volume>, <fpage>375</fpage>&#x2013;<lpage>378</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12686-016-0562-7</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Enaru</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Dre&#x163;canu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Pop</surname> <given-names>T. D.</given-names>
</name>
<name>
<surname>St&#x103;ni&#x103;</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Diaconeasa</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Anthocyanins: factors affecting their stability and degradation</article-title>. <source>Antioxid. (Basel)</source> <volume>10</volume>, <fpage>1967</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/antiox10121967</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fatihah</surname> <given-names>H. N. N.</given-names>
</name>
<name>
<surname>Wolinska</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Schaart</surname> <given-names>J. G.</given-names>
</name>
<name>
<surname>Oortwijn</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Visser</surname> <given-names>R. G. F.</given-names>
</name>
<name>
<surname>Krens</surname> <given-names>F. A.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Expression of anthocyanin biosynthesis-related genes during flower development in Lilium spp</article-title>. <source>Plant Gene</source> <volume>31</volume>, <elocation-id>100372</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plgene.2022.100372</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Qiu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Jian</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Comparative transcriptomic and metabonomic analysis revealed the relationships between biosynthesis of volatiles and flavonoid metabolites in <italic>Rosa rugosa</italic>
</article-title>. <source>Ornam. Plant Res.</source> <volume>1</volume>, <fpage>1</fpage>&#x2013;<lpage>10</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.48130/OPR-2021-0005</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Gas chromatography-mass spectrometry analysis of floral fragrance-related compounds in scented rose (<italic>Rosa hybrida</italic>) varieties and a subsequent evaluation on the basis of the analytical hierarchy process</article-title>. <source>Plant Physiol. Biochem.</source> <volume>185</volume>, <fpage>368</fpage>&#x2013;<lpage>377</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plaphy.2022.06.007</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fleschhut</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kratzer</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Rechkemmer</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Kulling</surname> <given-names>S. E.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Stability and biotransformation of various dietary anthocyanins in <italic>vitro</italic>
</article-title>. <source>Eur. J. Nutr.</source> <volume>45</volume>, <fpage>7</fpage>&#x2013;<lpage>18</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00394-005-0557-8</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Ghissing</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Mitra</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2022</year>). &#x201c;<article-title>Biology of floral scent volatiles in ornamental plants</article-title>,&#x201d; in <source>Floriculture and Ornamental Plants</source>. Eds. <person-group person-group-type="editor">
<name>
<surname>Datta</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Gupta</surname> <given-names>Y. C.</given-names>
</name>
</person-group> (<publisher-name>Springer Nature Singapore</publisher-name>, <publisher-loc>Singapore</publisher-loc>), <fpage>777</fpage>&#x2013;<lpage>817</lpage>.</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hong</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Dai</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Ectopic expression of multiple chrysanthemum (<italic>Chrysanthemum &#xd7; morifolium</italic>) R<sub>2</sub>R<sub>3</sub>-MYB transcription factor genes regulates anthocyanin accumulation in tobacco</article-title>. <source>Genes (Basel)</source> <volume>10</volume>, <elocation-id>777</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/genes10100777</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Inada</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Oyama-Okubo</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Yamagishi</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Introduction of Floral Scent Traits into Asiatic Hybrid Lilies (Unscented) by Crossbreeding with <italic>Lilium cernuum</italic> (Scented)</article-title>. <source>Horticult. J.</source> <volume>92</volume>, <fpage>485</fpage>&#x2013;<lpage>492</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2503/hortj.QH-066</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jaakola</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>New insights into the regulation of anthocyanin biosynthesis in fruits</article-title>. <source>Trends Plant Sci.</source> <volume>18</volume>, <fpage>477</fpage>&#x2013;<lpage>483</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tplants.2013.06.003</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Johnson</surname> <given-names>T. S.</given-names>
</name>
<name>
<surname>Schwieterman</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>J. Y.</given-names>
</name>
<name>
<surname>Cho</surname> <given-names>K. H.</given-names>
</name>
<name>
<surname>Clark</surname> <given-names>D. G.</given-names>
</name>
<name>
<surname>Colquhoun</surname> <given-names>T. A.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>
