A total of 15 strains of P. infestans with different pathogenicity were isolated from potato leaves showing late blight symptoms in Yunnan, China ( Table 1 ). The pathogenicity data in the table were determined according to method of detached-leaf inoculation (Raza et al., 2019) in the early stage. For pathogen inoculation, compound leaves from the top to the third leaf position were chosen from potato ‘S88’ grown for 45 days. PE (30,000 U/g, Yien Chemistry, Shanghai, China), derived from Aspergillus niger, was initially dissolved in 99.7% ethanol subsequently diluted with ddH₂O to achieve a final concentration of 1,000 U/mL PE, containing 0.1% ethanol, which was used as a stock solution for later use.

In a petri plate, rye tomato agar (Qian et al., 2021) was amended with PE stock solution at series of concentrations including 0, 10, 100, and 1,000 U/mL. Four strains of P. infestans (HZ02, DL04, HJG02, and ML01-2018) was inoculated onto the plate and grown for 8 days of incubation at 19 °C in the dark. The colony diameter was measured perpendicularly on days 4, 6, and 8. Mycelia were scraped off from the plate and weighed, and then homogenized with water. Sporangia were counted using a hemocytometer. According to the method of Zhu et al. (2015), DL04 sporangia suspension was mixed with different concentrations of PE solution at a ratio of 1:1 to prepare a sporangia suspension containing 8,000 sporangia per mL and various concentrations of PE. Five microliters were pipetted onto the concave slide, and the cover glass was placed in a dark incubator at 19°C for 48 h. Both zoosporic and sporangial germinations were observed under a biomicroscope (E200MV, Nikon, Nanjing, China). Each treatment contained three replicates.

The mycelia of P. infestans DL04 and HJG02 cultured for 10 days were collected using toothpicks, and ground with sterilized water in a mortar with pestle. The sporangium was obtained by filtration through a 300-mesh filter. The sporangia were transferred into 100 U/mL or 1,000 U/mL PE solutions and adjusted to a concentration of 8,000 sporangia per mL, which were used as inocula. According to method of detached-leaf inoculation (Raza et al., 2019), compound potato leaves were cut from the third leaf position and washed three times using sterilized water. Potato tubers were cut into one centimeter disks. Each leaf and tuber was a replicate with six replicates per treatment. Both the leaves and tuber disks were placed on 0.8% water agar. The P. infestans-PE mixture (25 μL) was inoculated onto both sides of the leaf or the center of the tuber disk. Inoculation of sporangium suspension was used as control. One day after the inoculation, the leaves were flipped over and placed in an incubator set to a 12 h light/dark cycle at 19 °C, along with the tuber disk. Disease was evaluated three days after the treatment. The ratio of leaf and tuber lesion area to total leaf and tuber area was used to evaluate the incidence of the disease.

Enzymatic analysis was performed using a pectinesterase kit (Suzhou Grace Biotechnology Co., Ltd., Suzhou, China) to determine the enzymatic activity of P. infestans strains and infected potato leaves. Briefly, 0.15 g P. infestans mycelia were ground with 1.5 mL of the pectinesterase kit in a mortar with a pestle in an ice bath and centrifuged at 12,000 g at 4°C for 15 min. An aliquot of 1 mL of the supernatant was transferred into a centrifuge tube, and 25 μL of reagent 2 and 4 mL of reagent 1 were added in order and mixed well. Subsequently, reagent 3 was added to adjust pH to 7.8 (pink). The tubes were incubated at 37°C in a water bath for 60 min. The pH was maintained to 7.8 (pink) with reagent 4 every 20 minutes. At the same time, the volume V2 (mL) of the consumed reagent 4 was recorded. PE activity (μmoL/min/g) was calculated as = 30 × V2 ÷ W × D (V2: the amount of reagent 4 consumed by titration; D: sample dilution factor; W: sample weight) (Wang et al., 2023).

The DNA of each P. infestans strain was extracted using the Ezup Column Fungal Genomic DNA Extraction Kit (B518259, Sangon Biotech, Shanghai, China). DNA quality was examined on a 1.5% agarose gel using electrophoresis. Pectinesterase nucleotide sequence (XM_ 002907416.1) was used as a template. Polymerase chain reaction (PCR) was performed using the primer pair for pipme1: Pipme1-F1 (5’ CGGTGTCGGAAGGGGTAG 3’) and Pipme1-R1 (5’ TAAGCAGCAGCGTGGTCG 3’). The PCR reaction was prepared in a 25 μL system, containing 2 μL of 10X PCR buffer, 0.5 μL of primer F (10 μM), 0.5 μL of primer R (10 μM), 0.5 μL of dNTP (10 mM), 2 μL of MgCl2 (25 mM), 0.5 μL of Taq Plus DNA Polymerase (5 U/μL), 2 μL of DNA, and 17 μL of ddH₂O. The thermal cycler conditions were as follows: pre-denaturation at 95°C for 3 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s, followed by a final extension at 72°C for 8 min. The PCR products were examined through 1.5% agarose gel using electrophoresis and the target band was cut off and recovered with SanPrep column DNA gel recovery kit (B518259, Sangon Biotech, Shanghai, China).

