Throughout the current study, the sensitive commercial cultivar Giza 3 of common bean (Phaseolus vulgaris L. cv. Giza 3) was used as an experimental plant material. Healthy seeds were generously provided by the Department of Food Legumes Research, Field Crops Research Institute (FCRI), Agricultural Research Center (ARC), Egypt. Five seeds were sown in plastic pots (35 cm inner diameter and 50 cm in depth) filled with S. sclerotiorum-infested soil under greenhouse conditions (25 ± 2°C, 75 ± 1% RH, and 8 h light/16 h dark photoperiod). However, 7-10 days post-sowing (dps), seedlings were thinned and only two uniform seedlings with fully expanded trifoliate leaves were left in each pot. All pots were irrigated every other week and fertilized monthly according to the recommendations for this cultivar.

To prepare a 500 mg/L stock solution of the diamine _L-ornithine (also known as (+)-(S)-2,5-Diaminovaleric acid; Sigma-Aldrich, Darmstadt, Germany), 50 mg was initially dissolved in a final volume of 100 mL sterilized distilled water. Subsequently, the stock solution has been diluted and used for subsequent experiments. Briefly, six serial concentrations of _L-ornithine (12.5, 25, 50, 75, 100, and 125 mg/L) were tested in vitro individually. Besides, sterilized distilled water was used as a negative control (Mock), whereas the commercial fungicide ‘Rizolex-T’ 50% WP (Tolclofos-Methyl 20% + Thiram 30%; KZ–Kafr El Zayat Pesticides and Chemicals, Kafr El-Zayat, Gharbia, Egypt) was used as a positive control. Five concentrations of the commercial fungicide ‘Rizolex-T’ were tested in vitro (2, 4, 6, 8, and 10 mg/L).

Samples of common bean stems and pods showing typical symptoms of white mold (disease severity: 10-30%) were collected from commercial farms. While most of the infected plant materials were identified by variety/cultivar (the sensitive commercial cultivar Giza 3), others, particularly those obtained from local markets, were of unknown variety. Initially, collected infected materials were surface sterilized with 0.5% NaOCl for three min, then washed several times using sterilized distilled water, and dried between sterilized filter papers to remove the extra water. Subsequently, infected organs were chopped into small pieces from the intermediate tissues (between healthy and infected ones), cultured on potato dextrose agar (PDA) medium, and incubated at 25 ± 2°C for 5 days under 12-hour light/12-hour dark cycles to encourage sclerotia formation. The hyphal tips method was also used to purify the fungal isolates from the mixed or contaminated cultures. The purified fungal isolates were first identified based on their cultural morphology characteristics, and then the identification was confirmed using microscopic features as S. sclerotiorum. Finally, the pathogenicity of all purified isolates was tested on the sensitive commercial cultivar Giza 3 of common bean to fulfill Koch’s postulates.

Moreover, the identification of the most aggressive isolate of S. sclerotiorum (isolate #3) was further confirmed based on the sequencing of the Internal transcribed spacer (ITS) region as described by (White et al., 1990; Baturo-Ciesniewska et al., 2017). Briefly, the isolate was grown on potato dextrose broth (PDB) and incubated at 25 ± 2°C for 5-7 days. Then, the fungal mycelium was harvested, filtered through cheesecloth, washed twice with sterile water, and dried using sterile filter paper. The genomic DNA was extracted using a Quick-DNA™ Fungal/Bacterial Miniprep Kit (Kuramae-Izioka, 1997; Atallah et al., 2022, 2024). Subsequently, ITS of the rDNA was amplified using a specific primer pair ITS1/ITS4 (TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC; Expected size: 540 bp) (Baturo-Ciesniewska et al., 2017). The purified PCR product was sent for sequencing (Aoke Dingsheng Biotechnology Co., Beijing, China). Sanger sequencing was used to perform the two-directional sequencing of the ITS rDNA sequence. Subsequently, a Nucleotide-Nucleotide Basic Local Alignment Search Tool (BLASTn) was used to compare the assembled query sequence with the most recent available data in GenBank and the National Center for Biotechnology Information website (NCBI, http://www.ncbi.nlm.nih.gov/gene/). Alignment was carried out using ClustalW through the Molecular Evolutionary Genetics Analysis software package (MEGA-11; version 11) (Kumar et al., 2024) to align the query sequence with other 20 Sclerotinia strains/isolates retrieved from the recently available data in NCBI GenBank ( Supplementary Table S1 ). Evolutionary analysis was inferred using the Maximum Likelihood method and General Time Reversible model (Nei and Kumar, 2000) of nucleotide substitutions, and the tree with the highest log likelihood was shown. The initial tree for the heuristic search was selected by choosing the tree with the superior log-likelihood between a Neighbor-Joining (NJ) tree (Kumar et al., 2024) and a Maximum Parsimony (MP) tree. The NJ tree was generated using a matrix of pairwise distances computed using the General Time Reversible model (Nei and Kumar, 2000).

