<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2025.1475068</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Antioxidant metabolism insights into ripening and senescence delay of green pepper fruit through the salicylic acid preharvest treatment</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Dob&#xf3;n-Su&#xe1;rez</surname>
<given-names>Alicia</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2932372"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guti&#xe9;rrez-Pozo</surname>
<given-names>Mar&#xed;a</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2975654"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Serna-Escolano</surname>
<given-names>Vicente</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1464511"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Gim&#xe9;nez</surname>
<given-names>Mar&#xed;a J.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1523264"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Valero</surname>
<given-names>Daniel</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/256717"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Serrano</surname>
<given-names>Mar&#xed;a</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/417965"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Garc&#xed;a-Pastor</surname>
<given-names>Mar&#xed;a E.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1006487"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zapata</surname>
<given-names>Pedro J.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/392415"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Agri-Food Technology, Institute for Agri-Food and Agro-Environmental Research and Innovation (CIAGRO), University Miguel Hern&#xe1;ndez</institution>, <addr-line>Alicante</addr-line>, <country>Spain</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Applied Biology, Institute for Agri-Food and Agro-Environmental Research and Innovation (CIAGRO), University Miguel Hern&#xe1;ndez</institution>, <addr-line>Alicante</addr-line>, <country>Spain</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Shifeng Cao, Zhejiang Wanli University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Muhammad Azam, University of Agriculture, Faisalabad, Pakistan</p>
<p>Pengxia Li, Jiangsu Academy of Agricultural Sciences (JAAS), China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Mar&#xed;a E. Garc&#xed;a-Pastor, <email xlink:href="mailto:m.garciap@umh.es">m.garciap@umh.es</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>19</day>
<month>03</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1475068</elocation-id>
<history>
<date date-type="received">
<day>02</day>
<month>08</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>17</day>
<month>02</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Dob&#xf3;n-Su&#xe1;rez, Guti&#xe9;rrez-Pozo, Serna-Escolano, Gim&#xe9;nez, Valero, Serrano, Garc&#xed;a-Pastor and Zapata</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Dob&#xf3;n-Su&#xe1;rez, Guti&#xe9;rrez-Pozo, Serna-Escolano, Gim&#xe9;nez, Valero, Serrano, Garc&#xed;a-Pastor and Zapata</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>The systematic investigation of the biochemical and molecular bases of salicylic acid (SA) in the postharvest physiological process of green pepper fruit remains unclear.</p>
</sec>
<sec>
<title>Methods</title>
<p>Accordingly, this study aims to analyze the effects of 0.5 mM-SA preharvest treatments, applied by foliar spraying or irrigation, on the ripening and senescence of green pepper fruit for 28 days of storage at 7 &#xb0;C.</p>
</sec>
<sec>
<title>Results</title>
<p>The study revealed that the preharvest application of SA, either by foliar spraying or irrigation, significantly delayed losses of weight, firmness and color during postharvest. Additionally, both treatments increased the total soluble solids and total acidity content, which lead to a significantly reduced ripening index after storage. These results were evidenced by a slowing down of the ripening and senescence processes, accompanied by the stimulation of the antioxidant enzymes in those SA-treated green pepper fruits. Furthermore, a significant increase in chlorophylls, phenolics, ascorbic acid and dehydroascorbic acid content was observed. The SA treatments also enhanced the total antioxidant activity, in both hydrophilic and lipophilic phases. These positive effects were mediated by the upregulation of the relative response of the <italic>CaAPX, CaPOD, CaPAL, CaDHAR2</italic> genes at harvest.</p>
</sec>
<sec>
<title>Discussion</title>
<p>These findings reinforce the existing knowledge gap regarding the impact of foliar spraying or irrigation SA on the intricate interplay between metabolites and genes related to the antioxidant system in regulating the bell pepper fruit ripening and senescence. The impact of both applications exhibited comparable results; however, the irrigation was identified as the most advantageous due to its ease applicability and cost effectiveness in comparison.</p>
</sec>
</abstract>
<abstract abstract-type="graphical">
<title>Graphical Abstract</title>
<p>An antioxidant metabolism approach delaying ripening and senescence of green pepper fruit by applying foliar or irrigation salicylic acid (SA) preharvest treatment.</p>
<p>
<graphic xlink:href="fpls-16-1475068-g010.tif" position="anchor"/>
</p>
</abstract>
<kwd-group>
<kwd>
<italic>Capsicum annuum</italic> L.</kwd>
<kwd>quality losses</kwd>
<kwd>bioactive compounds</kwd>
<kwd>antioxidant capacity</kwd>
<kwd>antioxidant enzymes</kwd>
<kwd>relative gene expression</kwd>
</kwd-group>
<counts>
<fig-count count="8"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="105"/>
<page-count count="20"/>
<word-count count="11201"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Technical Advances in Plant Science</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Bell pepper (<italic>Capsicum annuum</italic> L.) is an economically important vegetable crop which has a recent worldwide popularity among consumers in human diet due to its nutritional value, as an excellent source of biologically active compounds (vitamins, carotenoids, flavonoids, phenolic acids and other phytochemicals) with health-related properties, the crispness, and the versatility to be consumed as a fresh vegetable in salads, cooked meals or dehydrated for spices (<xref ref-type="bibr" rid="B58">Mar&#xed;n et&#xa0;al., 2004</xref>; <xref ref-type="bibr" rid="B61">Navarro et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B80">Serrano et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B72">Raybaudi-Massilia et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B85">Soare et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B31">Ge et&#xa0;al., 2020</xref>). Consumers have become more critical in the last decade with their purchasing decisions which are commonly focused not only in physical and sensory traits, such as color, size, pericarp thickness, firmness and flavor, but also in nutritional and nutraceutical characteristics (<xref ref-type="bibr" rid="B74">Rodr&#xed;guez-Burruezo et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B45">Jim&#xe9;nez-Garc&#xed;a et&#xa0;al., 2018</xref>). In Spain, the total production of chili peppers and peppers (<italic>Capsicum annuum</italic> L. and <italic>Piper nigrum</italic> L, respectively) has steadily increased to more than 1.58-fold over the past 10 years, reaching over 1.5 million tons in the 2022 season (<xref ref-type="bibr" rid="B25">FAOSTAT, 2024</xref>). The primary postharvest challenges that result in substantial quality deterioration and diminished acceptability of bell peppers are as follows: Water loss, which leads to significant softening and shrinkage due to turgor pressure loss, starch degradation, and chemical modifications in the cell wall related to pectin by the action of softening enzymes, such as polygalacturonase (PG), pectin methyl esterase (PME), cellulase, and &#xdf;-galactosidase (<xref ref-type="bibr" rid="B52">Li Z. et&#xa0;al., 2024</xref>). On the other hand, peppers can experience chilling injury (CI) when stored at temperatures below 7-10&#xb0;C. This leads to symptoms such as surface pitting, watery stains, browning of the seed and calyx, and fruit decay. This, in turn, can result in reduced marketability (<xref ref-type="bibr" rid="B22">El-Ramady et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B8">Charoenphun et&#xa0;al., 2024</xref>). Finally, there are pathological disorders, for example grey mold, which is mainly caused by <italic>Botrytis cinerea</italic> (<xref ref-type="bibr" rid="B9">Cheema et&#xa0;al., 2018</xref>).</p>
<p>Nowadays, global demand for high-quality vegetable products is rapidly increasing. However, climate change is negatively affecting agricultural areas and water resources which are decreasing (<xref ref-type="bibr" rid="B86">Sobczak et&#xa0;al., 2023</xref>). Bell pepper crop is sensitive to temperature fluctuations during the developmental and growth cycle, showing a lack of tolerance to high temperature since its fruit setting is drastically reduced when the day temperature rises above 32&#xb0;C and/or the night temperature is above 20&#xb0;C (<xref ref-type="bibr" rid="B24">Erickson and Markhart, 2002</xref>). This abiotic stress in the plant induces the production and accumulation of reactive oxygen species (ROS) leading to membrane breakdown and cellular turgor loss that can prevent plant growth and development (<xref ref-type="bibr" rid="B70">Preet et&#xa0;al., 2023</xref>). The process of scavenging ROS in plants as part of the antioxidant defense system and osmoprotectants comprises various antioxidant enzymes, including superoxide dismutase (SOD), which converts free superoxide (O<sub>2</sub>) radicals to hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) and oxygen, ascorbate peroxidase (APX), catalase (CAT), and peroxidase (POD). The latter enzymes have shown to play a pivotal role in the detoxification of H<sub>2</sub>O<sub>2</sub> through its decomposition into water and oxygen. Furthermore, the role of radical scavenging metabolites in ROS scavenging mechanisms is also of significance. In this sense, different phytohormones can positively influence the crop yield and reduce negative environmental impacts. On the other hand, fruit senescence and postharvest disease infection can result in quality and economic losses (<xref ref-type="bibr" rid="B98">Zhang and Jiang, 2019</xref>). Some plant hormones have been widely studied to improve the postharvest quality of fruit and vegetables (<xref ref-type="bibr" rid="B97">Zhang et&#xa0;al., 2020</xref>).</p>
<p>As the major endogenous component in signal transduction systems, SA plays an efficient role in plant growth and development, flowering, and fruit ripening, as well as in regulating photosynthesis (<xref ref-type="bibr" rid="B60">Natasha et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B37">Hadjipieri et&#xa0;al., 2021</xref>). On the other hand, SA is crucial in stimulating the systemic acquired resistance (SAR) in plants by regulating numerous biochemical and physiological functions related to tolerance to both biotic and abiotic stresses and modifying the antioxidant system (<xref ref-type="bibr" rid="B47">Khan et&#xa0;al., 2015</xref>). Therefore, SA and its derivatives elicit a wide range of metabolic and physiological processes in plants, which have great potential in reducing postharvest losses in horticultural crops. SA leads to the synthesis of proteins affecting several metabolic processes by regulating their gene expression (<xref ref-type="bibr" rid="B44">Janda et&#xa0;al., 2020</xref>). The mechanisms by which SA generates these improvements could be related to the protection of cell membranes, the increase in carbon metabolism, and antioxidant system, and the regulation of stress defense proteins (<xref ref-type="bibr" rid="B46">Kang et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B82">Sharma et&#xa0;al., 2017</xref>). However, its specific action mechanism is still not well understood. Indeed, different studies have demonstrated the hormonal interactions between SA and jasmonic acid (JA) and several different stress-link compounds taking place under abiotic stresses, highlighting the complexity of hormonal signaling cascades (<xref ref-type="bibr" rid="B17">Dempsey and Klessig, 2017</xref>; <xref ref-type="bibr" rid="B18">Devireddy et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B42">Huntenburg et&#xa0;al., 2022</xref>). Furthermore, the attenuating effects of SA in plants depend on the concentration used, the method of application, and the plant development stage (<xref ref-type="bibr" rid="B63">N&#xf3;brega et&#xa0;al., 2020</xref>).</p>
<p>In recent years, the foliar application of exogenous SA to crops has shown to be effective in the regulation of biotic and abiotic stresses, increasing the yield of green pepper fruit by reducing stress-induced growth inhibition as well as fruit quality traits (<xref ref-type="bibr" rid="B23">Elwan and El-Hamahmy, 2009</xref>; <xref ref-type="bibr" rid="B45">Jim&#xe9;nez-Garc&#xed;a et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B43">Ibrahim et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B91">Veloso et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B20">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al., 2021b</xref>; <xref ref-type="bibr" rid="B32">Ghahremani et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B86">Sobczak et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B70">Preet et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B73">Rodrigues da Silva et&#xa0;al., 2023</xref>). In addition, SA treatment was found to alleviate chilling injury in pepper fruits through enhancing antioxidant metabolism, fatty-acid desaturation efficiency and water retention (<xref ref-type="bibr" rid="B27">Fung et&#xa0;al., 2004</xref>; <xref ref-type="bibr" rid="B31">Ge et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B38">Hanaei et&#xa0;al., 2022</xref>). However, appropriate concentrations and methods of elicitor application need to be determined to improve the effectiveness of this practice under different growing conditions (<xref ref-type="bibr" rid="B59">Munshi et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B86">Sobczak et&#xa0;al., 2023</xref>). A recent review concluded that preharvest spraying provides better results than postharvest treatments, but the specific results need deeper research to be conducted focusing on the effect of spraying frequency time and growing environment on postharvest storage quality of fruit (<xref ref-type="bibr" rid="B10">Chen S. et&#xa0;al., 2023</xref>). Furthermore, <xref ref-type="bibr" rid="B10">Chen S. et&#xa0;al. (2023)</xref> stated that there is a lack of information about the metabolic mechanism of exogenous treatments with SA and its derivatives affecting fruit quality parameters, which is an emerging field that needs to be explored. In fact, most of the metabolomic and transcriptomic studies of SA available are related to the functions, biosynthesis or transcriptional regulations of this plant hormone for establishing resistance to many pathogens in plants (<xref ref-type="bibr" rid="B19">Ding and Ding, 2020</xref>). For instance, exogenous SA application bolstered resistance to <italic>Colletotrichum viniferum</italic> (<xref ref-type="bibr" rid="B55">Lin et&#xa0;al., 2024</xref>), <italic>Ralstonia solanacearum</italic> (<xref ref-type="bibr" rid="B51">Li N. et&#xa0;al., 2024</xref>), <italic>Podosphaera pannosa</italic> (<xref ref-type="bibr" rid="B96">Yang et&#xa0;al., 2022</xref>), <italic>Xanthomonas campestris pv. campestris</italic> (<xref ref-type="bibr" rid="B88">Sun et&#xa0;al., 2022</xref>), <italic>Colletotrichum</italic> (<xref ref-type="bibr" rid="B83">Shi et&#xa0;al., 2019</xref>), cucumber green mottle mosaic virus (<xref ref-type="bibr" rid="B56">Liu et&#xa0;al., 2023</xref>), and <italic>Penicillium expansum</italic> (<xref ref-type="bibr" rid="B99">Zhang et&#xa0;al., 2024</xref>) in grapes, tomato, roses, cabbage, tea, watermelon, and apples, respectively. Recently, <xref ref-type="bibr" rid="B68">Perez-Aranda et&#xa0;al. (2024)</xref> demonstrated that the expression of the <italic>CaPR1</italic> (Pathogenesis-related protein 1) in <italic>Capsicum annuum</italic> seedlings, a marker gene employed as indicator of SA pathways activation, is down-regulated with SA elicitation (1, 2.5 and 5 mM) and the cross-talk between jasmonic acid/ethylene and SA mediated signal pathways for the regulation of this gene. Other studies have revealed that the transcriptional activation of SA signaling pathway, rather than its biosynthesis, plays a crucial role in the chilling and freezing tolerance of cucumber and potato fruit, respectively (<xref ref-type="bibr" rid="B84">Sim et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B11">Chen L. et&#xa0;al., 2023</xref>). However, <xref ref-type="bibr" rid="B62">Nguyen et&#xa0;al. (2024)</xref> reported that the ripening quality of mango mirrored the induced SA and jasmonic acid (JA) endogenous levels after liquid methyl salicylate (MeSA) fumigants in postharvest and correlated with the high expression of biosynthetic-related genes. In this sense, in-depth study of both foliar spraying and irrigation methods to pepper plants has received little scientific attention, and the systematic investigation of the mechanism and molecular bases of SA effects in the postharvest physiological process of green pepper fruit remains unclear, which restricts the possibilities for improvement of green pepper fruit quality using preharvest elicitation tools. Therefore, this paper aims to compare the effect of SA preharvest treatment applied by foliar spraying or irrigation on ripening and senescence of green pepper fruit during postharvest storage from an antioxidant metabolism approach to provide deep insight into a practical application of SA on extending the storage shelf-life.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Plant materials, treatments and experimental design</title>
<p>Pepper plants (<italic>Capsicum annuum</italic> L., &#x2018;Lamuyo&#x2019; type), &#x2018;Herminio&#x2019; cultivar, were planted in January 2021 in a commercial plot growing under plastic-roofed greenhouse located in El Raal (Murcia, Spain). The optimal concentration of salicylic acid (SA) was chosen according to the best results observed in our latest study about the evaluation of SA foliar application on crop yield and quality parameters of green pepper fruit during 21 days of storage at 7&#xb0;C (<xref ref-type="bibr" rid="B21">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al., 2021a</xref>). In this study, SA applied at 0.5 mM showed the best results since this treatment increased crop yield, in terms of kg per plant, number of fruits harvested per plant, average fruit weight, fruit quality parameters and bioactive compound content at harvest. In addition, this treatment delayed losses of physio-chemical and functional traits that normally occur during postharvest storage of pepper fruit at non-chilling temperatures, maintaining fruit quality after 21 days of storage. Finally, SA preharvest treatment applied at 0.5 mM was the most effective tool to induce pepper fruit tolerance against decay incidence during storage. Therefore, SA was applied in the present study at 0.5 mM following two different commercial practices: <italic>1)</italic> Foliar spraying [Foliar SA] and <italic>2)</italic> Irrigation [Irrigation SA], while the control plants were treated only with distilled water as a spray [Control]. SA reagent (CAS Number: 69-72-7) was purchased from Sigma (Sigma-Aldrich, Madrid, Spain). Solutions for all treatments were supplemented with Tween 20 [0.05% (<italic>v/v</italic>)]. The foliar spray was carried out with a manual pump, while the root application was performed in the automatic irrigation system was carried out automatically. Plants received irrigation and fertilization according to normal agricultural practices designed by the company for the short-term crop cycle of &#x2018;Lamuyo&#x2019; pepper type, in which rockwood was used as the soil substrate and drip irrigation and optimal nutrient levels were applied. The soil texture was sandy loam with a pH of 7.50.</p>