<italic>Lilium</italic> floral fragrance: A biochemical and genetic resource for aroma and flavor</article-title>. <source>Phytochemistry</source> <volume>122</volume>, <fpage>103</fpage>&#x2013;<lpage>112</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.phytochem.2015.11.010</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Razzaq</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sattar</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Ahmed</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Habibullah Khan</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zubair Ghouri</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Understanding floral biology for CRISPR-based modification of color and fragrance in horticultural plants</article-title>. <source>F1000Research</source> <volume>11</volume>, <fpage>854</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.12688/f1000research</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumari</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Panwar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Soni</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Soni</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Biosynthesis, composition and sources of floral scent in ornamental crops: a review</article-title>. <source>Chem. Sci. Rev. Lett.</source> <volume>6</volume>, <fpage>1502</fpage>&#x2013;<lpage>1509</lpage>.</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Shan</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Integrated volatile metabolomic and transcriptomic analysis provides insights into the regulation of floral scents between two contrasting varieties of <italic>Lonicera japonica</italic>
</article-title>. <source>Front. Plant Sci.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2022.989036</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y. H.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>H. Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q. L.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Investigation and cultivation of <italic>Lilium cernuum</italic> from Northeast China</article-title>. <source>Acta Hortic.</source> <volume>1027</volume>, <fpage>55</fpage>&#x2013;<lpage>64</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.17660/ActaHortic.2014.1027.5</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>The flavonoid biosynthesis network in plants</article-title>. <source>Int. J. Mol. Sci.</source> <volume>22</volume>, <elocation-id>12824</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms222312824</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lo</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Benfodda</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>B&#xe9;nim&#xe9;lis</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Fontaine</surname> <given-names>J. X.</given-names>
</name>
<name>
<surname>Molini&#xe9;</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Meffre</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Extraction and identification of volatile organic compounds emitted by fragrant flowers of three <italic>Tillandsia</italic> species by HS-SPME/GC-MS</article-title>. <source>Metabolites</source> <volume>11</volume>, <elocation-id>594</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/metabo11090594</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lv</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Floral volatile benzenoids/phenylpropanoids: biosynthetic pathway, regulation and ecological value</article-title>. <source>Hortic. Res.</source> <volume>11</volume>, <elocation-id>uhae220</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/hr/uhae220</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname> <given-names>K. F.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q. X.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>T. R.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>X. L.</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>H. T.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Substantial epigenetic variation causing flower color chimerism in the ornamental tree <italic>Prunus mume</italic> revealed by single base resolution methylome detection and transcriptome sequencing</article-title>. <source>Int. J. Mol. Sci.</source> <volume>19</volume>, <elocation-id>2315</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms19082315</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>MacRae</surname> <given-names>E. A.</given-names>
</name>
</person-group> (<year>1998</year>). <source>Lilies: A guide for growers and collectors</source> (<publisher-loc>Portland, OR</publisher-loc>: <publisher-name>Timber Press Inc</publisher-name>).</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meng</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Analysis of floral fragrance compounds of <italic>Chimonanthus praecox</italic> with different floral colors in Yunnan, China</article-title>. <source>Separations</source> <volume>8</volume>, <fpage>122</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/separations8080122</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mostafa</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Floral scents and fruit aromas: functions, compositions, biosynthesis, and regulation</article-title>. <source>Front. Plant Sci.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2022.860157</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Muhammad</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>The joint role of the late anthocyanin biosynthetic UFGT-encoding genes in the flowers and fruits coloration of horticultural plants</article-title>. <source>Sci. Hortic.