The antifungal activities of _L-ornithine, as well as the ‘Rizolex-T’ fungicide, were tested in vitro using the agar diffusion method. Briefly, a proper volume of _L-ornithine stock solution (500 mg/L) was finely mixed with 10 mL PDA medium to obtain the final concentration of 12.5, 25, 50, 75, 100, and 125 mg/L. Moreover, five concentrations of ‘Rizolex-T’ fungicide (2, 4, 6, 8, and 10 mg/L) and sterilized distilled water were used as controls. After media solidification, a 4 mm-diameter mycelial plug of freshly prepared culture of S. sclerotiorum was transferred into the middle of the petri dish, incubated at 25 ± 2°C until the mycelial growth covered the whole control plate, then the fungal growth was recorded. The percentage of radial growth inhibition of S. sclerotiorum was calculated using Equation 1:

The experiment was repeated twice with six biological replicates per control/treatment and five pots (two plants per pot) for each biological replicate. Each biological replicate was analyzed twice (two technical replicates) to ensure the accuracy, reliability, and reproducibility of our experimental findings. Additionally, the half-maximal inhibitory concentration (IC₅₀) and IC₉₉ were calculated using probit regression analysis (Prentice, 1976).

Two successive pot experiments were carried out to evaluate the potential of _L-ornithine under greenhouse conditions. Briefly, pots were filled with sterilized clay-sandy soil (3:1) and inoculated with a freshly prepared culture of S. sclerotiorum. Initially, actively growing cultures of the most aggressive isolate of S. sclerotiorum (isolate #3) were produced by bisecting a sclerotium, placing it face down on PDA, and incubating at 25°C for 4 days under continuous darkness (24 h) to encourage mycelial growth. Then, four 5-mm diameter agar plugs from the leading edge were used to inoculate 100 g of a sterile mixture of wheat and rice bran (1:1, v/v), then all flasks were incubated at 25 ± 2°C for 5 days under 12-hour light/12-hour dark cycles to encourage sclerotia formation. Prior to the soil inoculation, all flasks were thoroughly mixed to ensure homogeneity. Subsequently, 100 g of the colonized bran mixture was used to inoculate each pot to ensure consistent pathogen concentration. Inoculated pots were directly watered to activate fungal growth and left under greenhouse conditions for 7 days.

Later, five seeds of the cultivar Giza 3 were sown in each pot. For _L-ornithine- and ‘Rizolex-T’ fungicide-treated pots, disinfected seeds were initially soaked in aqueous solutions of both compounds at a final concentration of the IC₉₉ (about 250 mg/L, and 50 mg/L, respectively) for two hours, then air-dried for one-hour before sowing. On the other hand, seeds were soaked in sterilized distilled water as a negative control. At 10 dps and right before the first irrigation, seedlings were thinned and only two uniform seedlings were left in each pot. Furthermore, to warrant the infection with S. sclerotiorum stems of bean plants at the same developmental stage (10 dps) were cut in two different positions using a sterilized scalpel, and approximately 0.5 g of the colonized bran mixture was placed into each wound, then a high level of humidity was maintained to encourage infection and disease development for all inoculated plants. A similar wounding procedure was performed on the control plants and the same amount (0.5 g) of the sterile non-colonized bran mixture was placed into the wounds and maintained under high humidity conditions to simulate the environment for disease development, ensuring consistency between the treatments.

For treatments, bean seedlings were watered via soil drench with 500 mL of aqueous solutions of _L-ornithine (250 mg/L) or ‘Rizolex-T’ fungicide (50 mg/L), then the treatment was repeated three times in total at 10 days intervals. Mock-treated control was irrigated with 500 mL of sterilized distilled water. All treatments were maintained under the greenhouse conditions (25 ± 2°C, 75 ± 1% RH, and 8 h light/16 h dark photoperiod). All pots were irrigated every other week and fertilized monthly using a balanced NPK fertilizer (20-20-20, in addition to 3.6% Sulfur and Microelements TE; Zain Seeds, Egypt) at a concentration of 3-4 g/L, applied via foliar spray according to the recommendations for this cultivar and the manufacturer’s instructions. Unless otherwise mentioned, the fully expanded, mature leaves (2^nd and 3^rd leaves from the top) were collected at 72 hours post-treatment (hpt) from each biological replicate, homogenized, mixed, and stored at −80°C for further analyses including, but not limited to, in situ histochemical localization of oxidative stress indicators, lipid peroxidation, enzymatic and non-enzymatic antioxidants, and gene expression.

The severity of white mold disease was evaluated weekly till 21 days post-inoculation (dpi) using a 1-9 scale ( Supplementary Table S2 ) according to Petzoldt and Dickson scale (Petzoldt and Dickson, 1996) as modified by Terán et al. (2006). Briefly, the stem and branches of the bean plant were examined starting from the inoculated site and observed for lesion progression along the internodes and nodes. Then, the distance of the lesion from the point of inoculation to its furthest point along the stem or branch was measured and a 1-9 score (based on the lesion position) was assigned, where a score (1) was assigned for no visible infection near the inoculant site, whereas scores (2-9) were assigned to progressively increasing lesion size and advancement across nodes/internodes ( Supplementary Table S2 ). Subsequently, the severity of white mold disease was converted into a percentage using Equation 2:

Moreover, the area under the disease progress curve (AUDPC) was calculated according to (Shaner and Finney, 1977) which was recently adapted for the white mold disease in the common bean (Chauhan et al., 2020) using Equation 3:-

Where, Y_i = Disease severity at time t_i , Y_i+1 = Disease severity at the next time point t_i+1 , t_i = Time of the first measurement (in days), t_i+1 = Time of the next measurement (in days), and n = Total number of time points or observations. Vegetative parameters of bean plants including plant height (cm), number of branches per plant, and number of leaves per plant were recorded weekly for 21 days for all biological replicates.