<p>The experiment was conducted from February to July 2021. The experimental design was completely randomized. Thus, 135 pepper plants were selected and distributed in randomized complete block design with nine replicates or blocks in total. Each treatment was performed in three blocks (n = 3) of 15 plants (45 plants per treatment). Seven exogenous SA applications by foliar spraying or irrigation throughout the crop cycle were performed in the morning (8-9 a.m.), the first treatment being applied before the beginning of the flowering stage. Treatments were applied seven times at a 21-d interval until the harvest date with a total amount of SA supplied of 0.48 g L<sup>-1</sup>. The equidistance among application dates was <italic>ca.</italic> 21 days due to a staggered flowering cycle, except for the last application that was performed close to the last commercial harvest, being chosen based on the crop cycle duration of this pepper cultivar and our previous experience (<xref ref-type="bibr" rid="B21">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al., 2021a</xref>). Application dates of treatments (Control, Foliar SA, and Irrigation SA) throughout the developmental and growth cycle of &#x2018;Herminio&#x2019; green pepper fruit were as follows: T1 (22 February), T2 (15 March), T3 (29 March), T4 (19 April), T5 (17 May), T6 (7 June) and T7 (10 July). Pepper fruits were harvested at the commercial harvest stage when green pepper had reached the phenological stage suitable for its consumption (<xref ref-type="bibr" rid="B20">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al., 2021b</xref>). A total of 10 harvest dates throughout the growth cycle were performed according to a staggered production and the commercial criteria of harvesting green pepper fruit established by the company. The harvest dates started from April until July: 6 April, 20 April, 4 May, 14 May, 26 May, 4 June, 16 June, 26 June, 6 July and 17 July. The mean temperature for each month was recorded: April (16.00&#xb0;C), May (19.30&#xb0;C), June (19.70&#xb0;C) and July (27.20&#xb0;C), using a station close to the experimental greenhouse (38&#xb0;2&#x2019;2.64&#x201d; North, 1&#xb0;1&#x2019;18.9&#x201d; West). Relative humidity (RH) fluctuated between 66 to 89% during the experiment. The crop yield was measured in terms of accumulative crop yield, expressed as kg per plant and number of peppers harvested per plant, for each harvest date along the crop cycle and blocks designed per treatment. In addition, the average fruit weight (g) was calculated by weighing and counting all harvested pepper fruits individually, according to <xref ref-type="bibr" rid="B21">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al. (2021a)</xref>. These results are presented in <xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Figure 1</bold></xref>. The uniform-sized pepper fruits harvested on 20 April were immediately transferred to the research laboratory of Postharvest Group of Fruit and Vegetables and then, they were graded for their uniformity in shape and color, and those fruits free from visual defects and blemishes were selected to carry out a postharvest storage experiment.</p>
<p>For each treatment 90 peppers fruits similar in shape, size and color were selected and weighted individually and stored at 7&#xb0;C and 85% of RH. Thus, 18 pepper fruits were analyzed at harvest (day 0) and 72 pepper fruits in total were stored for each treatment during 21 days of storage. For the postharvest storage experiment, pepper fruits were analyzed after 7, 14, 21 and 28 days of storage. Specifically, 90 pepper fruits were used in total for the analyses of each treatment in the four sampling dates (0, 7, 14, 21 and 28 storage days). For each sampling date, weight loss, firmness, color (hue&#xb0;), total soluble solids (TSS), total acidity (TA) and ripening index (RI) were measured as quality parameters of green pepper fruits during postharvest storage. From a metabolomic approach, the content of chlorophyll a and b, total phenolics, total carotenoids, ascorbic acid (AA) and dehydroascorbic acid (DHA) was quantified at harvest and after 28 days of storage at 7&#xb0;C in freeze-dried samples composed of both flesh and skin tissues. Furthermore, the hydrophilic-total antioxidant activity (H-TAA), lipophilic-total antioxidant activity (L-TAA) and the antioxidant enzymes activities of ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were also determined in freeze-dried material at harvest and after 28 days of postharvest storage. Finally, a genetic approach was also addressed since the relative expression of <italic>CaAPX</italic> [<italic>L</italic>-ascorbate peroxidase (APX) gene], <italic>CaCAT</italic> [catalase (CAT) gene], <italic>CaPOD</italic> [peroxidase (POD) gene], <italic>CaPAL</italic> [phenylalanine ammonia-lyase (PAL) gene] and <italic>CaDHAR2</italic> [dehydroascorbate reductase 2 gene] genes was also analyzed in freeze-dried samples of green pepper fruits at harvest and at the end of the storage period. All analyses were performed on 3 replicates of 6 fruits for each treatment and sampling date studied (18 pepper fruits in total).</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Evaluation of quality parameters during postharvest storage</title>
<sec id="s2_2_1">
<label>2.2.1</label>
<title>Weight loss, firmness and color (hue&#xb0;) of green pepper fruits</title>
<p>Green pepper fruits were initially weighed at harvest (day 0) and after 7, 14, 21 and 28 days of storage. The difference between the initial and final weight of pepper fruit was considered as accumulative weight loss during each storage interval and was expressed as a percentage (%) on a fresh weight basis with respect to pepper fruit weight at harvest. Firmness was evaluated individually in each pepper fruit as deformation force using a digital TX-XT2i Texturometer (Stable Microsystems, Godalming, UK). The machine had a flat steel plate to measure the equatorial fruit diameter and to apply a force that achieved a 5% deformation of its diameter, according to the protocol described by <xref ref-type="bibr" rid="B21">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al. (2021a)</xref>. Results were expressed as a force-deformation ratio (N mm<sup>-1</sup>). After that, 6 pepper fruits from each replicate (18 peppers from each treatment) were used to measure individually the color. Surface color changes of green pepper fruits were reported in hue angle (hue&#xb0;) parameter (arctan b*/a*), according to <xref ref-type="bibr" rid="B29">Garc&#xed;a-Pastor et&#xa0;al. (2021)</xref>. It was measured at three points of the fruit equatorial diameter by using a Minolta Colorimeter CFRC400 (Minolta Camera Co., Kant&#x14d;, Tokio, Japan).</p>
</sec>
<sec id="s2_2_2">
<label>2.2.2</label>
<title>Total soluble solids, total acidity and ripening index of green pepper fruits</title>
<p>A homogeneous sample was prepared from each replicate and treatment by blending the fruit in a blender. The sample was thoroughly mixed, and a few drops were taken on prism of a portable digital refractometer (Atago PR-101, Atago Co., Ltd., Tokyo, Japan) to measure the content of total soluble solids (TSS) of each sample in duplicate at 20&#xb0;C. Results were expressed as g kg<sup>-1</sup> in fresh weight basis (FW). As described by <xref ref-type="bibr" rid="B21">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al. (2021a)</xref>, total acidity (TA) was determined in duplicate from the same sample by titrating 1 mL of diluted juice in 25 mL of distilled H<sub>2</sub>O with 0.1 N NaOH up to a pH of 8.10 using an automatic titration (785 DMP Titrino, Metrohm, Burladingen, Germany). Results were expressed as g of malic acid equivalent kg<sup>-1</sup> FW. Ripening index (RI) was then calculated as the ratio of TSS/TA.</p>
</sec>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Metabolomic analysis at harvest and after 28 days of storage</title>
<sec id="s2_3_1">
<label>2.3.1</label>
<title>Quantification of bioactive compounds</title>
<p>Bioactive compounds were quantified in green pepper fruits at harvest (day 0) and after 28 days of storage at 7&#xb0;C. The chlorophyll a and b, and total carotenoids were extracted according to previously described methods (<xref ref-type="bibr" rid="B49">Knee, 1972</xref>; <xref ref-type="bibr" rid="B94">Xie et&#xa0;al., 2023</xref>) with some modifications. Approximately 0.20 g of fine freeze-dried powder for the three biological replicates (n = 3) were manually grounded in a mortar and pestle and mixed with 5 mL of acetone extract solution containing 0.1% BHT to prevent the pigment from oxidizing. Next, the mixed extraction was ultrasonically extracted for 15 min and then centrifuged at 10,000 <italic>g</italic> for 10 min at 4&#xb0;C to obtain the supernatant. The sample was repeatedly extracted until the residue was colorless. Acetone solution containing 0.1% BHT was used for a constant volume of collected supernatants (25 mL) to the subsequent estimation of chlorophyll and total carotenoid contents. Based on the methods reported by <xref ref-type="bibr" rid="B53">Lichtenthaler and Wellburn (1983)</xref>, the absorbance of the extracts was detected at 470, 645, and 662 nm by spectrophotometric absorbance (UV-1900i-UV-VIS Spectrophotometer, Shimadzu Corporation, Germany) to quantify the chlorophyll and total carotenoid contents, which were calculated from the equations: C<sub>a</sub> = 11.75A<sub>662</sub> - 2.35A<sub>645</sub>, C<sub>b</sub> = 18.6lA<sub>645</sub> - 3.96A<sub>662</sub> and C<sub>TC</sub> = (1000A<sub>470</sub> - 2.27C<sub>a</sub> &#x2212; 81.4C<sub>b</sub>)/227. C<sub>a</sub>, C<sub>b</sub> and C<sub>TC</sub> indicate the content of chlorophyll a, chlorophyll b and total carotenoids (g kg<sup>-1</sup> DW), respectively. The total chlorophyll content was calculated as the sum of the chlorophyll a and chlorophyll b contents (g kg<sup>-1</sup> DW). A<sub>662</sub>, A<sub>645</sub>, A<sub>470</sub> represent absorbances at 662 nm, 645 nm and 470 nm, respectively.</p>
<p>Ascorbic (AA) and dehydroascorbic (DHA) acids were measured in the freeze-dried powder for each replicate (n = 3), according to the methodology of <xref ref-type="bibr" rid="B67">Pe&#xf1;a-Est&#xe9;vez et&#xa0;al. (2016)</xref> with slight modifications. Thus, 0.20 g of fine powder was homogenized manually in a mortar and pestle and mixed with 5 mL of a methanol: water (5:95) solution containing 0.1 mM citric acid, 0.05 mM ethylenediamine tetracetic acid disodium salt, and 4 mM NaF. Then, the extract was filtered through a four-layer cheesecloth and the pH was adjusted to 2.35-2.40 with 2 N HCl. The mixed extraction was centrifuged at 10,000 <italic>g</italic> for 15 min at 4&#xb0;C and the supernatant was purified through a methanol-activated C18 cartridge (Sep-Pak cartridges C18, Waters, Dublin, Ireland) and filtered through a 0.45 &#x3bc;m PFTE filter. For DHA derivatization, 750 &#x3bc;L of extract was mixed with 250 &#x3bc;L of 7.7 M 1,2-phenylenediamine in an HPLC amber vial. The mixture was allowed to react for 37 min and then 20 &#x3bc;L were injected onto a Luna (250 mm &#xd7; 4.6 mm, 5 &#x3bc;m particle size) C18 column (Phenomenex, Macclesfield, UK) with a C18 security guard (4.0 mm &#xd7; 3.0 mm) cartridge system (Phenomenex) using an HPLC system (1200 Infinity series, Agilent Technologies, Waldbronn, Germany). The mobile phase was 50 mM KH<sub>2</sub>PO<sub>4</sub> containing 5 mM hexadecyl trimethylammonium bromide and 5% methanol (pH 4.59) with an isocratic flow of 1 mL min<sup>-1</sup>. Absorbance was recorded at 261 nm for AA (Rt = 9.4 min) and at 348 nm for DHA (Rt = 4.5 min), and both values were quantified by comparison with AA and DHA standard areas (Sigma-Aldrich, Darmstadt, Germany). Total vitamin C was defined as the sum of both AA and DHA content. Results (mean &#xb1; SE) were expressed as g kg<sup>-1</sup> of dry weight (DW).</p>
<p>The quantification of total phenolic compounds (TPC) was carried out from the hydrophilic phase obtained in the total antioxidant activity extraction, as previously described by <xref ref-type="bibr" rid="B20">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al. (2021b)</xref>. Briefly, 5 g of green pepper fruits were homogenized with 10 mL of 50 mM phosphate buffer pH = 7.8 and 5 mL of ethyl acetate using a homogenizer (Ultraturrax, T18 basic, IKA, Berlin, Germany) for 30 s. The extracts were centrifuged at 10,000 <italic>g</italic> for 10 min at 4&#xb0;C and the supernatant was used to quantify the total phenolic content in duplicate in each extract by using the Folin-Ciocalteu reagent (<xref ref-type="bibr" rid="B77">Sayyari et&#xa0;al., 2011</xref>). Results were expressed as g gallic acid equivalent (GAE) kg<sup>-1</sup> of fresh weight (FW) and are the mean &#xb1; SE of three replicates.</p>
</sec>
<sec id="s2_3_2">
<label>2.3.2</label>
<title>Total antioxidant capacity: hydrophilic and lipophilic fractions</title>
<p>Total antioxidant capacity was determined in both hydrophilic and lipophilic fractions at harvest (day 0) and after 28 days of storage at 7&#xb0;C after cutting the pepper fruit, removing its peduncle and seeds, and being frozen with liquid N<sub>2</sub> and stored at -20&#xb0;C. As previously reported in green pepper fruit (<xref ref-type="bibr" rid="B20">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al., 2021b</xref>), 5 g of frozen samples were extracted with 10 mL of 50 mM phosphate buffer pH = 7.8 and 5 mL of ethyl acetate. The extracts were homogenized using a homogenizer (Ultraturrax, T18 basic, IKA, Berlin, Germany) for 30 s and then, centrifugated at 10,000 <italic>g</italic> for 15 min at 4&#xb0;C. Both upper and lower fractions were used to quantify the hydrophilic (H-TAA) and lipophilic (L-TAA) total antioxidant activity, respectively. Both antioxidant fractions were measured in duplicate using a reaction mixture in which ABTS<sup>+</sup> radicals are generated and monitored at 730 nm. Results were expressed as g of Trolox equivalent (TE) kg<sup>-1</sup> FW and are the mean &#xb1; SE (n = 3).</p>
</sec>
<sec id="s2_3_3">
<label>2.3.3</label>
<title>Assays of antioxidant enzymes</title>
<p>The antioxidant activity of ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) enzymes were also determined in freeze-dried powder (flesh + skin tissues) maintained at -80&#xb0;C both at harvest (day 0) and after 28 days of postharvest storage. APX, CAT and POD enzymes were extracted by homogenizing 0.20 g of fine powder with 5 mL of phosphate buffer 50 mM, pH 6.8, containing 1% (<italic>w/v</italic>) of polyvinylpyrrolidone (PVP) and ethylenediamine-tetracetic acid 1 mM. After centrifugation at 10,000 <italic>g</italic> for 15 min at 4&#xb0;C, the supernatant was used to quantify each enzyme activity in duplicate, as reported elsewhere (<xref ref-type="bibr" rid="B29">Garc&#xed;a-Pastor et&#xa0;al., 2021</xref>). Antioxidant enzyme activities were expressed as units of enzymatic activity (U min<sup>-1</sup> g<sup>-1</sup>) of dry weight (DW) with one enzymatic unit (U) being defined as a 0.01 decrease of ascorbate at 290 and 240 nm min<sup>-1</sup> for APX and CAT, respectively, and a 0.01 increase of absorbance at 470 nm min<sup>-1</sup> for POD. Results were the mean &#xb1; SE of three replicates (n = 3).</p>
</sec>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Gene expression analysis at harvest and after 28 days of storage</title>
<p>Plant RNA was extracted from 0.03 g of freeze-dried samples (flesh + skin tissues of green pepper fruit) to analyze the relative expression of targeted genes at harvest (day 0) and after 28 days of storage. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Dusseldorf, Germany) according to manufacturer&#x2019;s instructions, in which a DNase treatment was recommended on the eluted RNA by using Baseline-ZERO DNase (Epicentre/Lucigen USA). RNA quantification was carried out by the spectrophotometric absorbance using an Implen Nanophotometer<sup>&#xae;</sup> (IMPLEN, Munich, Germany). RNA extracts were maintained at -80&#xb0;C. The single-strand cDNA was synthesized from 500 ng of total RNA using the PrimeScript RT Master Mix (Perfect Real Time) kit (Takara Bio, Japan) in a Mastercycler Nexus X2 (Eppendorf, Germany) PCR machine, following the manufacturer&#x2019;s protocol. This synthesis and the subsequent qPCR for the expression of the targeted genes were carried out by Genomic Centre of the Complutense University of Madrid (Madrid, Spain). Total RNA (15-40 ng per reaction) from three biological replicates and treatments was used as the template for the OneStep qPCR reactions.</p>
<p>Two housekeeping genes, ubiquitin (<italic>CaUBI</italic>) and actin (<italic>CaACT</italic>), were selected as reference genes in <italic>Capsicum annuum</italic> L (<xref ref-type="bibr" rid="B50">Li et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B78">Seo et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B31">Ge et&#xa0;al., 2020</xref>). The relative expression of five genes was evaluated as targeted genes: <italic>L</italic>-ascorbate peroxidase gene (<italic>CaAPX</italic>), catalase gene (<italic>CaCAT</italic>), peroxidase gene (<italic>CaPOD</italic>), phenylalanine ammonia-lyase gene (<italic>CaPAL</italic>) and dehydroascorbate reductase 2 gene (<italic>CaDHAR2</italic>). The gene-specific primers used are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. Gene sequences were obtained from the National Center for Biotechnology Information (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/">https://www.ncbi.nlm.nih.gov/</ext-link>). The amplicon length for each primer was 123 pb for <italic>CaUBI</italic>, 130 pb for <italic>CaACT</italic>, 238 pb for <italic>CaAPX</italic>, 104 pb for <italic>CaCAT</italic>, 131 pb for <italic>CaPOD</italic>, 676 pb for <italic>CaPAL</italic> and 136 pb for <italic>CaDHAR2</italic>. The primers for qRT-PCR (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>), purchased from Merck (Sigma-Aldrich, Darmstadt, Germany). The reactions were prepared in duplicate on 384-well plates using PowerUp SYBR<sup>&#xae;</sup> Green Master Mix (Applied Biosystems, California) with the primers at a concentration of 300 nM in a reaction volume of 10 &#xb5;L. The qPCR analysis was performed in a QuantStudio&#x2122; 7 Flex Real-Time PCR System (Applied Biosystems, California) with an initial step at 95&#xb0;C for 10 min followed by 40 cycles of 95&#xb0;C for 15 s and 60&#xb0;C for 1 min. Additionally, the quality of amplicons was controlled by a melt curve analysis step showing no side products. Data obtained from the qPCR was treated with the QuantStudio Reat-Time PCR software (Applied Biosystems, California). Relative targeted gene expression in treated green pepper fruit was normalized using the expression levels of the <italic>CaUBI</italic> and <italic>CaACT</italic> genes and was calculated regarding control fruit using three biological replicates (n = 3).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Genetic details of primers for the reference and targeted genes<sup>&#x3ef;</sup>.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Gene</th>
<th valign="middle" align="center">Forward Primer Sequence (5&#x2019;-3&#x2019;)</th>
<th valign="middle" align="center">Reverse Primer Sequence (5&#x2019;-3&#x2019;)</th>
<th valign="middle" align="center">NCBI Reference</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">
<bold>
<italic>CaUBI</italic>
</bold>
</td>
<td valign="middle" align="center">GGCATGTCTGGGACTTTTGC</td>
<td valign="middle" align="center">AGACCCGTTCCTTGACAACC</td>
<td valign="middle" align="center">AY486137.1</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>