The PCR product was ligated with the pMD ^® 18-T vector (1000328, TAKARA, Dalian, China). An aliquot of 5 μL of ligation high Solution I, 0.2 μL of pMD ^® 18-T vector, 4.8 μL of PCR product, and total volume were combined. After one hour of ligation at 16°C, the resulting product was transformed using the One-step Rapid Competent Cell Preparation Kit (B529307, Sangon Biotech, Shanghai, China). Subsequently, the plasmid was extracted using a SanPrep column plasmid DNA small extraction kit (B518191, Sangon). The constructed plasmid was confirmed by DNA sequencing. The value of plasmid OD₂₆₀ was measured using a microspectrophotometer and converted into copy number (copies/μL).

The standard curve of plasmids were constructed by 10-fold gradient dilution, including 90 μL diluent and 10 μL plasmid. The product was added into X SG Fast qPCR Master Mix (B639271, BBI, Roche, Rotkreuz, Switzerland), and analyzed using quantitative PCR on a LightCycler480 II fluorescence quantitative PCR instrument (Roche, Rotkreuz, Switzerland). The 10 μL PCR reaction mixture included 5 μL of 2X SybrGreen qPCR Master Mix, 0.2 μL of 10 μM primer F, 0.2 μL 10 μM R, 3.6 μL of ddH₂O, 1.0 μL of DNA. The thermal cycle was 95°C 3min, 95°C 15 s, 60°C 30 s, 45 cycles. The products were placed in a 96-well plate and incubated in LightCycler480 II. After the reaction, the exact copies of pipme1 gene in P. infestans was calculated according to the regression equation established by the standard curve.

Sporangial suspension of P. infestans was inoculated on both sides of potato leaves, and the diseased parts of potato leaves were collected at 0, 12, 24, 36, 48, 60, and 72 h after inoculation, respectively, and frozen in liquid nitrogen and stored at -80°C. RNA was extracted using the UNIQ-10 column Trizol total RNA extraction kit (B511321, Sangon Biotech, Shanghai, China). The integrity and purity of RNA were determined using 1% agarose gel electrophoresis and the ultraviolet spectrophotometer (SMA4000, Merinton Instrument, Inc. Beijing, China). A total of 1200 ng of total RNA was added to the nuclease-free PCR tube on ice, with 1 µL Random Primer p (dN)₆ (100 pmol), 1 µL dNTP Mix (0.5 mM final concentration), and RNase-free ddH₂O to bring the volume up to 14.5 µL. The mixture was gently mixed and briefly centrifuged for 3 to 5 s. The reaction mixture was incubated at 65°C for 5 min, ice bathed for 2 min, and centrifuged for 3 to 5 s. A test tube was placed in an ice bath, then 4 µL 5X RT Buffer, 0.5 µL Thermo Scientific RiboLock RNase Inhibitor (20 U), and 1 µL Maxima Reverse Transcriptase (200 U) were added. The tube was gently shaken and centrifuged for 3 to 5 s. A reverse transcription reaction was carried out on a PCR instrument. The obtained cDNA template was used for subsequent expression analysis.

Fluorescence quantitative PCR was performed using cDNA as the template, with the actin housekeeping gene as the target for amplification. PCR primers were actin-F2 (5’ TGCCTGATGGACAAGTTATTACC 3’) and actin-R2 (5’ CCACTGAGCACAATGTTACCG 3’). Fluorescence quantitative real-time PCR (RT-qPCR) was performed using 2X SG Fast qPCR Master Mix (B639271, BBI, Roche) on a LightCycler 480 II fluorescence quantitative PCR instrument. The reaction mixture contained 1.0 μL cDNA, 5 μL SYBR Green qPCR Master Mix, and 0.2 μL 10 μmol/L primers, and 3.6 μL RNase-free water. The thermal cycle consistent with the above. The relative quantitation of gene expression between samples was analyzed using the 2^–ΔΔCT method (Livak and Schmittgen, 2001), comparing the cycle threshold (CT) values of the housekeeping gene actin and the CT value of the pipme1 gene.

SPSS version 17.0 software (SPSS Inc., Chicago, IL) and Prism 7.0 software (GraphPad Inc., USA) were used for general statistical analyses. The normality of distribution and homogeneity of variance were evaluated before statistical analysis was conducted. Mean separation among treatments was analyzed by oneway analysis of variance and Duncan’s multiple range test (p < 0.05).