Leaf samples (2^nd and 3^rd fully developed leaves from the top) were collected at 45 dps (15 days post-last treatment) from each biological replicate. Each biological replicate contains five pots (two plants per pot). Approximately 500 mg of ground tissues were used to extract the photosynthetic pigments (chlorophyll a, chlorophyll b, and carotenoids) using 80% acetone in the dark at 4°C. After 24 hours, samples were centrifuged and the supernatant was collected and the chlorophyll a, chlorophyll b, and carotenoids contents were colorimetrically assessed by measuring the absorbance at three different wavelengths (A₄₇₀, A₆₄₆, and A₆₆₃ nm) using a UV-160A spectrophotometer (Shimadzu, Japan) as described by (Lichtenthaler, 1987). Finally, the content of photosynthetic pigments was calculated using the following Equations 4–6 as described by Lichtenthaler (1987).

For the assessment of non-enzymatic and enzymatic antioxidants, leaves (2^nd and 3^rd fully developed leaves from the top) were collected from each biological replicate at 72 hours post-treatment (hpt). Each biological replicate contains five pots (two plants per pot). Each biological replicate was analyzed twice (two technical replicates). Both leaves were ground together using liquid nitrogen and subjected directly for the analysis of enzymatic, and non-enzymatic antioxidants, total amino acids, proline content, gene expression, and the quantification of oxalic acid.

The total free amino acids in bean leaves were determined using a modified ninhydrin (Thermo Scientific Chemicals, Waltham, MA, USA) reagent, as described by Yokoyama and Hiramatsu (2003) and improved by (Sun et al., 2006). Briefly, 0.1 g of ground tissues were extracted with a pH 5.4 buffer, and then 200 μL of the supernatant was reacted with 200 μL of ninhydrin (2%) and 200 μL of pyridine (10%; Spectrum Chemical, New Brunswick, NJ, USA), incubated for 30 min in a boiling-water water bath, then cooled, and measured at 580 nm using a UV-160A spectrophotometer (Shimadzu, Japan). On the other hand, proline was determined using Bates’s method (Bates et al., 1973). Proline was extracted with 3% sulfosalicylic acid (Thermo Scientific Chemicals, Waltham, MA, USA), centrifuged, and then 0.5 mL of the supernatant was mixed with one mL of glacial acetic acid (Fisher Scientific, Hampton, NH, USA) and ninhydrin reagent, then incubated at 90°C for 45 min, then cooled, and measured at 520 nm using the same spectrophotometer described above. Calibration curves of glycine and proline (Sigma–Aldrich, Saint Louis, MO, USA) standards were used to determine the total free amino acids and proline content, respectively, in the leaves extract and expressed as mg g⁻¹ FW.

To determine the enzymatic activity of antioxidant-associated enzymes, about 500 mg of homogenized tissues were extracted using 3 mL of 50 mM Tris buffer (pH 7.8) containing 1 mM EDTA-Na₂ (Sigma–Aldrich, Saint Louis, MO, USA) and 7.5% polyvinylpyrrolidone (PVP; Sigma–Aldrich, Saint Louis, MO, USA), centrifuged at 10000× g for 20 min under cooling (4°C), and the supernatant (crude enzyme extract) was collected (El-Nagar et al., 2023; Osman et al., 2023). Subsequently, the enzymatic activity of catalase (CAT) was assessed according to the method of Aebi (1984) with slight modifications (El-Nagar et al., 2023; Osman et al., 2023) after the reaction with 2 mL of 0.1 M sodium phosphate buffer (pH 6.5; Sigma–Aldrich, Saint Louis, MO, USA) and 100 μL of 269 mM H₂O₂ solution. The enzymatic activity of guaiacol-dependent peroxidases (POX) was determined using the method of Harrach et al. (2008) with slight modifications (El-Nagar et al., 2023; Osman et al., 2023) after the reaction with 2.2 mL of 100 mM sodium phosphate buffer (pH 6.0), 100 µL guaiacol (TCI chemicals, Portland, OR, USA), and 100 µL of 12 mM H₂O₂. Whereas the enzymatic activity of polyphenol oxidase (PPO) was determined according to the method of Malik and Singh (1980) with slight modifications (El-Nagar et al., 2023; Osman et al., 2023). After the reaction with 3 mL catechol (Thermo Scientific Chemicals, Waltham, MA, USA) solution (0.01 M), freshly prepared in 0.1 M phosphate buffer (pH 6.0). CAT activity was measured by following the decomposition of H₂O₂ at 240 nm (A₂₄₀), POX activity was measured by following the increase in the absorption at 436 nm (A₄₃₆), whereas PPO activity was measured by recording the fluctuations in the absorbance at 495 nm (A₄₉₅) every 30 seconds for 3 min using a UV-160A spectrophotometer (Shimadzu, Japan).