<italic>CaACT</italic>
</bold>
</td>
<td valign="middle" align="center">ACCCTGTGCTTCTCACTGAAG</td>
<td valign="middle" align="center">GCATAAAGAGACAACACCGCC</td>
<td valign="middle" align="center">AY572427.1</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>
<italic>CaAPX</italic>
</bold>
</td>
<td valign="middle" align="center">ACTGGTGGACCGAATGGTTC</td>
<td valign="middle" align="center">GTAACCGCCCTTCCTTTGGA</td>
<td valign="middle" align="center">NM_001324587.1</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>
<italic>CaCAT</italic>
</bold>
</td>
<td valign="middle" align="center">TATCCGATCCCCGAGCAACT</td>
<td valign="middle" align="center">CACAGTGAGACGAGAAGCG</td>
<td valign="middle" align="center">AF227952.1</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>
<italic>CaPOD</italic>
</bold>
</td>
<td valign="middle" align="center">AACAGGGAAACCCGAATGGG</td>
<td valign="middle" align="center">TTTGGTGCAGCCCTCTTCTC</td>
<td valign="middle" align="center">FJ596178</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>
<italic>CaPAL</italic>
</bold>
</td>
<td valign="middle" align="center">ATGCTCTTAGAACGTCGCCC</td>
<td valign="middle" align="center">AAGACGTATTCCCTGTCCACG</td>
<td valign="middle" align="center">NM_001325423</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>
<italic>CaDHAR2</italic>
</bold>
</td>
<td valign="middle" align="center">GTTGATTTGAGCTTGGCCCC</td>
<td valign="middle" align="center">TCTGGAAAGACTCACGCTCG</td>
<td valign="middle" align="center">KJ950368.1</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<bold>
<sup>&#x3ef;</sup>
</bold>Based on National Center for Biotechnology Information (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/">https://www.ncbi.nlm.nih.gov/</ext-link>).</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Statistical analysis</title>
<p>The experiment was conducted using a randomized design with three replicates (n = 3). Data are expressed as mean &#xb1; standard error (SE). Statistical comparisons of the means were performed using one-way analysis of variance (ANOVA) of SPSS software package v. 17.0 for Windows (SPSS, 2001, IBM Corporation, Armonk, NY, USA). The source of variation was treatments. Mean separation was analyzed using Tukey&#x2019;s HSD test to determine whether the differences among treatments were significant at <italic>p</italic> &lt; 0.05. The heatmap analysis was conducted with Microsoft Excel<sup>&#xae;</sup> for Windows (Excel, 2016, Microsoft Corporation, Redmond, Washington, USA).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Foliar and irrigation SA delays quality losses during postharvest storage</title>
<p>SA applied by foliar spraying and irrigation significantly reduced (<italic>p</italic> &lt; 0.05) weight loss in green pepper fruit, &#x2018;Herminio&#x2019; cv., after 28 days of storage at 7&#xb0;C compared to untreated fruits. Specifically, irrigation SA showed a 4.81% of weight loss than the 6.56% achieved in control treatment, with a 1.36-fold reduction, at 28 storage days (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). SA treated green pepper fruits showed the highest firmness levels at harvest (&#x2248; 5.80 N mm<sup>-1</sup>) compared with control (4.42 N mm<sup>-1</sup>), although no significant differences (<italic>p</italic> &#x2265; 0.05) were observed between foliar and irrigation SA treatments (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). The losses of firmness were significantly delayed (<italic>p</italic> &lt; 0.05) by both SA treatments compared to untreated pepper fruits during postharvest storage. Thus, green pepper fruits treated with SA in preharvest had 1.19-fold in firmness values at 28 days of storage as compared with control (&#x2248; 3.14 <italic>vs.</italic> 2.63 N mm<sup>-1</sup>, respectively). The increase was similar for both foliar application and irrigation at the end of storage (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). The highest values of color, expressed in terms of hue&#xb0;, were observed in those pepper fruits treated with foliar and irrigation SA at harvest (&#x2248; 130 hue&#xb0;), although no significant differences (<italic>p</italic> &#x2265; 0.05) were showed between both application methods (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>). On the other hand, color changes during postharvest storage were significantly delayed (<italic>p</italic> &lt; 0.05) by both SA treatments and hue&#xb0; values were higher in pepper fruits from SA treated plants (&#x2248; 125 hue&#xb0;) than in control (&#x2248; 123 hue&#xb0;) during the whole storage period, without significant differences between both SA treatments. It is well known, a higher hue&#xb0; value showed a more intense dark green color in the pepper fruit (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Effect of salicylic acid (SA) applied by foliar spraying [Foliar SA] and irrigation [Irrigation SA] on weight loss (%) <bold>(A)</bold>, firmness (N mm<sup>-1</sup>) <bold>(B)</bold>, color (hue&#xb0;) <bold>(C)</bold>, total soluble solids (g kg<sup>-1</sup>) <bold>(D)</bold>, total acidity (g kg<sup>-1</sup>) <bold>(E)</bold> and ripening index <bold>(F)</bold> of green pepper fruit during 28 days of storage at 7&#xb0;C. Different lowercase letters indicate significant differences at p &lt; 0.05 according to Tukey&#x2019;s HSD test among treatments for each sampling date and parameter tested.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g001.tif"/>
</fig>
<p>Irrigation SA-treated green pepper fruits had a significantly higher (<italic>p</italic> &lt; 0.05) content of total soluble solids (40.80 g kg<sup>-1</sup>) than control fruits at harvest (40.00 g kg<sup>-1</sup>), although those peppers treated with the foliar method did not show any significant differences (<italic>p</italic> &#x2265; 0.05) compared to untreated fruits (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). Total soluble solids increased during postharvest storage at 7&#xb0;C in all treatments, although the highest values were reached in foliar SA-treated fruits at 28 days of storage followed by those pepper fruits treated by irrigation methods (42.60 and 41.90 g kg<sup>-1</sup>, respectively). Thus, control pepper fruits showed the lowest values of total soluble solids of 41.10 g kg<sup>-1</sup> at the end of postharvest storage at 7&#xb0;C (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>). The highest levels of total acidity were observed in foliar SA treatment at harvest followed by irrigation SA treatment (1.56 and 1.44 g kg<sup>-1</sup>, respectively; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>). Total acidity decreased during postharvest storage until it reached the lowest values (0.93 g kg<sup>-1</sup>) in untreated fruits. However, those green pepper fruits treated with SA showed a content of total acidity around 1.12 g kg<sup>-1</sup> at the end of storage, although no significant differences (<italic>p</italic> &#x2265; 0.05) were appreciated between both treatments. Therefore, both SA applied by foliar spraying and irrigation delayed losses of total acidity in green pepper fruit stored at 7&#xb0;C for 28 days (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>). Ripening index was significantly higher (<italic>p</italic> &lt; 0.05) in control pepper fruits at harvest (30.58) and after 28 days of postharvest storage (44.24) than SA treated ones (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1F</bold>
</xref>). When comparing both application methods studied for the SA application in preharvest, foliar SA treatment significantly showed (<italic>p</italic> &lt; 0.05) the lowest ripening index with a value of 25.98 at harvest while the irrigation SA method was the most effective treatment to delay the ripening during postharvest storage (ripening index of 37.28; <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1F</bold>
</xref>).</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Foliar and irrigation SA enhances the bioactive compound content and the antioxidant capacity at harvest and during postharvest storage</title>
<p>The chlorophyll a and b content, as well as the total chlorophyll content calculated as the sum of both individual forms, followed the same pattern to all treatments for both studied times (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>). Chlorophyll a was the major chlorophyll pigment in green pepper fruit, &#x2018;Herminio&#x2019; cv., since its content was 2-fold higher than chlorophyll b. Both SA treatments significantly increased (<italic>p</italic> &lt; 0.05) the content of both chlorophylls than control at harvest (&#x2248; 5.58 <italic>vs</italic>. 4.27 g kg<sup>-1</sup> for chlorophyll a and &#x2248; 2.71 <italic>vs.</italic> 2.02 g kg<sup>-1</sup>for chlorophyll b) and after 28 days of storage (&#x2248; 5.32 <italic>vs.</italic> 4.01 g kg<sup>-1</sup> for chlorophyll a and 2.54 <italic>vs.</italic> 1.93 g kg<sup>-1</sup> for chlorophyll b), although no significant differences were observed between foliar and irrigation SA treatments (<italic>p</italic> &#x2265; 0.05) (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;D</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;2A, B</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Effect of salicylic acid (SA) applied by foliar spraying [Foliar SA] and irrigation [Irrigation SA] on chlorophyll a and chlorophyll b content (g kg<sup>-1</sup> DW) of green pepper fruit at harvest [<bold>A, C</bold>, respectively] and after 28 days of storage at 7&#xb0;C [<bold>B, D</bold>, respectively]. Different lower case letters indicate significant differences at p &lt; 0.05 according to Tukey&#x2019;s HSD test among treatments for each parameter tested at harvest or after 28 days of storage..</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g002.tif"/>
</fig>
<p>Results showed that foliar and irrigation SA treatments reduced the rate of decline on chlorophyll a content (5.02 and 4.30%, respectively) after 28 days of storage compared to control (6.08%). However, only those green pepper fruits irrigated with SA showed the lowest rate of decline on chlorophyll b content. Thus, both SA treatments enhanced the total chlorophyll content in green pepper fruits at harvest (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;2A</bold>
</xref>) and after 28 days of storage (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;2B</bold>
</xref>) in the same way (<italic>p</italic> &#x2265; 0.05) than untreated fruits. This result could influence the maintenance of the intense dark green color of pepper fruit during postharvest, as it can be observed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>. Total phenolic content was significantly enhanced (<italic>p</italic> &lt; 0.05) at harvest and after 28 days of storage in those green pepper fruits treated with SA (0.71 and 0.91 g kg<sup>-1</sup>, respectively) compared to control fruits (0.64 and 0.69 g kg<sup>-1</sup>, respectively), although no significant differences (<italic>p</italic> &#x2265; 0.05) were appreciated between both application methods (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, D</bold>
</xref>). The significant differences between SA treated and untreated pepper fruits were higher at the end of the storage, showing an increase of 1.32-fold on total phenolics caused by SA treatment (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>). Compared with the values at harvest, the increase rate of phenolics compounds (21.97%) was enhanced by both SA applications during postharvest storage than control fruits (7.24%).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Effect of salicylic acid (SA) applied by foliar spraying [Foliar SA] and irrigation [Irrigation SA] on total phenolic (g kg<sup>-1</sup> FW) and ascorbic acid (AA) and dehydroascorbic acid (DHA) content (g kg<sup>-1</sup> DW) of green pepper fruit at harvest [<bold>A&#x2013;C</bold>, respectively] and after 28 days of storage at 7&#xb0;C [<bold>D&#x2013;F</bold>, respectively]. Different lower case letters indicate significant differences at p &lt; 0.05 according to Tukey&#x2019;s HSD test among treatments for each parameter tested at harvest or after 28 days of storage.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g003.tif"/>
</fig>
<p>Ascorbic acid (AA) and dehydroascorbic acid (DHA) content were enhanced with the SA preharvest application than control treatment both at harvest (&#x2248; 0.30 <italic>vs.</italic> 0.16 g kg<sup>-1</sup> for AA and 0.76 <italic>vs.</italic> 0.58 g kg<sup>-1</sup> for DHA) and after 28 days of storage (&#x2248; 0.19 <italic>vs.</italic> 0.10 g kg<sup>-1</sup> for AA and 0.65 <italic>vs.</italic> 0.48 g kg<sup>-1</sup> for DHA). Nevertheless, no significant differences (<italic>p</italic> &#x2265; 0.05) were observed between both SA application ways. The DHA content was 2-fold higher than AA content in green pepper fruit and both forms of vitamin C were degraded during storage for all treatments. However, SA treatment delayed this functional degradation by 44% (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3B, C, E, F</bold>
</xref>). In fact, the irrigation SA treatment showed a decrease rate on AA content of 36.66% than control green pepper fruits (37.50%) from harvest until 28 days of storage at 7&#xb0;C. Nevertheless, those pepper fruits harvested from plants treated with SA by foliar spraying presented the lowest percentage of decrement on DHA content (9.21%) compared with the control ones (17.24%). Total vitamin C, expressed as the sum of both AA and DHA forms, was also significantly enhanced (<italic>p</italic> &lt; 0.05) by the two SA treatments studied in the same proportion (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;3A, B</bold>
</xref>). Hydrophilic (H-TAA) and lipophilic (L-TAA) total antioxidant activity was significantly improved (<italic>p</italic> &lt; 0.05) with SA preharvest treatments compared to control both at harvest (&#x2248; 1.38 <italic>vs.</italic> 1.10 g kg<sup>-1</sup> for H-TAA and 0.51 <italic>vs.</italic> 0.36 g kg<sup>-1</sup> for L-TAA) and after 28 days of storage (&#x2248; 1.55 <italic>vs.</italic> 1.23 g kg<sup>-1</sup> for H-TAA and 0.59 <italic>vs.</italic> 0.50 g kg<sup>-1</sup> for L-TAA) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A&#x2013;D</bold>
</xref>). Specifically, foliar SA application was the most effective treatment stimulating the H-TAA at harvest compared to other treatments (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). However, these significant differences (<italic>p</italic> &lt; 0.05) between both application methods of SA were not observed after 28 storage days (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). The increment of H-TAA from harvest to the end of the postharvest period was highest in those green pepper fruits irrigated with SA compared to control treatment (11.92 <italic>vs.</italic> 9.83%). Similarly, no significant differences (<italic>p</italic> &#x2265; 0.05) were appreciated between foliar and irrigation SA methods on L-TAA (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). Finally, carotenoids content did not show any significant differences (<italic>p</italic> &#x2265; 0.05) among treatments (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;4A, B</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Effect of salicylic acid (SA) applied by foliar spraying [Foliar SA] and irrigation [Irrigation SA] on hydrophilic total antioxidant activity (H-TAA) and lipophilic total antioxidant activity (L-TAA) (g kg<sup>-1</sup> FW) of green pepper fruit at harvest [<bold>A, C</bold>, respectively] and after 28 days of storage at 7&#xb0;C [<bold>B, D</bold>, respectively]. Different lower case letters indicate significant differences at p &lt; 0.05 according to Tukey&#x2019;s HSD test among treatments for each parameter tested at harvest or after 28 days of storage.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g004.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Foliar and irrigation SA modulates antioxidant enzyme activities and the relative antioxidant systems-based gene expression at harvest and during postharvest storage</title>
<p>Foliar and irrigation SA treatments significantly stimulated (<italic>p</italic> &lt; 0.05) the APX activity compared to control at harvest (&#x2248; 354 and 372 U min<sup>-1</sup> g<sup>-1</sup>, respectively, <italic>vs.</italic> 279 U min<sup>-1</sup> g<sup>-1</sup>) and after 28 days of storage (&#x2248; 468 and 501 U min<sup>-1</sup> g<sup>-1</sup>, respectively, <italic>vs.</italic> 327 U min<sup>-1</sup> g<sup>-1</sup>), although no significant differences (<italic>p</italic> &#x2265; 0.05) were appreciated between both application methods (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, D</bold>
</xref>). This effect could be related to the upregulation of the relative <italic>CaAPX</italic> gene expression detected by foliar and irrigation SA treatments at harvest (relative expression of 2.70 and 3.57, respectively), disappearing this effect after 28 days of storage at 7&#xb0;C (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, F</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Effect of salicylic acid (SA) applied by foliar spraying [Foliar SA] and irrigation [Irrigation SA] on ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) activities (U min<sup>-1</sup> g<sup>-1</sup> DW) of green pepper fruit at harvest [<bold>A&#x2013;C</bold>, respectively] and after 28 days of storage at 7&#xb0;C [<bold>D&#x2013;F</bold>, respectively]. Different lower case letters indicate significant differences at p &lt; 0.05 according to Tukey&#x2019;s HSD test among treatments for each parameter tested at harvest or after 28 days of storage.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g005.tif"/>
</fig>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Effect of salicylic acid (SA) applied by foliar spraying [Foliar SA] and irrigation [Irrigation SA] on the relative <italic>CaAPX</italic>, <italic>CaCAT</italic>, <italic>CaPOD</italic>, <italic>CaPAL</italic>, and <italic>CaDHAR2</italic> genes expression of green pepper fruit at harvest [<bold>A&#x2013;E</bold>, respectively] and after 28 days of storage at 7&#xb0;C [<bold>F&#x2013;J</bold>, respectively]. Different lower case letters indicate significant differences at p &lt; 0.05 according to Tukey&#x2019;s HSD test among treatments for each parameter tested at harvest or after 28 days of storage.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g006.tif"/>
</fig>
<p>CAT activity was only significantly stimulated (<italic>p</italic> &lt; 0.05) in those green pepper fruits treated with SA by irrigation at harvest (&#x2248; 286 U min<sup>-1</sup> g<sup>-1</sup>) and no significant differences (<italic>p</italic> &#x2265; 0.05) were observed between foliar SA and control treatments (&#x2248; 271 and 247 U min<sup>-1</sup> g<sup>-1</sup>, respectively) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). Nevertheless, this difference was accentuated during postharvest storage and both SA preharvest treatments significantly increased (<italic>p</italic> &lt; 0.05) the activity of CAT antioxidant enzyme than control fruits in the same way (&#x2248; 116 <italic>vs.</italic> 48 U min<sup>-1</sup> g<sup>-1</sup>) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). When the effect of SA was studied on the relative <italic>CaCAT</italic> gene expression, no significant differences (<italic>p</italic> &#x2265; 0.05) were observed on the modulation of this targeted gene either at harvest nor during postharvest storage (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6B, G</bold>