</source> <volume>301</volume>, <fpage>111110</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2022.111110</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>N&#xf8;rb&#xe6;k</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Kondo</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Anthocyanins from flowers of lilium (Liliaceae)</article-title>. <source>Phytochemistry</source> <volume>50</volume>, <fpage>1181</fpage>&#x2013;<lpage>1184</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0031-9422(98)00661-X</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Picazo-Aragon&#xe9;s</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Terrab</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Balao</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Plant volatile organic compounds evolution: transcriptional regulation, epigenetics and polyploidy</article-title>. <source>Int. J. Mol. Sci.</source> <volume>21</volume>, <elocation-id>8956</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms21238956</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sakai</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yamagishi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Matsuyama</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Repression of anthocyanin biosynthesis by R3-MYB transcription factors in lily (<italic>Lilium</italic> spp.)</article-title>. <source>Plant Cell Rep.</source> <volume>38</volume>, <fpage>609</fpage>&#x2013;<lpage>622</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00299-019-02391-4</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shah</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rastogi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Vashisth</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Rout</surname> <given-names>P. K.</given-names>
</name>
<name>
<surname>Lal</surname> <given-names>R. K.</given-names>
</name>
<name>
<surname>Lavania</surname> <given-names>U. C.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Altered developmental and metabolic gene expression in basil interspecific hybrids</article-title>. <source>Plants (Basel)</source> <volume>11</volume>, <elocation-id>1873</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/plants11141873</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shan</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>A functional homologue of Arabidopsis TTG1 from Freesia interacts with bHLH proteins to regulate anthocyanin and proanthocyanidin biosynthesis in both Freesia hybrida and Arabidopsis thaliana</article-title>. <source>Plant Physiol. Biochem.</source> <volume>141</volume>, <fpage>60</fpage>&#x2013;<lpage>72</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plaphy.2019.05.015</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Du</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Anthocyanin synthesis and the expression patterns of bHLH transcription factor family during development of the Chinese jujube fruit (<italic>Ziziphus jujuba</italic> Mill.)</article-title>. <source>Forests</source> <volume>10</volume>, <fpage>346</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/f10040346</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sinela</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Rawat</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Mertz</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Achir</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Fulcrand</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Dornier</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Anthocyanins degradation during storage of <italic>Hibiscus sabdariffa</italic> extract and evolution of its degradation products</article-title>. <source>Food Chem.</source> <volume>214</volume>, <fpage>234</fpage>&#x2013;<lpage>241</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2016.07.071</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Viswanath</surname> <given-names>K. K.</given-names>
</name>
<name>
<surname>Varakumar</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Pamuru</surname> <given-names>R. R.</given-names>
</name>
<name>
<surname>Basha</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Mehta</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rao</surname> <given-names>A. D.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Plant lipoxygenases and their role in plant physiology</article-title>. <source>J. Plant Biol.</source> <volume>63</volume>, <fpage>83</fpage>&#x2013;<lpage>95</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12374-020-09241-x</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Ran</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Dou</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>R<sub>2</sub>R<sub>3</sub>-MYB transcription factor MYB6 promotes anthocyanin and proanthocyanidin biosynthesis but inhibits secondary cell wall formation in <italic>Populus tomentosa</italic>
</article-title>. <source>Plant J.</source> <volume>99</volume>, <fpage>733</fpage>&#x2013;<lpage>751</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/tpj.14364</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yamagishi</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Mechanisms suppressing carotenoid accumulation in flowers differ depending on the hybrid groups of lilies (<italic>Lilium</italic> spp.)</article-title>. <source>Sci. Hortic.</source> <volume>243</volume>, <fpage>159</fpage>&#x2013;<lpage>168</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2018.08.025</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Functional identification of anthocyanin glucosyltransferase genes: a Ps3GT catalyzes pelargonidin to pelargonidin 3-O-glucoside painting the vivid red flower color of Paeonia</article-title>. <source>Planta</source> <volume>257</volume>, <fpage>65</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00425-023-04095-2</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wei</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Comprehensive flavor analysis of volatile components during the vase period of cut lily (<italic>Lilium</italic> spp. &#x2018;Manissa&#x2019;) flowers by HS-SPME/GC-MS combined with E-nose technology</article-title>. <source>Front. Plant Sci.