The transcript levels of three antioxidant-associated genes, including peroxisomal catalase (PvCAT1; GenBank accession number: KF033307.1), superoxide dismutase (PvSOD; GenBank accession number: XM_068639556.1), and glutathione reductase (PvGR; GenBank accession number: KY195009.1) were assessed from common bean leaves (2^nd and 3^rd fully developed leaves from the top) at 72 hpt after last treatment using real-time RT-qPCR. Briefly, RNA was extracted using a Simply P Total RNA Extraction Kit (catalog number BSC52S1; BioFlux, Bioer technology, China), according to the manufacturer’s procedure. Then, cDNA was synthesized using a TOP script™ cDNA Synthesis Kit as described in the manufacturer’s protocol. The primer sequences for the three genes mentioned above are listed in Supplementary Table S3 . PvActin-3 (GenBank accession number: XM_068616709.1) was used as a housekeeping gene, and the 2^−ΔΔCT method was used for the calculation of relative gene expression (Livak and Schmittgen, 2001). The stability of Actin was confirmed previously under biotic (incompatible interaction between common bean and fungus Colletotrichum lindemuthianum) as well as abiotic (drought; salinity; cold temperature) stresses (Borges et al., 2012).

Initially, genome-wide in silico analysis of oxaloacetate acetylhydrolase (OAH) protein in S. sclerotiorum was carried out using the protein-protein BLAST (BLASTp 2.15.0+) tool (Altschul et al., 1997, 2005). Briefly, OAH from Aspergillus fijiensis CBS 313.89 (AfOAH; taxid:1191702; GenBank Accession No. XP_040799428.1; 342 aa) and Penicillium lagena (PlOAH; taxid:94218; GenBank Accession No. XP_056833920.1; 316 aa) were used as query sequences to match their homologous proteins from S. sclerotiorum (taxid:5180). BLASTp was carried out based on recently available data about the S. sclerotiorum genome on GenBank, National Center for Biotechnology Information website (NCBI, http://www.ncbi.nlm.nih.gov/gene/).

Moreover, evolutionary analysis and phylogenetic tree of predicted OAH genes from S. sclerotiorum (SsOAH), as well as AfOAH from A. fijiensis CBS 313.89 and PlOAH from P. lagena were inferred by using the Maximum Likelihood method and JTT matrix-based model (Jones et al., 1992) in MEGA11 (Tamura et al., 2021). The phylogenetic tree was combined with multiple protein sequence alignment analysis of all predicted OAH genes from S. sclerotiorum (SsOAH), as well as the query sequences using Constraint-Based Alignment Tool (COBALT; for multiple protein sequences (https://www.ncbi.nlm.nih.gov/tools/cobalt/re_cobalt.cgi) (Papadopoulos and Agarwala, 2007). Furthermore, ClustalW (http://www.genome.jp/tools-bin/clustalw) was used to align the top-matched AA sequences of SsOAH from S. sclerotiorum with the query sequences (AfOAH and PlOAH) (Larkin et al., 2007) and ESPript tool (version 3.0; https://espript.ibcp.fr/ESPript/ESPript/index.php) was used to visualize conserved regions in the alignment.

Additionally, functionally representative domains and conserved sites of the predicted SsOAH from S. sclerotiorum were interactively classified into families using the InterPro tool (https://www.ebi.ac.uk/interpro/) (Blum et al., 2021). Finally, three-dimensional (3D) structure modeling of predicted SsOAH from S. sclerotiorum was carried out using the Protein Homology/analogy Recognition Engine (Phyre2-server version 2.0; http://www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index) (Kelley et al., 2015), then confirmed using the SWISS-MODEL server (https://swissmodel.expasy.org/) (Biasini et al., 2014). The predicted 3D structures (PDB format) were interactively visualized using the UCSF-Chimera package (version 1.15; https://www.cgl.ucsf.edu/chimera/) (Pettersen et al., 2004).

The transcript levels of oxaloacetate acetylhydrolase (SsOAH; GenBank accession number: XM_001590428.1) were assessed from S. sclerotiorum mycelia using real-time RT-qPCR. Briefly, S. sclerotiorum was inoculated into PDB-containing flasks and incubated on an incubator shaker (Model I2400, New Brunswick Scientific Co., Edison, NJ, USA) at 150 rpm for 24 hours at 25 ± 2°C under continuous darkness (24 h) to encourage mycelial growth, then treated with _L-ornithine- and ‘Rizolex-T’ fungicide at a final concentration of the IC₅₀ (about 40, and 3.2 mg/L, respectively), then the incubation was continued at the same conditions for another 24 hours. After incubation, cultures were centrifuged at 2500 rpm for 5 min and the supernatant (fungal mycelia) was collected for gene expression analysis. Likewise, fungal mycelia were collected at 0, 24, 48, 72, 96, and 120 hpt from infected plants that produced a white mold that forms cottony mycelium on the surface of infected tissue. RNA was extracted from the fungal mycelium, and then cDNA was synthesized as described above. The primer sequences for SsOAH are listed in Supplementary Table S3 . SsActin (GenBank accession number: XM_001589919.1) was used as a housekeeping gene, and the 2^−ΔΔCT method was used for the calculation of relative gene expression (Livak and Schmittgen, 2001).