</xref>). Foliar and irrigation SA treatment significantly activated (<italic>p</italic> &lt; 0.05) the POD enzyme at harvest reaching values of 575.46 and 741.02 U min<sup>-1</sup> g<sup>-1</sup>, respectively, compared with control (356.75 U min<sup>-1</sup> g<sup>-1</sup>) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). This effect was also observed after 28 days of storage since those foliar and irrigation SA-treated green pepper fruits exhibited values of POD of 39.65 and 42.34 U min<sup>-1</sup> g<sup>-1</sup>, respectively, compared with untreated fruits (30.85 U min<sup>-1</sup> g<sup>-1</sup>) (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5F</bold>
</xref>). In this sense, SA applied by foliar spraying and irrigation significantly upregulated (<italic>p</italic> &lt; 0.05) the relative <italic>CaPOD</italic> gene expression at harvest by 1.94 and 1.50, respectively (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Thus, the highest effect was observed for the preharvest foliar treatment, and it was maintained after 28 storage days only in those green pepper fruits treated with foliar SA with a relative expression of 1.34 (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6H</bold>
</xref>). The relative <italic>CaPAL</italic> gene expression was only upregulated at harvest with a value of 1.73 after the foliar SA application, while both foliar and irrigation SA treatments upregulated the relative <italic>CaDHAR2</italic> gene expression at harvest in green pepper fruits (relative expression of 2.25 and 2.43, respectively) (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6E</bold>
</xref>). However, SA did not modulate (<italic>p</italic> &#x2265; 0.05) the expression of these two targeted genes after 28 days of storage at 7&#xb0;C (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6I, J</bold>
</xref>).</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Bell pepper (<italic>Capsicum annuum</italic> L.) is a model for studying the ripening and senescence processes of non-climacteric fleshy fruit, during which numerous physiological changes occur, the most noticeable being the color change caused by chlorophyll degradation and the synthesis of new pigments such as carotenoids (<xref ref-type="bibr" rid="B6">Chaki et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B57">Ma et&#xa0;al., 2021</xref>). Nevertheless, numerous changes occur during the ripening of bell pepper fruit, including alterations in flavor, aroma, and texture, which are regulated by both external and internal factors (<xref ref-type="bibr" rid="B65">Palma et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B48">Klie et&#xa0;al., 2014</xref>). For instance, phenological stages and harvest dates are two key factors that significantly influence some nutritional and functional traits of green pepper fruit, as it was unveiled by <xref ref-type="bibr" rid="B20">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al. (2021b)</xref>. Fruit ripening and senescence involve complex and highly coordinated molecular and biochemical processes that include ripening-associated genes, transcription factors, enzymes, repressors, signaling molecules, and metabolic pathways in both climacteric and non-climacteric fruits (<xref ref-type="bibr" rid="B13">Cherian et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B26">Fuentes et&#xa0;al., 2019</xref>). These processes influence fruit quality on one hand and postharvest losses on the other.</p>
<p>As fruit ripens or undergoes senescence, it becomes more susceptible to fungal pathogens (<xref ref-type="bibr" rid="B1">Alkan and Fortes, 2015</xref>), leading to green pepper fruit deterioration. Cold storage is widely adopted to prevent premature ripening and senescence since this fruit is highly perishable at ambient temperatures. However, green bell pepper is susceptible to chilling injury (CI) at temperatures below 7&#xb0;C (<xref ref-type="bibr" rid="B54">Lim et&#xa0;al., 2007</xref>). Consequently, common strategies to slow down senescence and preserve fruit quality include both pre- and postharvest management practices and technological tools. Many factors, however, such as various plant hormones and biotic and abiotic stresses are known to influence bell pepper fruit ripening (<xref ref-type="bibr" rid="B87">Sun et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B12">Cheng et&#xa0;al., 2016</xref>). Recently, numerous studies have shown that salicylic acid (SA) preharvest treatment applied by foliar spraying influences the ripening and senescence of fruit species, such as sweet cherry (<xref ref-type="bibr" rid="B34">Gim&#xe9;nez et&#xa0;al., 2014</xref>), table grape (<xref ref-type="bibr" rid="B7">Champa et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B36">Gomes et&#xa0;al., 2021</xref>), jujube fruit (<xref ref-type="bibr" rid="B81">Shanbehpour et&#xa0;al., 2020</xref>), pomegranate fruit (<xref ref-type="bibr" rid="B30">Garc&#xed;a-Pastor et&#xa0;al., 2020</xref>), lemon (<xref ref-type="bibr" rid="B79">Serna-Escolano et&#xa0;al., 2021</xref>) and green pepper (<xref ref-type="bibr" rid="B21">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al., 2021a</xref>), showing activation of the antioxidant system and a delay in fruit senescence, as it was highlighted by <xref ref-type="bibr" rid="B10">Chen S. et&#xa0;al. (2023)</xref>. The present study showed that SA preharvest treatment applied by both foliar spraying and irrigation enhanced the fruit quality of green pepper fruit resulting in a slowdown of the ripening and senescence processes during postharvest storage at 7&#xb0;C (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>). As it can be observed in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>, this fact could be modulated throughout the stimulation of the antioxidant system accompanied by an increase on the content of secondary metabolites and the activity of antioxidant enzymes that is mediated by the upregulation of their codifying gene expressions.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>A hypothetical working model illustrates the role of preharvest 0.5 mM SA treatment delaying green pepper fruit ripening and senescence during storage at 7&#xb0;C using a regulatory network model for some targeted metabolites and genes. Green arrows represent stimulation of metabolites or functional parameters and an up-regulation of the gene expression. SA preharvest treatment at 0.5 mM increases secondary metabolites (ascorbic acid and dehydroascorbic acid, total phenolic content, carotenoids and chlorophylls) and stimulates both the hydrophilic and lipophilic total antioxidant activity, as well as antioxidant enzymes (catalase, ascorbate peroxidase and peroxidase), reducing probably ROS accumulation, thereby delaying fruit ripening and senescence. This metabolomic modulation has been mediated by increasing the expression of <italic>CaAPX</italic>, <italic>CaCAT</italic>, <italic>CaPOD</italic>, <italic>CaPAL</italic> and <italic>CaDHAR2</italic> genes by SA [For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article]. Abbreviations: SA (salicylic acid), AA (ascorbic acid), DHA (dehydroascorbic acid), TPC (total phenolic content), H-TAA (hydrophilic-total antioxidant activity), L-TAA (lipophilic-total antioxidant activity), CAT (catalase), APX (ascorbate peroxidase), POD (peroxidase), <italic>CaAPX</italic> [<italic>L</italic>-ascorbate peroxidase (APX) gene], <italic>CaCAT</italic> [catalase (CAT) gene], <italic>CaPOD</italic> [peroxidase (POD) gene], <italic>CaPAL</italic> [phenylalanine ammonia-lyase (PAL) gene] and <italic>CaDHAR2</italic> [dehydroascorbate reductase 2 gene], ROS (Reactive Oxygen Species).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g007.tif"/>
</fig>
<p>Fruit quality is related to the ripening and senescence of fruit during storage, which is involved in fruit softening, weight loss, color change, ethylene production and respiration rate (<xref ref-type="bibr" rid="B28">Gao et&#xa0;al., 2020</xref>). Salicylic acid (SA) regulates growth in plants, playing an efficient role in growth and development, flowering and fruit ripening, and photosynthesis (<xref ref-type="bibr" rid="B60">Natasha et&#xa0;al., 2020</xref>). Many studies have also indicated that SA and its derivatives play an important role in regulating the physiological metabolism of fruit to achieve optimal fruit quality and to maintain it during postharvest (<xref ref-type="bibr" rid="B90">Valverde et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B35">Gim&#xe9;nez et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B39">Hanif et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B2">Amiri et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B10">Chen S. et&#xa0;al., 2023</xref>). Over the past ten years, biochemical data have also indicated that the bell pepper fruit ripening process is influenced by the metabolism of reactive oxygen species (ROS) and nitrogen oxygen species (NOS) (<xref ref-type="bibr" rid="B66">Palma et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B15">Corpas and Palma, 2018</xref>; <xref ref-type="bibr" rid="B14">Corpas et&#xa0;al., 2018</xref>), which reflects the profound biochemical and molecular changes taking place during ripening (<xref ref-type="bibr" rid="B5">Camejo et&#xa0;al., 2015</xref>). The accumulation of the reactive oxygen species (ROS) including hydroxyl radical, superoxide and hydrogen peroxide during fruit ripening can cause oxidative damage leading to membrane lipid breakdown and loss of cellular turgor, triggering cell death and damage in fruit tissue (<xref ref-type="bibr" rid="B7">Champa et&#xa0;al., 2014</xref>). The beneficial effect of SA has been recently related to its capacity to improve photosynthesis and the activity of antioxidant enzymes, leading to maintaining the balance between the production and elimination of ROS (<xref ref-type="bibr" rid="B3">Batista et&#xa0;al., 2019</xref>). In the present study, results show a significant effect of both foliar and irrigation SA on activating the APX and POD by upregulating the relative <italic>CaAPX</italic> and <italic>CaPOD</italic> gene expression, respectively, at harvest (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, C</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>6A, C</bold>
</xref>). Results showed that SA treatment applied by foliar spraying was more effective on increasing <italic>CaPOD</italic> gene expression than SA, irrigation treatment, although this effect was not reflected in a higher POD activity in those foliar SA-treated peppers than the irrigated ones (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). Nevertheless, SA treatment applied by irrigation was the most effective in stimulating CAT activity at harvest (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>), although this effect was not mediated through the upregulation of the relative <italic>CaCAT</italic> gene expression (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). The effect of SA treatment on activating the antioxidant enzymes activity at harvest has been demonstrated in the present study and results show that this plant growth regulator could have a potential effect modulating the antioxidant enzymes-gene expression. These results propose that the enzymatic antioxidants can offset the damaging effects of ROS metabolism on cell structure (<xref ref-type="bibr" rid="B36">Gomes et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B79">Serna-Escolano et&#xa0;al., 2021</xref>), which results in a slowdown in ripening process and an increase on quality traits at harvest (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). In fact, the ripening index (RI) was deeply correlated (negatively, Pearson) with firmness, color, TSS, TA, chlorophylls, phenolics, antioxidant capacity and antioxidant enzymatic system, except with the carotenoids content which also showed a similar correlation pattern (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Some studies corroborate these findings regarding the activation of enzymatic systems by the application of SA and its derivatives [Methyl salicylate (MeSA) and Acetylsalicylic acid (ASA)], leading to the high antioxidant activity in sweet cherry (<xref ref-type="bibr" rid="B34">Gim&#xe9;nez et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B100">Zhang et&#xa0;al., 2011</xref>), pomegranate fruit (<xref ref-type="bibr" rid="B30">Garc&#xed;a-Pastor et&#xa0;al., 2020</xref>), citrus (<xref ref-type="bibr" rid="B104">Zhu et&#xa0;al., 2016</xref>), papaya (<xref ref-type="bibr" rid="B39">Hanif et&#xa0;al., 2020</xref>) and banana (<xref ref-type="bibr" rid="B95">Xu et&#xa0;al., 2019</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Pearson correlation heatmap of green pepper fruit qualities, metabolites and antioxidant system and targeted genes at harvest (AH) <bold>(A)</bold> and after 28 days of postharvest storage (PS) at 7&#xb0;C <bold>(B)</bold>. Fruit quality includes weight loss, firmness, color, total soluble solids (TSS), total acidity (TA) and ripening index (RI). Metabolites and antioxidant systems include chlorophyll a, chlorophyll b, total chlorophylls, total phenolics, ascorbic acid (AA), dehydroascorbic acid (DHA), hydrophilic-total antioxidant activity (H-TAA), lipophilic-total antioxidant activity (L-TAA), ascorbate peroxidase (APX), catalase (CAT), peroxidase (POD), and carotenoids. Targeted genes based on the antioxidant enzymatic system including the relative expression of <italic>CaAPX</italic> gene, <italic>CaCAT</italic> gene, <italic>CaPOD</italic> gene, <italic>CaPAL</italic> gene and <italic>CaDHAR2</italic> gene. The range runs from -1 = green to 1 = blue, which represents the correlation coefficient between the fruit qualities and metabolomic and genetic parameters of the antioxidant system run from -1 to 1.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-16-1475068-g008.tif"/>
</fig>
<p>Phenolic compounds have antioxidant activity, which not only scavenge free radicals and reduce oxidative damage to fruits, but also contribute to fruit flavor and quality maintenance. Their biosynthesis is involved in phenylpropanoid pathway of plant secondary metabolites. Phenylalanine ammonia-lyase (PAL) is the first step to catalyze the conversion of phenylalanine to cinnamic acid which is further converted to phenolic acid (<xref ref-type="bibr" rid="B64">Oraei et&#xa0;al., 2019</xref>). The enzyme activity of PAL could be enhanced by SA (<xref ref-type="bibr" rid="B103">Zhou et&#xa0;al., 2018</xref>), increasing phenolic content in oranges (<xref ref-type="bibr" rid="B2">Amiri et&#xa0;al., 2021</xref>) and table grapes (<xref ref-type="bibr" rid="B4">Blanch et&#xa0;al., 2020</xref>). In the present study, SA treatment applied by foliar spraying upregulated the relative <italic>CaPAL</italic> gene expression at harvest (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>), which led to a significant increase in the total phenolic content (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). However, the irrigation-SA treatment also showed an enhancement in phenolic compounds as compared with control (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>), although these findings were not corroborated by the analysis of the <italic>CaPAL</italic> targeted gene (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>). In this sense, previous transcriptomic and metabolic profiling of watermelon uncovered the role of SA pretreatment up-regulating the expression of flavonoid biosynthesis genes, thus increasing the total flavonoid content (<xref ref-type="bibr" rid="B56">Liu et&#xa0;al., 2023</xref>). Furthermore, transcriptome analysis and exogenous SA treatment demonstrated that SA (NPR1) is involved in the positive regulation of flavonoid biosynthesis (<xref ref-type="bibr" rid="B93">Wu et&#xa0;al., 2021</xref>).</p>
<p>On the other hand, SA treatment increased ascorbic acid content which is an essential plant antioxidant vital for defense against oxidative stress, leading to alleviating damages induced by ROS accumulation. In this sense, the content of both AA and DHA was quantified at harvest (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3B, C</bold>
</xref>), as well as the relative <italic>CaDHAR2</italic> gene expression which is involved in the biosynthesis of the cytoplasmic enzyme DHAR2, namely dehydroascorbate reductase, implicated on the catalyzation of the glutathione (GSH)-dependent reduction of dehydroascorbate and had a direct role in regenerating ascorbic acid (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6E</bold>
</xref>). Results suggest that both SA applications (foliar and irrigation) effectively enhanced the AA and DHA content, and consequently, the total vitamin C content, throughout the upregulation of the <italic>CaDHAR2</italic> gene expression at harvest, although no significant differences were appreciated between both methods (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6E</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>3B, C</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3A</bold>
</xref>). The form of AA can neutralize radicals to retard oxidative reactions triggering the ripening process in plant tissues (<xref ref-type="bibr" rid="B41">Huang et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B76">Sangprayoon et&#xa0;al., 2019</xref>). Other studies corroborate these findings hypothesizing that the application of SA could enhance the antioxidant ability by inhibiting the ascorbic acid oxidase (AAO) enzyme, which would affect the ascorbate-glutathione cycle positively, leading to the high content of AA in orange fruit (<xref ref-type="bibr" rid="B2">Amiri et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B39">Hanif et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B92">Wei et&#xa0;al., 2011</xref>). Other reports indicated that SA, MeSA, or ASA treatments could lead to high content of DHA in fruit, which is oxidized from AA by the AAO enzyme in pomegranate fruit and table grapes (<xref ref-type="bibr" rid="B30">Garc&#xed;a-Pastor et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B40">Hazarika and Marak, 2022</xref>).</p>
<p>Bell pepper ripening is characterized by important visual and metabolic changes regulated by transcription factors, with color changes caused by chlorophyll degradation and biosynthesis of new pigments such as carotenoids (<xref ref-type="bibr" rid="B6">Chaki et&#xa0;al., 2015</xref>). In the present study, both SA treatments applied by foliar spraying and irrigation significantly influenced the content of these pigments at harvest (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, C</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2A</bold>
</xref>), the highest levels of chlorophylls a and b were recorded in those green pepper fruits harvested from 0.5 mM SA-treated plants (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>). Multiple biological functions have been reported for chlorophylls as lipophilic-nature pigments. Strictly related to their antioxidant capabilities, two main mechanisms can be described: Their direct free-radical-scavenging activity and the metabolic activation of detoxification pathways, as was reported by <xref ref-type="bibr" rid="B69">P&#xe9;rez-G&#xe1;lvez et&#xa0;al. (2020)</xref>. Accordingly, exogenous SA increased chlorophyll content under drought and salinity conditions (<xref ref-type="bibr" rid="B89">Tang et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B33">Ghassemi-Golezani et&#xa0;al., 2018</xref>). Some studies showed that there was a positive correlation between TPC and TAA (<xref ref-type="bibr" rid="B2">Amiri et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B92">Wei et&#xa0;al., 2011</xref>), considering also the contribution of ascorbic acid. The present study shows the positive correlation observed between total phenolics and AA and DHA content (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). In this sense, the H-TAA (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>) was significantly improved by SA preharvest treatments at harvest, although the highest stimulation was achieved with foliar spraying. Since no significant differences were recorded between the two application methodologies on total phenolics or vitamin C content (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;C</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;3A</bold>