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2022.822956</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Ni</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>UFGT: the key enzyme associated with the petals variegation in Japanese apricot</article-title>. <source>Front. Plant Sci.</source> <volume>8</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2017.00108</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiong</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>Dynamic changes in catechin levels and catechin biosynthesis-related gene expression in albino tea plants (<italic>Camellia sinensis</italic> L.)</article-title>. <source>Plant Physiol. Biochem.</source> <volume>71</volume>, <fpage>132</fpage>&#x2013;<lpage>143</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plaphy.2013.06.019</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Khalil-Ur-Rehman</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Tao</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Comparison among &#x2018;Benitaka&#x2019; grape, ABA-treated &#x2018;Benitaka&#x2019;, and its deeper-colored bud mutation revealed the coloring mechanisms on grapes</article-title>. <source>J. Plant Interact.</source> <volume>14</volume>, <fpage>102</fpage>&#x2013;<lpage>109</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/17429145.2018.1547843</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamagishi</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>White with partially pink flower color in <italic>Lilium cernuum</italic> var. album is caused by transcriptional regulation of anthocyanin biosynthesis genes</article-title>. <source>Sci. Hortic.</source> <volume>260</volume>, <elocation-id>108880</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2019.108880</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamagishi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ihara</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Arakawa</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Toda</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>The origin of the <italic>LhMYB12</italic> gene, which regulates anthocyanin pigmentation of tepals, in Oriental and Asiatic hybrid lilies (<italic>Lilium</italic> spp.)</article-title>. <source>Sci. Hortic.</source> <volume>174</volume>, <fpage>119</fpage>&#x2013;<lpage>125</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2014.05.017</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamagishi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yoshida</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Nakayama</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The transcription factor LhMYB12 determines anthocyanin pigmentation in the tepals of Asiatic hybrid lilies (<italic>Lilium</italic> spp.) and regulates pigment quantity</article-title>. <source>Mol. Breed.</source> <volume>30</volume>, <fpage>913</fpage>&#x2013;<lpage>925</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11032-011-9675-6</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ye</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Comparative transcriptome analysis to identify candidate genes related to chlorogenic acid biosynthesis in Eucommia ulmoides Oliv</article-title>. <source>Trees</source> <volume>33</volume>, <fpage>1373</fpage>&#x2013;<lpage>1384</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00468-019-01865-y</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Transcriptome analysis and metabolic profiling of anthocyanins accumulation in loropetalum Chinense var</article-title>. <source>Rubrum With Diff. Colors Leaf</source>. doi:&#xa0;<pub-id pub-id-type="doi">10.21203/rs.3.rs-960260/v1</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Transcriptome and volatile compounds profiling analyses provide insights into the molecular mechanism underlying the floral fragrance of tree peony</article-title>. <source>Ind. Crops Prod.</source> <volume>162</volume>, <elocation-id>113286</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.indcrop.2021.113286</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jiao</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Rosli</surname> <given-names>H. G.</given-names>
</name>
<name>
<surname>Pombo</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>iTAK: A program for genome-wide prediction and classification of plant transcription factors, transcriptional regulators, and protein kinases</article-title>. <source>Mol. Plant</source> <volume>9</volume>, <fpage>1667</fpage>&#x2013;<lpage>1670</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.molp.2016.09.014</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>He</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhuge</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Different color regulation mechanism in willow barks determined using integrated metabolomics and transcriptomics analyses</article-title>. <source>BMC Plant Biol.</source> <volume>22</volume>, <fpage>530</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12870-022-03909-x</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname> <given-names>H. H.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>J. X.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>C. H.</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>T. Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H. Y.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Differences in flavonoid pathway metabolites and transcripts affect yellow petal colouration in the aquatic plant <italic>Nelumbo nucifera</italic>
</article-title>. <source>BMC Plant Biol.</source> <volume>19</volume>, <fpage>277</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12870-019-1886-8</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>