Oxalic acid was determined in both potato dextrose broth (PDB) containing the fungal pathogen, S. sclerotiorum, as well as the plant samples according to the method of Xu and Zhang (2000) with slight modifications. Briefly, S. sclerotiorum isolates were inoculated into PDB-containing flasks and then incubated on an incubator shaker (Model I2400, New Brunswick Scientific Co., Edison, NJ, USA) at 150 rpm for 3-5 days at 25 ± 2°C under continuous darkness (24 h) to encourage mycelial growth. After incubation, the fungal cultures were initially filtered through Whatman filter paper No. 1, then centrifuged at 2500 rpm for 5 min to remove any mycelial debris. The supernatant was collected and stored at 4°C for further quantification of oxalic acid. Approximately 0.1 g of ground tissues were extracted three times (2 ml each) using distilled water to prepare the plant sample. Subsequently, samples were centrifuged at 2500 rpm for 5 min and the supernatant was filtered dryly through Whatman No. 1 paper, then collected for further analysis.

For oxalic acid quantification, the reaction mix was prepared in a test tube fitted with a glass stopper in the order of 0.2 mL of sample (or PDB culture filtrate or standard oxalic acid solution), 0.11 ml of bromophenol blue (BPB, 1 mM; Fisher Chemical, Pittsburgh, PA, USA), 0.198 ml of 1 M sulfuric acid (H₂SO₄; Al - Gomhoria Company for medicines and medical supplies, Cairo, Egypt), and 0.176 ml of 100 mM potassium dichromate (K₂Cr₂O₇; TCI chemicals, Portland, OR, USA), then the solution was made up to the mark using 4.8 ml of distilled water, vigorously mixed, and placed in the water bath immediately at 60°C. After 10 minutes, the reaction was quenched by adding 0.5 ml sodium hydroxide solution (NaOH; 0.75 M). The absorbance of the reaction mix was measured at 600 nm (A₆₀₀) using a UV-160 spectrophotometer (Shimadzu, Japan). PDB and distilled water were used as a blank control for quantification in culture filtrate or plant samples, respectively. A calibration curve of oxalic acid (Thermo Scientific Chemicals, Waltham, MA, USA) was used to determine the concentration of oxalic acid in the culture filtrate and expressed as μg oxalic acid per mL PDB medium (μg.mL⁻¹) as well as in the leaves extract which was expressed as μg oxalic acid per gram fresh weight (μg.g⁻¹ FW).

Throughout the study, unless otherwise stated, all experiments were arranged in a completely randomized design (CRD) with six biological replicates per treatment and five pots (two plants per pot) for each biological replicate. Biological replicates were analyzed twice (two technical replicates). Technical replicates were used to test the reproducibility within the same experiment, but they were not used in the statistical analysis to avoid the possibility of pseudoreplication. Data were statistically analyzed using the analysis of variance (ANOVA), followed by the Tukey-Kramer honestly significant difference (HSD) test (p ≤ 0.05). For the in vitro experiments, probit analysis was used to calculate the IC₅₀ and IC₉₉ with 95% confidence intervals.

A total of 4 isolates were collected from different bean fields in El-Gharbia Governorate, Egypt. On the PDA medium, all isolates developed creamy white mycelia that rapidly became cottony white ( Figure 1A ), then turned beige or brownish at the stage of sclerotia formation. Generally, the sclerotia were hard-bodied, black-colored, globose to irregular in shape, and measured 5.2 to 7.7 mm in length and 3.4 to 5.3 mm in diameter ( Figure 1B ). Although the four isolates showed a peripheral sclerotia pattern that developed at the edge of the culture media 10-12 days post incubation at 25 ± 2°C ( Figure 1A ), significant differences were observed in the number of sclerotia per plate between them (P < 0.001) with superiority for isolate #3 (32.33 ± 1.53 sclerotia per plate; Figure 1C ). Likewise, isolate #3 produced more oxalic acid in PDB than other isolates (3.33 ± 0.49 μg.mL⁻¹; Figure 1D ). Isolate #3 showed typical morphological and microscopic characteristics with the phytopathogenic fungus S. sclerotiorum. For instance, on PDA, colonies of isolate #3 were fast growing with milky white ( Figure 1A ), and reverse beige or little salmon-buff color and took 6-7 days to fully cover the surface of a 9-cm Petri dish when incubated at 25 ± 2°C. Collectively, isolate #3 was identified as S. sclerotiorum based on the above-mentioned morphological and microscopic features.

Moreover, to confirm pathogenicity, Koch’s postulates were fulfilled using the four obtained isolates of S. sclerotiorum to inoculate the sensitive commercial cultivar Giza 3 of common bean under greenhouse conditions ( Figure 1E ). Although all obtained fungal isolates were pathogenic and were able to infect common bean (cv. Giza 3) producing typical white mold symptoms on all above-ground parts ( Figure 1F ), particularly stems ( Figure 1G ) and pods ( Figure 1H ) after 10 days post inoculation (dpi), isolate #3 was the most aggressive isolate in two separate experiments. Isolate #3 had the highest disease severity (%) on bean plants (24.0 ± 4.0, 58.0 ± 2.0, and 76.7 ± 3.1 at 7, 14, and 21 dpi, respectively; Figure 1F ).