</xref>), probably other hydrophilic antioxidant compounds, such as glutathione (GSH), could be highly influenced by foliar SA treatment. As opposed to H-TAA, the analyses of the L-TAA at harvest showed that this parameter was stimulated by both SA applications, although no significant differences were observed between both methodologies (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>). This functional increment with the application of SA at 0.5 mM is corroborated by a previous study in &#x2018;Lamuyo&#x2019; green pepper fruit and could be related to the enhancement chlorophyll a and b content by the application of SA that has been demonstrated in the present study (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, C</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figures&#xa0;2A</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>5</bold>
</xref>). Preharvest applications of SA have been reported to increase the antioxidant capacities of grapes (<xref ref-type="bibr" rid="B7">Champa et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B36">Gomes et&#xa0;al., 2021</xref>), Indian jujube (<xref ref-type="bibr" rid="B81">Shanbehpour et&#xa0;al., 2020</xref>), lemon (<xref ref-type="bibr" rid="B79">Serna-Escolano et&#xa0;al., 2021</xref>), pomegranate fruit (<xref ref-type="bibr" rid="B30">Garc&#xed;a-Pastor et&#xa0;al., 2020</xref>), and sweet cherry (<xref ref-type="bibr" rid="B34">Gim&#xe9;nez et&#xa0;al., 2014</xref>). Accordingly, SA preharvest treatment has a beneficial impact on the quality of green pepper fruit, &#x2018;Herminio&#x2019; cv., at harvest which results in a slowdown in the ripening process (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>). At harvest, quality traits such as color and firmness were positively correlated and both showed a deep correlation (positively, Pearson) with the antioxidant compounds and the activity of the antioxidant enzymes, although no correlation was observed with the targeted genes (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Specifically, the relative expression of <italic>CaDHAR2</italic> gene was highly correlated with firmness, color, chlorophylls, phenolics, AA, DHA, L-TAA, APX and the expression of <italic>CaAPX</italic> gene (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>; positively, Pearson). The action mechanism proposed in the present study is the following: <italic>1)</italic> SA induces the synthesis of secondary metabolites and enhances the antioxidant systems by stimulating the phenylpropanoid biosynthesis pathway, and <italic>2)</italic> SA activates the antioxidant enzymes, acting on the modulation of the relative antioxidant systems-based genes expression and regulating the balance between the antioxidant system and ROS metabolism, contributing to antioxidant metabolism insights (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>).</p>
<p>The senescence delay triggered by the foliar and irrigation application of 0.5 mM SA extended the shelf-life of &#x2018;Lamuyo&#x2019; green pepper fruit since the preharvest treatment reduced fruit quality losses (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>). The contribution to extending shelf-life and delaying fruit senescence for 28 days at 7&#xb0;C could be attributed to the enhancement of both total phenolics (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>) and antioxidant capacity from hydrophilic and lipophilic phases (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4B, D</bold>
</xref>) with both SA applications which might reduce the oxidative damage (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). Regarding the functional increment related to phenolics content after harvest, results showed the highest increase rate in those green pepper harvested from SA-treated plants. However, the highest increment on H-TAA after 28 storage days was observed in those pepper fruits irrigated with SA, leading to a higher stimulating effect of the antioxidant system in those pepper fruits treated with SA. Similar findings applying salicylates in preharvest have been obtained in sweet cherry (<xref ref-type="bibr" rid="B90">Valverde et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B100">Zhang et&#xa0;al., 2011</xref>), pomegranate fruit (<xref ref-type="bibr" rid="B30">Garc&#xed;a-Pastor et&#xa0;al., 2020</xref>), lemon (<xref ref-type="bibr" rid="B79">Serna-Escolano et&#xa0;al., 2021</xref>) and plum (<xref ref-type="bibr" rid="B16">Davarynejad et&#xa0;al., 2015</xref>). Other contributing aspects to the delay in senescence could be related to the higher levels of two forms of ascorbic acids (AA and DHA; <xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3E, F</bold>
</xref>) quantified in those green pepper fruits treated with foliar and irrigation SA. Moreover, foliar and irrigation SA treatments lead to higher increase rate on DHA and AA content, respectively, compared to control from harvest until 28 days of storage. In this sense, <xref ref-type="bibr" rid="B75">Ruoyi et&#xa0;al. (2005)</xref> indicated that this effect is mediated by the inactivation of the AAO enzymatic activity, which might have caused a delay in the senescence of peppers in the later stages of the storage period. The inhibition of AAO was also advantageous in keeping vitamin C and for anti-browning in sweet pepper (<xref ref-type="bibr" rid="B71">Rao et&#xa0;al., 2011</xref>). Recently, the coordinated regulatory network of ncRNAs involved in the ripening&#xa0;of&#xa0;bell pepper fruit has been analyzed (<xref ref-type="bibr" rid="B105">Zuo et&#xa0;al., 2019</xref>), providing a theoretical basis for deciphering novel mechanisms of fruit&#xa0;ripening in future studies. In the present study, the increase in secondary metabolites, such as phenolics or vitamin C, mediated by&#xa0;SA was not correlated with the upregulation of the relative <italic>Ca</italic>PAL gene expression after 28 days of storage at 7&#xb0;C, as it can be observed in <xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>. Similarly, both SA applications did not modulate the response of <italic>CaDHAR2</italic> gene after 28 storage days (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6J</bold>
</xref>). This finding could be related to the fact that SA was applied in preharvest upregulating both genes at harvest, and probably during the crop cycle, although the modulation effect is lost during postharvest storage.</p>
<p>On the other hand, a delay in senescence is commonly associated with a delay in color changes and this effect was observed in the present study from a metabolomic approach, where chlorophylls a and b content were significantly higher in both foliar and irrigation SA-treated pepper fruits than control (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2B, D</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2B</bold>
</xref>), as it was previously discussed. In addition, the rate of decline on chlorophyll a and b from harvest date until the end of postharvest storage was lower in both SA treatments, especially with the irrigation method, compared to control. This result shows a preserving effect on green color maintenance after postharvest storage associated with the SA treatments, as it can be observed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;5</bold>
</xref>. After 28 days of storage at 7&#xb0;C, a similar effect was observed on the relative expression of <italic>CaAPX</italic> and <italic>CaCAT</italic> genes which was no upregulated by SA treatments (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6F, G</bold>
</xref>), although an enzymatic activity stimulation was observed compared to untreated pepper fruit because of both foliar and irrigation SA treatments (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5D, E</bold>
</xref>). Nevertheless, SA treatment applied by foliar spraying positively modulated the relative expression of <italic>CaPOD</italic> gene after 28 storage days and, therefore, stimulated the activity of the POD enzyme (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5F</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>6H</bold>
</xref>). Induction POD activity, which is an important oxyradical detoxification enzyme in plant tissues, has been demonstrated in the present study and may generally facilitate conditions that can delay senescence in green peppers fruits (<xref ref-type="bibr" rid="B102">Zhou et&#xa0;al., 2011</xref>). Furthermore, the only relative expression of those antioxidant enzyme activities-related genes that was upregulated after 28 days of storage was for the POD enzyme (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6H</bold>
</xref>). These results are in accordance with those reported by <xref ref-type="bibr" rid="B71">Rao et&#xa0;al. (2011)</xref> in which 1- and 2-mM SA postharvest treatments extended the shelf-life of sweet pepper fruit (<italic>Capsicum annum</italic> L., cv. Indra). Senescence is associated with the defensive system, including antioxidant enzymes, such as POD. In the present study, POD was highly correlated (positively, Pearson) with firmness, color, TA, chlorophylls, phenolics and AA content, L-TAA, APX and the relative expression of both <italic>CaAPX</italic> and <italic>CaCAT</italic> genes (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>). An efficient antioxidant system can postpone the senescence process even though antioxidative activity in fruits decreases with ageing (<xref ref-type="bibr" rid="B101">Zheng et&#xa0;al., 2007</xref>). Antioxidants can delay, retard or prevent oxidation processes by reacting with free radicals, chelating metals and acting as oxygen scavengers, a triplet as well as singlet form and transferring hydrogen atoms to the free radical structure. Similar results were recently reported where the incorporation of SA foliar spraying and caraway oil coating resulted in the highest antioxidant enzyme activity and the lowest chilling injury in treated pepper fruits stored under cold conditions (<xref ref-type="bibr" rid="B38">Hanaei et&#xa0;al., 2022</xref>). The results of the present study reinforce the knowledge gap about the effect of SA applied by foliar spraying and irrigation on the complex interaction of metabolites and genes in regulating the bell pepper fruit ripening and senescence processes.</p>
<p>Finally, whilst not the primary focus of this study, it has been demonstrated that the foliar and irrigation application of SA on bell pepper plants has the capacity to enhance fruit quality without exerting a detrimental effect on productivity. The results suggest that both foliar and irrigation SA treatments improve the accumulated crop yield, expressed in terms of kg per plant, throughout the crop cycle of &#x2018;Lamuyo&#x2019; green pepper fruit, &#x2018;Herminio&#x2019; cv., as it can be observed in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>. However, no significant differences were appreciated between the two application methodologies (<italic>p</italic> &#x2265; 0.05). The role of SA in improving fruit yield may have been due to the translocation of more photoassimilates to fruits, thereby increasing fruit weight and reducing negative environmental impacts. These findings confirm those observed in a previous study where an increase of 0.5 kg yield was recorded in the last harvest date after the foliar application of SA (<xref ref-type="bibr" rid="B21">Dob&#xf3;n-Su&#xe1;rez et&#xa0;al., 2021a</xref>). Other studies also observed a higher productivity with the preharvest application of exogenous SA in different types of pepper plants (<xref ref-type="bibr" rid="B86">Sobczak et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B70">Preet et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B32">Ghahremani et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B43">Ibrahim et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B23">Elwan and El-Hamahmy, 2009</xref>).</p>
<p>In summary, the results of the present study demonstrated that both SA preharvest methods tested (foliar and irrigation) were effective in enhancing crop yield, fruit quality at harvest, and delaying ripening and senescence of green pepper fruit throughout the antioxidant metabolism. The effect of both SA applications was found to be similar in most of the parameters analyzed, although it should be highlighted that they showed differences as follows: Firstly, foliar spraying of SA led to a positive modulation of the relative expression of <italic>CaPOD</italic> and <italic>CaPAL</italic> genes at harvest, although this stimulation was only upregulated for the <italic>CaPOD</italic> gene after 28 days of storage. Secondly, irrigation with SA led to an enhancement of H-TAA at harvest and TSS content after postharvest storage. Thirdly, the irrigation method of SA showed a significant increase in CAT activity and delayed weight loss and ripening index. However, regarding their impact on the field and on the agri-food industry, it should be emphasized that the irrigation method was the most beneficial due to the ease and cost-effectiveness with which it could be applied in comparison to foliar spraying.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusions</title>
<p>In our study, we found that salicylic acid (SA) preharvest treatment, both by foliar spraying and irrigation, improved the fruit quality of green peppers, resulting in a slowing of the ripening and senescence processes during postharvest storage, while stimulating the antioxidant system, accompanied by an increase in the content of secondary metabolites and activity of antioxidant enzymes, mediated by the upregulation of the relative response of genes responsible for their biosynthesis. The mechanism of action proposed in the present study is as follows: <italic>1)</italic> SA induces the synthesis of secondary metabolites and enhances the antioxidant systems by stimulating the phenylpropanoid biosynthesis pathway, and <italic>2)</italic> SA activates the antioxidant enzymes by acting on the modulation of the relative expression of antioxidant system-based genes and regulating the balance between the antioxidant system and ROS metabolism, contributing to the antioxidant metabolism insights. The results of the present study fill the knowledge gap on the effect of SA applied by spraying and irrigation on the complex interaction of metabolites and genes in regulating the ripening and senescence processes of pepper fruit. Finally, both foliar spray and irrigation SA applications showed a great effect on fruit quality and crop yield. However, in terms of beneficial effects on the field and for the agri-food industry it should be highlighted the irrigation method due to the easier way and the reduced cost of application compared to the foliar application.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>, further inquiries can be directed to the corresponding author/s.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>AD-S: Conceptualization, Data curation, Investigation, Methodology, Writing &#x2013; original draft, Visualization. MG-P: Methodology, Software, Writing &#x2013; review &amp; editing, Visualization. VS-E: Funding acquisition, Methodology, Visualization, Writing &#x2013; review &amp; editing. MJG: Funding acquisition, Software, Visualization, Writing &#x2013; review &amp; editing. DV: Methodology, Writing &#x2013; review &amp; editing, Visualization. MS: Data curation, Writing &#x2013; review &amp; editing, Visualization. MG-P: Conceptualization, Data curation, Supervision, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing, Visualization. PZ: Conceptualization, Funding acquisition, Supervision, Writing &#x2013; review &amp; editing, Visualization.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that no financial support was received for the research, authorship, and/or publication of this article.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors thank the company &#x2018;Hortalizas Sanper El Raal SL&#x2019; for permission to use its commercial greenhouse and the technical support received. In addition, the authors thank BioRender (Toronto, ON, Canada) to provide pictures used in the Graphical Abstract and in the illustration of hypothetical working model (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref>).</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors&#xa0;and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2025.1475068/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2025.1475068/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alkan</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Fortes</surname> <given-names>A. M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Insights into molecular and metabolic events associated with fruit response to post-harvest fungal pathogens</article-title>. <source>Front. Plant Sci.</source> <volume>6</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2015.00889</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amiri</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Nicknam</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Radi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sayadi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bagheri</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Karimi Khorrami</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Postharvest quality of orange fruit as influenced by salicylic acid, acetic acid, and carboxymethyl cellulose coating</article-title>. <source>J. Food Meas. Charact.</source> <volume>15</volume>, <fpage>3912</fpage>&#x2013;<lpage>3930</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11694-021-00966-y</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Batista</surname> <given-names>V. C.V.</given-names>
</name>
<name>
<surname>Pereira</surname> <given-names>I. M.C.</given-names>
</name>
<name>
<surname>Paula-Marinho</surname> <given-names>S. O.</given-names>
</name>
<name>
<surname>Canuto</surname> <given-names>K. M.</given-names>
</name>
<name>
<surname>Pereira</surname> <given-names>R. C.A.</given-names>
</name>
<name>
<surname>Rodrigues</surname> <given-names>T. H.S.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Salicylic acid modulates primary and volatile metabolites to alleviate salt stress-induced photosynthesis impairment on medicinal plant <italic>Egletes viscosa</italic>
</article-title>. <source>Environ. Exp. Bot.</source> <volume>167</volume>, <fpage>103870</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envexpbot.2019.103870</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Blanch</surname> <given-names>G. P.</given-names>
</name>
<name>
<surname>G&#xf3;mez-Jim&#xe9;nez</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Del Castillo</surname> <given-names>M. L. R.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Exogenous salicylic acid improves phenolic content and antioxidant activity in table grapes</article-title>. <source>Plant Foods. Hum. Nutr.</source> <volume>75</volume>, <fpage>177</fpage>&#x2013;<lpage>183</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11130-019-00793-z</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Camejo</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Jim&#xe9;nez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Palma</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Sevilla</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Proteomic identification of mitochondrial carbonylated proteins in two maturation stages of pepper fruits</article-title>. <source>Proteomics</source> <volume>15</volume>, <fpage>2634</fpage>&#x2013;<lpage>2642</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/pmic.201400370</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chaki</surname> <given-names>M.</given-names>
</name>
<name>