The identification of the most aggressive S. sclerotiorum isolate #3 was further confirmed based on the sequencing of the Internal transcribed spacer (ITS) region ( Figure 1I ). The phylogenetic analysis between isolate #3 and 20 reference isolates/strains showed high similarity (over 99%) between them. It is worth mentioning that S. sclerotiorum – isolate #3 (533 bp) showed high similarity with the American isolate S. sclerotiorum isolate LPM36 (GenBank accession No. MK896659.1; 540 bp) isolated from the dry pea seed and the Chinese isolate S. sclerotiorum isolate YKY211 (GenBank accession No. OR206374.1; 548 bp) the causal agent of stem rot of stock (Matthiola incana) which all were clustered separately at the top of the dendogram ( Figure 1I ). The new sequence was deposited in the NCBI database and named ‘S. sclerotiorum - isolate YN-25’ (GenBank Accession No. PV202792). Accordingly, it was noticeable that isolate #3 was the most aggressive isolate; consequently, it was chosen for all subsequent experiments.

The antifungal activity of serial concentrations of (12.5, 25, 50, 75, 100, and 125 mg/L) of the diamine, _L-ornithine (Sigma-Aldrich, Darmstadt, Germany), was examined in vitro against S. sclerotiorum – isolate #3. It is worth mentioning that _L-ornithine showed fungistatic action and progressively inhibited the mycelial radial growth of S. sclerotiorum in a dose-dependent manner ( Figures 2A, B ). At the highest tested concentration (125 mg/L), _L-ornithine had the highest mycelial growth inhibition (99.62 ± 0.27%; Figure 2B ) which was equivalent to the highest tested concentration (10 mg/L) of the commercial fungicide ‘Rizolex-T’ (99.45 ± 0.39% inhibition; Figure 2C ), suggesting similar potency.

Moreover, the probit regression analysis was carried out and its associated plots are presented in Table 1 and Figures 2D, E . Briefly, the acceptable slope value of _L-ornithine (y = 2.92x − 4.67) and its associated significant statistics (Cox & Snell R² = 0.3709, Nagelkerke R² = 0.4998, and p < 0.0001; Figures 2D ) compared with the commercial fungicide ‘Rizolex-T’ (y = 1.96x − 0.99, Cox & Snell R² = 0.1242, Nagelkerke R² = 0.1708, and p < 0.0001) indicates a potentiating effect on antifungal activity against S. sclerotiorum ( Table 1 ).

Generally, _L-ornithine (250 mg/L) significantly reduced the development and severity of white mold disease on treated common bean plants compared with non-treated S. sclerotiorum-infected plants (control; Figure 3A ). Briefly, although the disease severity was progressively increased in the non-treated infected control plants (52.67 ± 1.53, 83.21 ± 2.61, and 92.33 ± 3.06%), _L-ornithine markedly lowered disease severity (%) throughout the experiment (8.97 ± 0.15, 18.00 ± 1.00, and 26.36 ± 3.07) at 7, 14, and, 21 days post-treatment (dpt), respectively ( Figure 3A ). Likewise, the area under the disease progress curve (AUDPC) declined from 1274.33 ± 33.13 (in non-treated control) to 281.03 ± 7.95 when S. sclerotiorum-infected bean plants were treated with the 250 mg/L of _L-ornithine, which was just behind the positive control 50 mg/L ‘Rizolex-T’ fungicide (183.61 ± 7.71; Figure 3B ). The same trend was observed in the second trial.

Exogenous application of 250 mg/L _L-ornithine progressively enhanced the plant height ( Figure 4A ), number of branches per plant ( Figure 4B ), and number of leaves per plant ( Figure 4C ) throughout 42 dpi. Although the commercial fungicide ‘Rizolex-T’ (50 mg/L) had the highest effect on all studied vegetative parameters, the exogenous application of _L-ornithine (250 mg/L) came second highest when compared with non-treated control plants ( Figures 4A–C ). On the other hand, the application of _L-ornithine had no significant effect on the content of both photosynthetic pigments chlorophyll a ( Figure 4D ) and chlorophyll b ( Figure 4E ), however, it slightly augmented the total carotenoids (0.56 ± 0.03 mg.g⁻¹ FW) compared with both negative (0.44 ± 0.02 mg.g⁻¹ FW) and positive controls (0.46 ± 0.02 mg.g⁻¹ FW; Figure 4F ). Collectively, these findings suggest that _L-ornithine has no phytotoxicity on the treated bean plants, but it even stimulates their growth.

In situ histochemical localization of the reactive oxygen species (ROS; expressed as hydrogen peroxide [H₂O₂]) and free radicals (expressed as superoxide anion [O₂ ^•−]) showed that exogenous application of _L-ornithine (250 mg/L) significantly reduced the accumulation of both H₂O₂ (96.05 ± 5.33 nmol.g⁻¹ FW; Figure 5A ) and O₂ ^•− (32.69 ± 8.56 nmol.g⁻¹ FW; Figure 5B ), compared to non-treated infected plants (173.31 ± 12.06 and 149.35 ± 7.94 nmol.g⁻¹ FW, respectively) and those treated with 50 mg/L of the commercial fungicide ‘Rizolex-T’ (170.12 ± 9.50 and 157.00 ± 7.81 nmol.g⁻¹ FW, respectively) which both accumulate higher contents of H₂O₂ and O₂ ^•− at 72 hpt ( Figures 5A, B ). Similarly, TCA -based assay of malondialdehyde (MDA) suggested that S. sclerotiorum-infected bean plants accumulate higher MDA levels (113.48 ± 10.02 nmol.g⁻¹ FW) in their leaves ( Figure 5C ). Nevertheless, exogenous application of _L-ornithine markedly diminished lipid peroxidation as expressed by lower MDA content within treated plants (33.08 ± 4.00 nmol.g⁻¹ FW).