<surname>&#xc1;lvarez de Morales</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ruiz</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Begara-Morales</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Barroso</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Corpas</surname> <given-names>F. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Ripening of pepper (<italic>Capsicum annuum</italic>) fruit is characterized by an enhancement of protein tyrosine nitration</article-title>. <source>Ann. Bot.</source> <volume>116</volume>, <fpage>637</fpage>&#x2013;<lpage>647</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/aob/mcv016</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Champa</surname> <given-names>W. H.</given-names>
</name>
<name>
<surname>Gill</surname> <given-names>M. I. S.</given-names>
</name>
<name>
<surname>Mahajan</surname> <given-names>B. V. C.</given-names>
</name>
<name>
<surname>Arora</surname> <given-names>N. K.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Preharvest salicylic acid treatments to improve quality and postharvest life of table grapes (<italic>Vitis vinifera</italic> L.) cv. Flame Seedless</article-title>. <source>J. Food Sci. Tech.</source> <volume>52</volume>, <fpage>3607</fpage>&#x2013;<lpage>3616</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s13197-014-1422-7</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Charoenphun</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Pham</surname> <given-names>N. H.</given-names>
</name>
<name>
<surname>Rattanawut</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Venkatachalam</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Exogenous application of melatonin on the preservation of physicochemical and enzymatic qualities od pepper fruit from chilling injury</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>10</volume>, <elocation-id>550</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/horticulturae10060550</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheema</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Padmanabhan</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Amer</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Parry</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>L. T.</given-names>
</name>
<name>
<surname>Subramanian</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Postharvest hexanal vapor treatment delays ripening and enhances shelf life of greenhouse grown sweet bell pepper (<italic>Capsicum annum</italic> L.)</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>136</volume>, <fpage>80</fpage>&#x2013;<lpage>89</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2017.10.006</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>C. B.</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>J. H.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Salicylic acid had the potential to enhance tolerance in horticultural crops against abiotic stress</article-title>. <source>Front. Plant Sci.</source> <volume>14</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2023.1141918</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Salicylic acid improves the constitutive freezing tolerance of potato as revealed by transcriptomics and metabolomics analyses</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume>, <elocation-id>609</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms24010609</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>JalalAhammed</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Ruan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Putative WRKYs associated with regulation of fruit ripening revealed by detailed expression analysis of the WRKY gene family in pepper</article-title>. <source>Sci. Rep.</source> <volume>6</volume>, <elocation-id>39000</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep39000</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cherian</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Figueroa</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Nair</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>[amp]]lsquo;Movers and shakers&#x2019; in the regulation of fruit ripening: a cross-dissection of climacteric versus non-climacteric fruit</article-title>. <source>J. Exp. Bot.</source> <volume>65</volume>, <fpage>4705</fpage>&#x2013;<lpage>4722</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jxb/eru280</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corpas</surname> <given-names>F. J.</given-names>
</name>
<name>
<surname>Freschi</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Rodriguez-Ruiz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Mioto</surname> <given-names>P. T.</given-names>
</name>
<name>
<surname>Gonzalez-Gordo</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Palma</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Nitro-oxidative metabolism during fruit ripening</article-title>. <source>J. Exp. Bot.</source> <volume>69</volume>, <fpage>3449</fpage>&#x2013;<lpage>3463</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jxb/erx453</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corpas</surname> <given-names>F. J.</given-names>
</name>
<name>
<surname>Palma</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Nitric oxide on/off in fruit ripening</article-title>. <source>Plant Biol.</source> <volume>20</volume>, <fpage>805</fpage>&#x2013;<lpage>807</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/plb.12852</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Davarynejad</surname> <given-names>G. H.</given-names>
</name>
<name>
<surname>Zarei</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Nasrabadi</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Ardakani</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Effects of salicylic acid and putrescine on storability, quality attributes and antioxidant activity of plum cv. &#x2018;Santa Rosa&#x2019;</article-title>. <source>J. Food Sci. Technol.</source> <volume>52</volume>, <fpage>2053</fpage>&#x2013;<lpage>2062</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s13197-013-1232-3</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dempsey</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Klessig</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>How does the multifaceted p`lant hormone salicylic acid combat disease in plants and are similar mechanisms utilized in humans</article-title>? <source>BMC Biol.</source> <volume>15</volume>, <fpage>23</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12915-017-0364-8</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Devireddy</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Zandalinas</surname> <given-names>S. I.</given-names>
</name>
<name>
<surname>Fichman</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Mittler</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Integration of&#xa0;reactive oxygen species and hormone signaling during abiotic stress</article-title>. <source>Plant J.</source> <volume>105</volume>, <fpage>459</fpage>&#x2013;<lpage>476</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/tpj.15010</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ding</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Stories of salicylic acid: A plant defense hormone</article-title>. <source>Trends Plant Sci.</source> <volume>25</volume>, <fpage>549</fpage>&#x2013;<lpage>565</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tplants.2020.01.004</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dob&#xf3;n-Su&#xe1;rez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Gim&#xe9;nez</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Castillo</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Garc&#xed;a-Pastor</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Zapata</surname> <given-names>P. J.</given-names>
</name>
</person-group> (<year>2021</year>b). <article-title>Influence of the phenological stage and harvest date on the bioactive compounds content of green pepper fruit</article-title>. <source>Molecules</source> <volume>26</volume>, <elocation-id>3099</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/molecules26113099</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dob&#xf3;n-Su&#xe1;rez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Gim&#xe9;nez</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Garc&#xed;a-Pastor</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Zapata</surname> <given-names>P. J.</given-names>
</name>
</person-group> (<year>2021</year>a). <article-title>Salicylic acid foliar application increases crop yield and quality parameters of green pepper fruit during postharvest storage</article-title>. <source>Agronomy</source> <volume>11</volume>, <elocation-id>2263</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/agronomy11112263</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>El-Ramady</surname> <given-names>H. R.</given-names>
</name>
<name>
<surname>Domokos-Szabolcsy</surname> <given-names>&#xc9;.</given-names>
</name>
<name>
<surname>Abdalla</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Taha</surname> <given-names>H. S.</given-names>
</name>
<name>
<surname>F&#xe1;ri</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Postharvest management of fruit and vegetables storage. <italic>In:</italic> Lichtfouse, E. (eds) Sustainable Agriculture Reviews</article-title>. <source>Sustain. Agric. Rev.</source> <volume>15</volume>, <fpage>65</fpage>&#x2013;<lpage>152</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-3-319-09132-7_2</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elwan</surname> <given-names>M. W. M.</given-names>
</name>
<name>
<surname>El-Hamahmy</surname> <given-names>M. A. M.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Improved productivity and quality associated with salicylic acid application in greenhouse pepper</article-title>. <source>Sci. Hortic.</source> <volume>122</volume>, <fpage>521</fpage>&#x2013;<lpage>526</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2009.07.001</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Erickson</surname> <given-names>A. N.</given-names>
</name>
<name>
<surname>Markhart</surname> <given-names>A. H.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Flower developmental stage and organ sensitivity of bell pepper (<italic>Capsicum annuum</italic> L.) to elevated temperature</article-title>. <source>Plant Cell Environ.</source> <volume>25</volume>, <fpage>123</fpage>&#x2013;<lpage>130</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1046/j.0016-8025.2001.00807.x</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>FAOSTAT</collab>
</person-group> (<year>2024</year>). <article-title>Statistical data of total production of Chili peppers and peppers in Spain</article-title>. Available online at: <uri xlink:href="https://www.fao.org/faostat/es/data/QCL">https://www.fao.org/faostat/es/data/QCL</uri> (Accessed <access-date>15 June 2024</access-date>).</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fuentes</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Figueroa</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Valdenegro</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Recent advances in hormonal regulation and cross-talk during non-climacteric fruit development and ripening</article-title>. <source>Horticulturae</source> <volume>5</volume>, <fpage>45</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/horticulturae50</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fung</surname> <given-names>R. W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C. Y.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>D. L.</given-names>
</name>
<name>
<surname>Gross</surname> <given-names>K. C.</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>MeSA and MeJA increase steady-state transcript levels of alternative oxidase and resistance against chilling injury in sweet peppers (<italic>Capsicum annuum</italic> L.)</article-title>. <source>Plant Sci.</source> <volume>166</volume>, <fpage>711</fpage>&#x2013;<lpage>719</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plantsci.2003.11.009</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Role of ethylene response factors (ERFs) in fruit ripening</article-title>. <source>Food Qual. Saf.</source> <volume>4</volume>, <fpage>15</fpage>&#x2013;<lpage>20</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/fqsafe/fyz042</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garc&#xed;a-Pastor</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Gim&#xe9;nez</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Serna-Escolano</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Guill&#xe9;n</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Valero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Serrano</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Oxalic acid preharvest treatment improves color and quality of seedless table grape &#x2018;magenta&#x2019; upregulating on-vine abscisic acid metabolism, relative vvnced1 gene expression, and the antioxidant system in berries</article-title>. <source>Front. Plant Sci. Sec. Crop Product. Physiol.</source> <volume>12</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2021.740240</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garc&#xed;a-Pastor</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Zapata</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Castillo</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mart&#xed;nez-Romero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Guill&#xe9;n</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Valero</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>The effects of salicylic acid and its derivatives on increasing pomegranate fruit quality and bioactive compounds at harvest and during storage</article-title>. <source>Front. Plant Sci.</source> <volume>11</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2020.00668</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ge</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kong</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Combining salicylic acid and trisodium phosphate alleviates chilling injury in bell pepper (<italic>Capsicum annuum</italic> L.) through enhancing fatty-acid desaturation efficiency and water retention</article-title>. <source>Food Chem.</source> <volume>327</volume>, <elocation-id>127057</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2020.127057</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghahremani</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Alizadeh</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Barzegar</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Nikbakht</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ranjbar</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Nezamdoost</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>The mechanism of enhancing drought tolerance threshold of pepper plant treated with putrescine and salicylic acid</article-title>. <source>Plant Stress</source> <volume>9</volume>, <elocation-id>100199</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.stress.2023.100199</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghassemi-Golezani</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Farhangi-Abriz</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Bandehagh</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Salicylic acid and jasmonic acid alter physiological performance, assimilate mobilization and seed filling of soybean under salt stress</article-title>. <source>Acta Agric. Slov.</source> <volume>111</volume>, <fpage>597</fpage>&#x2013;<lpage>607</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.14720/aas.2018.111.3.08</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gim&#xe9;nez</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Valverde</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Valero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Guill&#xe9;n</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Mart&#xed;nez-Romero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Serrano</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Quality and antioxidant properties on sweet cherries as affected by preharvest salicylic and acetylsalicylic acids treatments</article-title>. <source>Food Chem.</source> <volume>160</volume>, <fpage>226</fpage>&#x2013;<lpage>232</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2014.03.107</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gim&#xe9;nez</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Valverde</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Valero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zapata</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Castillo</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Serrano</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Postharvest methyl salicylate treatments delay ripening and maintain quality attributes and antioxidant compounds of &#x2018;Early Lory&#x2019; sweet cherry</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>117</volume>, <fpage>102</fpage>&#x2013;<lpage>109</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2016.02.006</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gomes</surname> <given-names>E. P.</given-names>
</name>
<name>
<surname>Borges</surname> <given-names>C. V.</given-names>
</name>
<name>
<surname>Monteiro</surname> <given-names>G. C.</given-names>
</name>
<name>
<surname>Belin</surname> <given-names>M. A. F.</given-names>
</name>
<name>
<surname>Minatel</surname> <given-names>I. O.</given-names>
</name>
<name>
<surname>Junior</surname> <given-names>A. P.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Preharvest salicylic acid treatments improve phenolic compounds and biogenic amines in &#x2018;Niagara Rosada&#x2019; table grape</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>176</volume>, <elocation-id>111505</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2021.111505</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hadjipieri</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Georgiadou</surname> <given-names>E. C.</given-names>
</name>
<name>
<surname>Drogoudi</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Fotopoulos</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Manganaris</surname> <given-names>G. A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>The efficacy of acetylsalicylic acid, spermidine and calcium preharvest foliar spray applications on yield efficiency, incidence of physiological disorders and shelf-life performance of loquat fruit</article-title>. <source>Sci. Hortic.</source> <volume>289</volume>, <elocation-id>110439</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2021.110439</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hanaei</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Bodahi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Hagh</surname> <given-names>Z. G.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Alleviation of postharvest chilling injury in sweet pepper using Salicylic acid foliar spraying incorporated with caraway oil coating under cold storage</article-title>. <source>Front. Plant Sci. Sec. Plant Abiotic. Stress</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2022.999518</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hanif</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ahmad</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shahzad</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Liaquat</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Anwar</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Postharvest application of salicylic acid reduced decay and enhanced storage life of papaya fruit during cold storage</article-title>. <source>J. Food Meas. Charact.</source> <volume>14</volume>, <fpage>3078</fpage>&#x2013;<lpage>3088</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11694-020-00555-5</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hazarika</surname> <given-names>T. M.</given-names>