To better understand the physicochemical mechanisms of _L-ornithine within S. sclerotiorum-infected bean plants, non-enzymatic antioxidant defense machinery as expressed by total soluble phenolics (TSP; Figure 5D ) and total soluble flavonoids (TSF; Figure 5E ) were further investigated. Briefly, the application of _L-ornithine (250 mg/L) induced the accumulation of TSP within treated S. sclerotiorum-infected bean plants to reach its highest peak at 72 hpt (11.84 ± 0.73 mg GAE.g⁻¹ FW), compared to non-treated (3.51 ± 0.24 mg GAE.g⁻¹ FW) and fungicide-treated controls (6.80 ± 0.10 mg GAE.g⁻¹ FW) at the same time point ( Figure 5D ). Similarly, exogenous application of 250 mg/L _L-ornithine dramatically increased the accumulation of TSF within treated S. sclerotiorum-infected bean plants to reach its highest peak at 72 hpt (1.60 ± 0.07 mg RE.g⁻¹ FW), compared to non-treated (0.56 ± 0.02 mg RE.g⁻¹ FW) and fungicide-treated controls (0.76 ± 0.06 mg RE.g⁻¹ FW) at the same time point ( Figure 5E ). However, both TSP and TSF dropped thereafter when measured at 96 and 120 hpt, but still higher than both controls.

Generally, the application of _L-ornithine (250 mg/L) significantly boosted the total free amino acids (45.37 ± 3.07 mg.g⁻¹ FW; Figure 5F ) and proline content (13.20 ± 0.60 mg.g⁻¹ FW; Figure 5G ) of S. sclerotiorum-infected bean plants compared with the non-treated control (30.38 ± 3.08 and 4.90 ± 0.20 mg.g⁻¹ FW; respectively) and 50 mg/L ‘Rizolex-T’ fungicide-treated plants (32.02 ± 2.00 and 5.20 ± 0.20 mg.g⁻¹ FW; respectively). Nevertheless, there were no significant differences between non-treated and fungicide-treated common bean plants in terms of total free amino acids and proline content ( Figures 5F and G ).

In agreement with its effect on non-enzymatic antioxidant defense machinery, _L-ornithine (250 mg/L) gradually improved the enzymatic activity of catalase (CAT; Figure 6A ), peroxidase (POX; Figure 6B ), and polyphenol oxidase (PPO; Figure 6C ) till they reached their highest peak at 72 hpt (129.69 ± 3.05 μM H₂O₂ g⁻¹ FW min⁻¹, 1.182 ± 0.182 μM of tetraguaiacol g⁻¹ FW min⁻¹, 0.676 ± 0.025 arbitrary units, respectively) compared to both controls at the same time point, then they dropped slowly at 96 and 120 hpt. Moreover, exogenous application of 250 mg/L _L-ornithine unregulated three antioxidant-associated genes, including peroxisomal catalase (PvCAT1; Figure 6D ), superoxide dismutase (PvSOD; Figure 6E ), and glutathione reductase (PvGR; Figure 6F ) compared to both controls.

In silico analysis showed that the S. sclerotiorum genome possesses about six putative oxaloacetate acetylhydrolase (OAH) proteins that were similar and produced significant alignment statistics with OAH protein from Aspergillus fijiensis CBS 313.89 and Penicillium lagena ( Supplementary Table S4 ). Only three of them had an identity percentage of more than 50%, including Hypothetical protein SS1G_08218 (GenBank accession no. XP_001590478.1, 338 aa, identity = 70.28 and 61.97% with OAH from A. fijiensis and P. lagena, respectively), OAH-1 (GenBank accession no. AEY84228.1, identity = 71.08 and 69.79% with OAH from A. fijiensis and P. lagena, respectively), and OAH-2 (GenBank accession no. AEY84231.1, identity = 69.02 and 65.93% with OAH from A. fijiensis and P. lagena, respectively) ( Supplementary Table S4 ). It is worth mentioning that the AA sequence of both OAH-1 (249 aa) and OAH-2 (185 aa) from S. sclerotiorum was a little bit shorter than the query AA sequences of OAH from Aspergillus fijiensis (342 aa) and from Penicillium lagena (316 aa), but the length of AA sequences Hypothetical protein SS1G_08218 (henceforth SsOAH; 338 aa) was approximately like them. Therefore, we focused only on the SsOAH protein for further in silico analysis.

Moreover, the multiple protein sequences alignment using COBALT analysis showed that the obtained six protein sequences were relatively highly homologous to each other, as well as OAH from A. fijiensis and P. lagena, and all had a conserved 2-methylisocitrate lyase (PrpB) domain ( Figure 7A ). However, the phylogenetic analysis showed that only SsOAH was phylogenetically closer to OAH from Penicillium lagena while OAH from Aspergillus fijiensis was clustered separately at the bottom of the dendrogram ( Figure 7A ). Likewise, multiple sequence alignment showed that the SsOAH protein from S. sclerotiorum had high similarity and conserved sequence with both query sequences (OAH from A. fijiensis and P. lagena) ( Supplementary Figure S1 ).