</name>
<name>
<surname>Marak</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Salicylic acid and oxalic acid in enhancing the quality and extending the shelf life of grape cv. Thompson seedless</article-title>. <source>Food Sci. Technol. Int.</source> <volume>28</volume>, <fpage>463</fpage>&#x2013;<lpage>475</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/10820132211020612</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Hui</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Physicochemical properties enhancement of Chinese kiwi fruit (<italic>Actinidia chinensis</italic> Planch) via chitosan coating enriched with salicylic acid treatment</article-title>. <source>J. Food Meas. Charact.</source> <volume>11</volume>, <fpage>184</fpage>&#x2013;<lpage>191</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11694-016-9385-1</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huntenburg</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Pue&#x301;rtolas</surname> <given-names>J.</given-names>
</name>
<name>
<surname>de Ollas</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Dodd</surname> <given-names>I. C.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Bi-directional, long-distance hormonal signaling between roots and shoots of soil water availability</article-title>. <source>Physiol. Plant</source> <volume>174</volume>, <elocation-id>e13697</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/ppl.13697</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ibrahim</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Abdel-Razzak</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wahb-Allah</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Alenazi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Alsadon</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Dewir</surname> <given-names>Y. H.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Improvement in growth, yield and fruit quality of three red sweet pepper cultivars by foliar application of humic and salicylic acids</article-title>. <source>HortTechnology</source> <volume>29</volume>, <fpage>170</fpage>&#x2013;<lpage>178</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21273/HORTTECH04263-18</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Janda</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Szalai</surname> <given-names>G.</given-names>
</name>
<name>
<surname>P&#xe1;l</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Salicylic acid signaling in plants</article-title>. <source>Int. J. Mol. Sci.</source> <volume>21</volume>, <elocation-id>2655</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms21072655</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jim&#xe9;nez-Garc&#xed;a</surname> <given-names>S. N.</given-names>
</name>
<name>
<surname>V&#xe1;zquez-Cruz</surname> <given-names>M. U.</given-names>
</name>
<name>
<surname>Miranda-L&#xf3;pez</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Garc&#xed;a-Mier</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Guevara-Gonz&#xe1;lez</surname> <given-names>R. G.</given-names>
</name>
<name>
<surname>Feregrino-P&#xe9;rez</surname> <given-names>A. A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Effect of Elicitors as Stimulating Substances on Sensory Quality Traits in Color Sweet Bell Pepper (<italic>Capsicum annuum</italic> L. cv. Fascinato and Orangela) Grown under Greenhouse Conditions</article-title>. <source>Pol. J. Food Nutr. Sci.</source> <volume>68</volume>, <fpage>359</fpage>&#x2013;<lpage>365</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2478/pjfns-2018-0003</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kang</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Proteomics reveals the effects of salicylic acid on growth and tolerance to subsequent water stress in wheat</article-title>. <source>J. Proteome Rese.</source> <volume>11</volume>, <fpage>6066</fpage>&#x2013;<lpage>6079</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/pr300728y</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Hui</surname> <given-names>C. Z.</given-names>
</name>
<name>
<surname>Ghazanfar</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Khan</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Ahmad</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Ahmad</surname> <given-names>I.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Acetyl salicylic acid and 24-epibrassinolide attenuate decline in photosynthesis, chlorophyll contents and membrane thermo-stability in tomato (<italic>Lycopersicon esculentum</italic> Mill.) under Heat Stress</article-title>. <source>Pak. J. Bot.</source> <volume>47</volume>, <fpage>63</fpage>&#x2013;<lpage>70</lpage>. Available at: <uri xlink:href="http://142.54.178.187:9060/xmlui/handle/123456789/15415">http://142.54.178.187:9060/xmlui/handle/123456789/15415</uri> (Accessed July 15, 2024).</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Klie</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Osorio</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tohge</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Drincovich</surname> <given-names>M. F.</given-names>
</name>
<name>
<surname>Fait</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Giovannoni</surname> <given-names>J. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Conserved changes in the dynamics of metabolic processes during fruit development and ripening across species</article-title>. <source>Plant Physiol.</source> <volume>164</volume>, <fpage>55</fpage>&#x2013;<lpage>68</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.113.226142</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knee</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>1972</year>). <article-title>Anthocyanin, carotenoid, and chlorophyll changes in the peel of cox&#x2019;s orange pippin apples during ripening on and off the tree</article-title>. <source>J. Exp. Bot.</source> <volume>23</volume>, <fpage>184</fpage>&#x2013;<lpage>196</lpage>. Available at: <uri xlink:href="https://www.jstor.org/stable/23687515">https://www.jstor.org/stable/23687515</uri> (Accessed July 4, 2024).</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Jackson</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Dynamic changes of enzymes involved in sugar and organic acid level modification during blueberry fruit maturation</article-title>. <source>Food Chem.</source> <volume>309</volume>, <elocation-id>125617</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2019.125617</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kong</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Xin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Shao</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Transcriptomic and physiological analyses reveal plant resistance against <italic>Ralstonia solanacearum</italic> involves salicylic acid-mediated defences in tomato leaves</article-title>. <source>Plant Pathol.</source> <volume>74</volume>, <fpage>123</fpage>&#x2013;<lpage>136</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/ppa.14002</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Transcriptome analysis integrated with changes in cell wall polysaccharides of different fresh-cut chili pepper cultivars during storage reveals the softening mechanism</article-title>. <source>Food Chem.</source> <volume>452</volume>, <elocation-id>139445</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2024.139445</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lichtenthader</surname> <given-names>H. K.</given-names>
</name>
<name>
<surname>Wellburn</surname> <given-names>A. R.</given-names>
</name>
</person-group> (<year>1983</year>). <article-title>Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents</article-title>. <source>Biochem. Soc. Trans.</source> <volume>11</volume> (<issue>5</issue>), <fpage>591</fpage>&#x2013;<lpage>592</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1042/bst0110591</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lim</surname> <given-names>C. S.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Cho</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Gross</surname> <given-names>K. C.</given-names>
</name>
<name>
<surname>Woolf</surname> <given-names>A. B.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Bell pepper (<italic>Capsicum annuum</italic> L.) fruits are susceptible to chilling injury at the breaker stage of ripeness</article-title>. <source>HortScience</source> <volume>42</volume>, <fpage>1659</fpage>&#x2013;<lpage>1664</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21273/HORTSCI.42.7.1659</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Lei</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Salicylic acid represses VdMYB31 expression to enhance grape resistance to <italic>Colletotrichum viniferum</italic>
</article-title>. <source>Int. J. Biol. Macromol.</source> <volume>288</volume>, <elocation-id>138731</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijbiomac.2024.138731</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Aranda</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Transcriptomic and metabolic profiling of watermelon uncovers the role of salicylic acid and flavonoids in the resistance to cucumber green mottle mosaic virus</article-title>. <source>J. Exp. Bot.</source> <volume>74</volume>, <fpage>5218</fpage>&#x2013;<lpage>5235</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jxb/erad197</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Grierson</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>UV-C irradiation delays the physiological changes of bell pepper fruit during storage</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>180</volume>, <elocation-id>111506</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2021.111506</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mar&#xed;n</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ferreres</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Tom&#xe1;s-Barber&#xe1;n</surname> <given-names>F. A.</given-names>
</name>
<name>
<surname>Gil</surname> <given-names>M. I.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Characterization and quantitation of antioxidant constituents of sweet pepper (<italic>Capsicum annuum</italic> L.)</article-title>. <source>J. Agric. Food Chem.</source> <volume>52</volume>, <fpage>3861</fpage>&#x2013;<lpage>3869</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/jf0497915</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Munshi</surname> <given-names>M. H.</given-names>
</name>
<name>
<surname>Issak</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Kabir</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Hosain</surname> <given-names>M. T.</given-names>
</name>
<name>
<surname>Fazle Bari</surname> <given-names>A. S. M.</given-names>
</name>
<name>
<surname>Rahman</surname> <given-names>M. S.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Enhancement of growth, yield and fruit quality of sweet pepper (<italic>Capsicum annuum</italic> L.) by foliar application of salicylic acid</article-title>. <source>Int. J. Biosci.</source> <volume>17</volume>, <fpage>49</fpage>&#x2013;<lpage>56</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.12692/ijb/17.5.49-56</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Natasha</surname>
</name>
<name>
<surname>Shahid</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Khalid</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Bibi</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Bundschuh</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Khan Niazi</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>A critical review of mercury speciation bioavailability, toxicity and detoxification in soil-plant environment: Ecotoxicology and health risk assessment</article-title>. <source>Sci. Total. Environ.</source> <volume>711</volume>, <elocation-id>134749</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scitotenv.2019.134749</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Navarro</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Flores</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Garrido</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Mart&#xed;nez</surname> <given-names>V.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Changes in the contents of antioxidant compounds in pepper fruits at different ripening stages, as affected by salinity</article-title>. <source>Food Chem.</source> <volume>96</volume>, <fpage>66</fpage>&#x2013;<lpage>73</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2005.01.057</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nguyen</surname> <given-names>N. X. B.</given-names>
</name>
<name>
<surname>Saithong</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Boonyaritthongchai</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Buanong</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kalapanulak</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wongs-Aree</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Methyl salicylate induces endogenous&#xa0;jasmonic acid and salicylic acid in &#x2018;Nam Dok Mai&#x2019; mango to maintain postharvest ripening and quality</article-title>. <source>J. Plant Physiol.</source> <volume>303</volume>, <elocation-id>154356</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jplph.2024.154356</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>N&#xf3;brega</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>Bruno</surname> <given-names>R. D. L. A.</given-names>
</name>
<name>
<surname>Figueiredo</surname> <given-names>F. R. A.</given-names>
</name>
<name>
<surname>da Silva</surname> <given-names>T. I.</given-names>
</name>
<name>
<surname>de F&#xe1;tima</surname> <given-names>R. T.</given-names>
</name>
<name>
<surname>Ferreira</surname> <given-names>J. T. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Growth and fluorescence rates of <italic>Mesosphaerum suaveolens</italic> (L.) Kuntze under saline stress and salicylic acid doses</article-title>. <source>Rev. Bras. Ci&#xea;ncias. Agr&#xe1;rias.</source> <volume>15</volume>, <fpage>1</fpage>&#x2013;<lpage>7</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5039/agraria.v15i3a7012</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oraei</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Panahirad</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zaare Nahandi</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Gohari</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Pre-veraison treatment of salicylic acid to enhance anthocyanin content of grape (<italic>Vitis vinifera</italic> L.) berries</article-title>. <source>J. Sci. Food Agric.</source> <volume>99</volume>, <fpage>5946</fpage>&#x2013;<lpage>5952</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jsfa.9869</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Palma</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Jim&#xe9;nez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Corpas</surname> <given-names>F. J.</given-names>
</name>
<name>
<surname>Mateos</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Mart&#xed;</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Sevilla</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <source>Role of ascorbate on the fruit physiology of pepper (<italic>Capsicum annuum</italic> L.). Functional Plant Science and Biotechnology</source> Vol. <volume>5</volume> (<publisher-loc>Kagawa Ken, Japan</publisher-loc>: <publisher-name>&#xa9;2011 Global Science Books</publisher-name>), <fpage>56</fpage>&#x2013;<lpage>61</lpage>.</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Palma</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Sevilla</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Jim&#xe9;nez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>del R&#xed;o</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>Corpas</surname> <given-names>F. J.</given-names>
</name>
<name>
<surname>Alvarez de Morales</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Physiology of pepper fruit and the metabolism of antioxidants: chloroplasts, mitochondria and peroxisomes</article-title>. <source>Ann. Bot.</source> <volume>116</volume>, <fpage>627</fpage>&#x2013;<lpage>636</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/aob/mcv121</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pe&#xf1;a-Est&#xe9;vez</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Art&#xe9;s-Hern&#xe1;ndez</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Art&#xe9;s</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Aguayo</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Mart&#xed;nez-Hern&#xe1;ndez</surname> <given-names>G. B.</given-names>
</name>
<name>
<surname>Galindo</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Quality changes of pomegranate arils throughout shelf life affected by deficit irrigation and pre-processing storage</article-title>. <source>Food Chem.</source> <volume>209</volume>, <fpage>302</fpage>&#x2013;<lpage>311</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2016.04.054</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perez-Aranda</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Loera-Muro</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Caamal-Chan</surname> <given-names>M. G.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Expression analysis of defense signaling marker genes in <italic>Capsicum annuum</italic> in response to phytohormones elicitation</article-title>. <source>Mol. Biol. Rep.</source> <volume>52</volume>, <fpage>9</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11033-024-10071-0</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>P&#xe9;rez-G&#xe1;lvez</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Viera</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Roca</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Carotenoids and chlorophylls as antioxidants</article-title>. <source>Antioxidants</source> <volume>9</volume>, <elocation-id>505</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/antiox9060505</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Preet</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Ghai</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Jindal</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Kaur Sangha</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Salicylic acid and 24-epibrassinolide induced thermotolerance in bell pepper through enhanced antioxidant enzyme system and heat shock proteins</article-title>. <source>J. Agr. Sci. Tech-Iran.</source> <volume>25</volume>, <fpage>171</fpage>&#x2013;<lpage>183</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.52547/jast.25.1.171</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rao</surname> <given-names>T. R.</given-names>
</name>
<name>
<surname>Gol</surname> <given-names>N. B.</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>K. K.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Effect of postharvest treatments and storage temperatures on the quality and shelf life of sweet pepper (<italic>Capsicum annum</italic> L.)</article-title>. <source>Sci. Hortic.</source> <volume>132</volume>, <fpage>18</fpage>&#x2013;<lpage>26</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2011.09.032</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raybaudi-Massilia</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Su&#xe1;rez</surname> <given-names>A. I.</given-names>
</name>
<name>
<surname>Arvelo</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Zambrano</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sojo</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Calder&#xf3;n-Gabald&#xf3;n</surname> <given-names>M. I.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Cytotoxic, antioxidant and antimicrobial properties of red sweet pepper (<italic>Capsicum annuum</italic> L. Var. Llaner&#xf3;n) extracts: <italic>In vitro</italic> study</article-title>. <source>Int. J. Food Stud.</source> <volume>6</volume>, <fpage>222</fpage>&#x2013;<lpage>231</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.7455/ijfs/6.2.2017.a8</pub-id>