Additionally, the InterPro Scan tool was used for the functional analysis of proteins by classifying them into families and predicting domains and important sites of SsOAH ( Figure 7B ). Briefly, SsOAH protein has a phosphoenolpyruvate mutase (PEPM) isocitrate lyase (ICL) representative domain (ICL/PEPM, CDD entry: cd00377), as well as an ICL/PEPM domain (InterPro entry: IPR039556). Furthermore, SsOAH has a pyruvate kinase-like domain superfamily (InterPro entry: IPR040442) with phosphoenolpyruvate-binding domains (CATH-Gene3D entry: G3DSA:3.20.20.60), as well as a pyruvate/phosphoenolpyruvate kinase-like domain superfamily (InterPro entry: IPR015813) with phosphoenolpyruvate/pyruvate domain (SUPERFAMILY entry: SSF51621). It also has an isocitrate lyase/phosphorylmutase conserved site (InterPro entry: IPR018523) with an isocitrate lyase signature (PROSITE patterns entry: PS00161) Figure 7B ). It is worth mentioning that SsOAH had an unintegrated site of isocitrate lyase/PEP mutase superfamily, oxaloacetate decarboxylase (PANTHER entry: PTHR42905) with phosphoenolpyruvate phosphomutase site (Pfam entry: PF13714). Other features of SsOAH include a region of a membrane-bound protein predicted to be embedded in the membrane (as a transmembrane site), a region of a membrane-bound protein predicted to be outside the membrane, in the extracellular region (as a non-cytoplasmic domain), and a region of a membrane-bound protein predicted to be outside the membrane, in the cytoplasm (as a cytoplasmic domain) ( Figure 7B ). Collectively, these findings suggest that the predicted SsOAH protein is highly similar in its functional analysis, conserved domains, and topology with known OAH proteins from other species.

The crystallographic three-dimensional (3D) structure of SsOAH ( Figures 7C, D ) was predicted using the crystal structure of oxaloacetate acetylhydrolase in the protein data bank (PDB ID: 3lye.1.A) and refined using the X-ray method to 1.30 Å resolution with acceptable statistics ( Figures 7C, D ; Supplementary Figure S2 ). Briefly, the Phyre2 tool showed that approximately 283 residues (84%; residues Val 39 to Gly 331) of SsOAH have been modeled with template protein with 100% confidence ( Figure 7C ). According to the Phyre2-based analysis, the predicted 3D structure of SsOAH is a monomer composed of 12 α-helix ribbons (approximately 40%) and eight β-sheets (about 11%; Figure 7C ; Supplementary Figure S2 ) with considerable predicted local similarity (PLS) to the target. Interestingly, the SWISS-model protein structure homology-modeling server confirmed almost the same 3D structure. However, the SWISS-model-based predicted model of SsOAH is a homo-tetramer (sequence identity = 65.78%, sequence similarity = 50%, and coverage = 89%) with a satisfactory global model quality estimate (GMQE = 0.79), QMEANDisCo Global (0.86 ± 0.05), and quaternary structure quality estimate (QSQE = 0.76) ( Figure 7D ; Supplementary Figure S3 ).

The addition of 40 mg/L _L-ornithine to the PDB medium significantly down-regulated the gene expression of SsOAH in the mycelium of S. sclerotiorum ( Figure 8A ). Likewise, although the transcript levels of SsOAH were progressively increased in the fungal mycelium collected from non-treated control plants till the end of the experiment (120 hpt), exogenous application of 250 mg/L _L-ornithine significantly down-regulated the gene expression of SsOAH in the fungal mycelia collected from treated plants at 48 hpt and till the end of the experiment ( Figure 8A ).

To better understand the relationship between _L-ornithine and the pathogenicity factor of S. sclerotiorum, oxalic acid, the effect of _L-ornithine application on the secretion of oxalic acid in liquid media (PDB), as well as infected tissues was investigated. Briefly, the addition of 40 mg _L-ornithine per liter of PDB media significantly reduced the secretion of oxalic acid in the medium (1.24 ± 0.21 μg.mL⁻¹) compared to the non-treated control (4.06 ± 0.17 μg.mL⁻¹; Figure 8C ). However, we believe that the observed reduction in oxalic acid levels could be due to the inhibited growth of S. sclerotiorum or due to direct inhibition of SsOAH activity. Therefore, the fungal mycelium was weighed to normalize oxalic acid production per gram of fungal biomass in our in vitro experiments. The results showed that _L-ornithine (40 mg/L) significantly reduced oxalic acid production even after normalizing fungal biomass, suggesting a direct inhibitory effect on the enzyme’s activity or its expression. Likewise, exogenous application of _L-ornithine (250 mg/L) significantly reduced the oxalic acid accumulation in S. sclerotiorum-infected bean leaves. Although the oxalic acid level in non-treated infected leaves was gradually increased over the time course until it reached its highest peak at 96 hpt (237.40 ± 12.69 μg.g⁻¹ FW), _L-ornithine application significantly lessened the oxalic acid accumulation in treated plants ( Figure 8D ).