</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rodrigues da Silva</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Soares de Lima</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Vieira de Azevedo</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>S&#xe1;&#xa0;Almeida&#xa0;Veloso</surname> <given-names>L. L.</given-names>
</name>
<name>
<surname>P&#xe1;dua Souza</surname> <given-names>L.</given-names>
</name>
<name>
<surname>F&#xe1;tima</surname> <given-names>R. T.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Exogenous application of salicylic acid on the mitigation of salt stress in <italic>Capsicum annuum</italic> L</article-title>. <source>Ciec. Rural Santa. Maria.</source> <volume>53</volume>, <elocation-id>7</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1590/0103-8478cr20210447</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rodr&#xed;guez-Burruezo</surname> <given-names>A. N.</given-names>
</name>
<name>
<surname>Kollmannsberger</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Gonz&#xe1;lez-Mas</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Nitz</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Fernando</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>HS-SPME comparative analysis of genotypic diversity in the volatile fraction and aroma-contributing compounds of <italic>Capsicum</italic> fruits from the Annuum&#x2013;Chinense&#x2013;Frutescens complex</article-title>. <source>J. Agric. Food Chem.</source> <volume>58</volume>, <fpage>4388</fpage>&#x2013;<lpage>4400</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/jf903931t</pub-id>
</citation>
</ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ruoyi</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Zhifang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhaoxin</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Effect of coating and intermittent warming on enzymes, soluble pectin substances and ascorbic acid of <italic>Prunus persica</italic> (cv. Zhonghuashoutao) during refrigerated storage</article-title>. <source>Food Res. Int.</source> <volume>3</volume>, <fpage>331</fpage>&#x2013;<lpage>336</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodres.2004.09.015</pub-id>
</citation>
</ref>
<ref id="B76">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sangprayoon</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Supapvanich</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Youryon</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Wongs Aree</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Boonyaritthongchai</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Efficiency of salicylic acid or methyl jasmonate immersions on internal browning alleviation and physicochemical quality of Queen pineapple cv. &#x201c;Sawi&#x201d; fruit during cold storage</article-title>. <source>J. Food Biochem.</source> <volume>43</volume>, <fpage>e13059</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jfbc.13059</pub-id>
</citation>
</ref>
<ref id="B77">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sayyari</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Babalar</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kalantari</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mart&#xed;nez-Romero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Guill&#xe9;n</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Serrano</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Vapour treatments with methyl salicylate or methyl jasmonate alleviated chilling injury and enhanced antioxidant potential during postharvest storage of pomegranates</article-title>. <source>Food Chem.</source> <volume>124</volume>, <fpage>964</fpage>&#x2013;<lpage>970</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2010.07.036</pub-id>
</citation>
</ref>
<ref id="B78">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seo</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yi</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>J. G.</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>E. J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Seed browning in pepper (<italic>Capsicum annuum</italic> L.) fruit during cold storage is inhibited by methyl jasmonate or induced by methyl salicylate</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>166</volume>, <elocation-id>111210</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2020.111210</pub-id>
</citation>
</ref>
<ref id="B79">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Serna-Escolano</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Mart&#xed;nez-Romero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Gim&#xe9;nez</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Serrano</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Garc&#xed;a-Mart&#xed;nez</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Valero</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Enhancing antioxidant systems by preharvest treatments with methyl jasmonate and salicylic acid leads to maintain lemon quality during cold storage</article-title>. <source>Food Chem.</source> <volume>338</volume>, <elocation-id>128044</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2020.128044</pub-id>
</citation>
</ref>
<ref id="B80">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Serrano</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zapata</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Castillo</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Guill&#xe9;n</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Mart&#xed;nez-Romero</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Antioxidant and nutritive constituents during sweet pepper development and ripening are enhanced by nitrophenolate treatments</article-title>. <source>Food Chem.</source> <volume>118</volume>, <fpage>497</fpage>&#x2013;<lpage>503</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2009.05.006</pub-id>
</citation>
</ref>
<ref id="B81">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shanbehpour</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Rastegar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ghasemi</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Effect of preharvest application of calcium chloride, putrescine, and salicylic acid on antioxidant system and biochemical changes of two Indian jujube genotypes</article-title>. <source>J. Food Biochem.</source> <volume>44</volume>, <elocation-id>13474</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jfbc.13474</pub-id>
</citation>
</ref>
<ref id="B82">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sharma</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Gupta</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Majumder</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Maurya</surname> <given-names>V. K.</given-names>
</name>
<name>
<surname>Deeba</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Alam</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Growth mediated by salicylic acid, physiological and proteomic responses in two wheat varieties under water stress</article-title>. <source>J. Proteom.</source> <volume>123</volume>, <fpage>28</fpage>&#x2013;<lpage>51</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jprot.2017.05.011</pub-id>
</citation>
</ref>
<ref id="B83">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname> <given-names>Y. L.</given-names>
</name>
<name>
<surname>Sheng</surname> <given-names>Y. Y.</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>Z. Y.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Q. S.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Involvement of salicylic acid in Anthracnose infection in tea plants revealed by transcriptome profiling</article-title>. <source>Int. J. Mol. Sci.</source> <volume>20</volume>, <elocation-id>2439</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms20102439</pub-id>
</citation>
</ref>
<ref id="B84">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sim</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Min</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>E. J.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Salicylic acid and transcriptional activation of phytohormone signaling potentially mediate chilling response in cucumber fruit peel</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>218</volume>, <elocation-id>113182</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2024.113182</pub-id>
</citation>
</ref>
<ref id="B85">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soare</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Dinu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Babeanu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Popescu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Popescu</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Nutritional value and antioxidant activities in fruit of some cultivars of pepper (<italic>Capsicum annuum</italic> L.)</article-title>. <source>J. Agroaliment. Process. Technol.</source> <volume>23</volume>, <fpage>217</fpage>&#x2013;<lpage>222</lpage>. Available at: <uri xlink:href="http://journal-of-agroalimentary.ro">http://journal-of-agroalimentary.ro</uri> (Accessed June 24, 2024).</citation>
</ref>
<ref id="B86">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sobczak</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ku&#x107;ko</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Pi&#xf3;ro-Jabrucka</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Gajc-Wolska</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kowalczyk</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Effect of salicylic acid on the growth and development of sweet pepper (<italic>Capsicum annum</italic> L.) under standard and high EC nutrient solution in aeroponic cultivation</article-title>. <source>Agronomy</source> <volume>13</volume>, <elocation-id>779</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/agronomy13030779</pub-id>
</citation>
</ref>
<ref id="B87">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>S. L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z. H.</given-names>
</name>
<name>
<surname>Palloix</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L. H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>B. X.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Resistances to anthracnose (<italic>Colletotrichum acutatum</italic>) of <italic>Capsicum</italic> mature green and ripe fruit are controlled by a major dominant cluster of QTLs on chromosome P5</article-title>. <source>Sci. Hortic.</source> <volume>181</volume>, <fpage>81</fpage>&#x2013;<lpage>88</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2014.10.033</pub-id>
</citation>
</ref>
<ref id="B88">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Integrated metabolome and transcriptome analysis reveals salicylic acid and flavonoid pathways&#x2019; key roles in cabbage&#x2019;s defense responses to <italic>Xanthomonas campestris pv. campestris</italic>
</article-title>. <source>Front. Plant Sci.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2022.1005764</pub-id>
</citation>
</ref>
<ref id="B89">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wen</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Implications of terminal oxidase function in regulation of salicylic acid on soybean seedling photosynthetic performance under water stress</article-title>. <source>Plant Physiol. Biochem.</source> <volume>112</volume>, <fpage>19</fpage>&#x2013;<lpage>28</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plaphy.2016.11.016</pub-id>
</citation>
</ref>
<ref id="B90">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Valverde</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Gim&#xe9;nez</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Guill&#xe9;n</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Valero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Mart&#xed;nez-Romero</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Serrano</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Methyl salicylate treatments of sweet cherry trees increase antioxidant systems in fruit at harvest and during storage</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>109</volume>, <fpage>106</fpage>&#x2013;<lpage>113</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2015.06.011</pub-id>
</citation>
</ref>
<ref id="B91">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Veloso</surname> <given-names>L. L. A.</given-names>
</name>
<name>
<surname>Lima</surname> <given-names>G. S.</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>A. A. R.</given-names>
</name>
<name>
<surname>Souza</surname> <given-names>L. P.</given-names>
</name>
<name>
<surname>Lacerda</surname> <given-names>C. N.</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>I. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Attenuation of salt stress on the physiology and production of bell peppers by treatment with salicylic acid</article-title>. <source>Semina.: Ci&#xea;nc. Agr&#xe1;r. Londrina.</source> <volume>42</volume>, <fpage>2751</fpage>&#x2013;<lpage>2768</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5433/1679-0359.2021v42n5p2751</pub-id>
</citation>
</ref>
<ref id="B92">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wei</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Effect of salicylic acid treatment on postharvest quality, antioxidant activities, and free polyamines of asparagus</article-title>. <source>J. Food Sci.</source> <volume>76</volume>, <fpage>S126</fpage>&#x2013;<lpage>S132</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1750-3841.2010.01987.x</pub-id>
</citation>
</ref>
<ref id="B93">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Metabolomics and transcriptome analysis of the biosynthesis mechanism of flavonoids in the seeds of <italic>Euryale ferox</italic> Salisb at different developmental stages</article-title>. <source>Mol. Genet. Genomics</source> <volume>296</volume>, <fpage>953</fpage>&#x2013;<lpage>970</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00438-021-01790-1</pub-id>
</citation>
</ref>
<ref id="B94">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Spatio-temporal variability of surface chlorophyll a in the yellow sea and the east China sea based on reconstructions of satellite data of 2001&#x2013;2020</article-title>. <source>J. Ocean. Limnol.</source> <volume>42</volume>, <fpage>390</fpage>&#x2013;<lpage>407</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00343-023-2335-y</pub-id>
</citation>
</ref>
<ref id="B95">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Fu</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Influence of 1-methylcyclopropene (1-MCP) combined with salicylic acid (SA) treatment on the postharvest physiology and quality of bananas</article-title>. <source>J. Food Process. Pres.</source> <volume>43</volume>, <fpage>e13880</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jfpp.13880</pub-id>
</citation>
</ref>
<ref id="B96">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>An integrated transcriptomic and metabolomic analysis for changes in rose plant induced by rose powdery mildew and exogenous salicylic acid</article-title>. <source>Genomics</source> <volume>114</volume>, <elocation-id>110516</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygeno.2022.110516</pub-id>
</citation>
</ref>
<ref id="B97">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Applications of nitric oxide and&#xa0;melatonin in improving postharvest fruit quality and the separate and crosstalk biochemical mechanisms</article-title>. <source>Trends Food Sci. Technol.</source> <volume>99</volume>, <fpage>531</fpage>&#x2013;<lpage>541</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tifs.2020.03.024</pub-id>
</citation>
</ref>
<ref id="B98">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>UV treatment improved the quality of postharvest fruits and vegetables by inducing resistance</article-title>. <source>Trends Food Sci. Technol.</source> <volume>92</volume>, <fpage>71</fpage>&#x2013;<lpage>80</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tifs.2019.08.012</pub-id>
</citation>
</ref>
<ref id="B99">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Kuang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Metabonomic investigation of <italic>Penicillium expansum</italic> infection of apples and salicylic acid-mediated disease resistance</article-title>. <source>Food Bioprocess. Technol.</source> <volume>17</volume>, <fpage>2869</fpage>&#x2013;<lpage>2884</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11947-023-03302-y</pub-id>
</citation>
</ref>
<ref id="B100">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Meng</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Sheng</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Methyl salicylate-induced arginine catabolism is associated with up-regulation of polyamine and nitric oxide levels and improves chilling tolerance in cherry tomato fruit</article-title>. <source>J. Agric. Food Chem.</source> <volume>59</volume>, <fpage>9351</fpage>&#x2013;<lpage>9357</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/jf201812r</pub-id>
</citation>
</ref>
<ref id="B101">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Mosher</surname> <given-names>S. L.</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Klessig</surname> <given-names>D. F.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Functional analysis of <italic>Arabidopsis</italic> WRKY25 transcription factor in plant defense against <italic>Pseudomonas syringae</italic>
</article-title>. <source>BMC Plant Biol.</source> <volume>7</volume>, <fpage>1</fpage>&#x2013;<lpage>13</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2229-7-2</pub-id>
</citation>
</ref>
<ref id="B102">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Effect of edible coatings on enzymes, cell-membrane integrity, and cell-wall constituents in relation to brittleness and firmness of Huanghua pears (<italic>Pyrus pyrifolia</italic> Nakai, cv. Huanghua) during storage</article-title>. <source>Food Chem.</source> <volume>124</volume>, <fpage>569</fpage>&#x2013;<lpage>575</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2010.06.075</pub-id>
</citation>
</ref>
<ref id="B103">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Transcriptomic and&#xa0;biochemical analysis of highlighted induction of phenylpropanoid pathway metabolism of citrus fruit in response to salicylic acid, <italic>Pichia membranaefaciens</italic> and&#xa0;oligochitosan</article-title>. <source>Postharvest. Biol. Technol.</source> <volume>142</volume>, <fpage>81</fpage>&#x2013;<lpage>92</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.postharvbio.2018.01.021</pub-id>
</citation>
</ref>
<ref id="B104">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yun</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Salicylic acid treatment reduces the rot of postharvest citrus fruit by inducing the accumulation of H<sub>2</sub>O<sub>2</sub>, primary metabolites and lipophilic polymethoxylated flavones</article-title>. <source>Food Chem.</source> <volume>207</volume>, <fpage>68</fpage>&#x2013;<lpage>74</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2016.03.077</pub-id>
</citation>
</ref>
<ref id="B105">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zuo</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Network analysis of noncoding RNAs in pepper provides insights into fruit ripening control</article-title>. <source>Sci. Rep.</source> <volume>9</volume>, <fpage>8734</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-019-45427-1</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>