Mycelial weight, sporangia concentration, and spore germination of four strains of P. infestans were measured on a PE-amended agar medium. Results showed that PE increased the growth of P. infestans to various degrees ( Figure 1 ). PE at 10 U/mL significantly increased the weight of mycelia of ML01-2018 and HJG02 ( Figure 1E ). PE at 10 U/mL significantly increased the number of sporangia of all four strains ( Figure 1F ). PE at 10 U/mL and 500 U/mL significantly promoted the sporangial germination but not zoosporic germination of strain DL04 ( Figure 1G ). Therefore, PE promotes the growth of P. infestans, increases the weight of mycelium, the number of sporangia, and promotes the sporangial germination of P. infestans under certain conditions.

Compared with the control, the central lesion area on potato leaves and tubers, inoculated with strains DL04 and HJG02, was largest after adding 1,000 U/mL PE solution, indicating that a high concentration of PE can accelerate the infection of the leaf by P. infestans ( Figure 2 ). However, this result was not observed at a lower PE concentration (100 U/mL). It is speculated that the pathogenicity of the two strains may be relatively strong, and they can secrete PE themselves. A low concentration of PE is not sufficient to produce a significant infection. It indicated a low concentration of PE had no promoting effect on the infection of potato leaves and tubers by P. infestans.

There were significant differences in PE activity among different P. infestans strains after 8 d of culture. Combining with pathogenicity, it was found that ML01-2018 had the strongest pathogenicity, followed by DL04, HJG02 and MLYWS8802; while HZ02 and HS03 had the weakest pathogenicity ( Figure 3A ), the results of PE activity were consistent with the pathogenicity. The correlation between PE activity and pathogenicity of six P. infestans was analyzed by Pearson ( Supplementary Figure S1 ). There were high positive correlations between the PE activity and pathogenicity of P. infestans, the r value was 0.94, the linear equation was y = 0.5089x - 8.014 (R² = 0.88, p = 0.006), the difference was highly significant (p < 0.01). It indicating that P. infestans with high PE activity had strong pathogenicity ( Figure 3B ).

The enzymatic activity in potato leaves inoculated with DL04 and HZ02 was determined at different time points ( Figure 3C ). The enzymatic activity increased with the extension of infection time and decreased after reaching the highest point. The enzymatic activity of DL04 was highest at 24 h after infection, and that of HZ02 was highest at 48 h after infection. The enzymatic activity of DL04 was significantly higher than that of HZ02 at 24 h and 72 h after infection, which was consistent with the pathogenicity results. It indicated that the activity of PE could affect the pathogenicity of P. infestans to potato leaves.

PE genes were expressed in different pathogenic strains, and the expression levels of the gene product were significantly different. The gene product level of HS03 and JCZ29 was the lowest ( Figure 4 ), while the pathogenicity of four strains of P. infestans isolated from Huize, including HS03 and JCZ29, was consistently low. The pipme1 gene product level of P. infestans varied depending on the region of isolation. The level of gene product was in the order from high to low: HS03 (Huize) < MLS13418 (Malong) < LJ04 (Lijiang) < ZTQ907 (Zhaotong) < DQ01 (Diqing). The level of P. infestans gene products isolated from the same region was also different. The pipme1 expression of P. infestans strains from Huize varied from high to low: HS03 < JCZ29 < HS02 < HZ02. The level of PE gene product in the strains with strong pathogenicity in the test materials was relatively high. The level of ML01-2018 gene product was higher than that of DL04, HJG02, MLYWS8802, while HZ02 and HS03 had the lowest level, which was consistent with the results of the enzyme activity assay. The correlation between copies of pipme1 DNA and pathogenicity of 15 strains of P. infestans was analyzed ( Supplementary Figure S2 ). There were positive correlations between the DNA copies of the pectinesterase gene pipme1 and pathogenicity, the r value was 0.65, the linear equation was y = 0.01x + 10.20 (R² = 0.42; p = 0.009), the difference was highly significant (p < 0.01). It indicating that the expression of the pectinesterase gene pipme1 could affect the pathogenicity of P. infestans to potato leaves.

The level of PE gene product was determined using fluorescence quantitative PCR in potato leaves infected by P. infestans after 0 h, 12 h, 24 h, 36 h, 48 h, 56 h and 72 h. The level of pipme1 product in HZ02 and DL04 increased with the extension of infection time, which was consistent with the pathogenicity test ( Figure 5 ). There was a significant difference in gene product level between HZ02 and DL04 at the same time point after infection. The expression levels of the genes were consistent across different strains. After 48 hours of infection with HZ02, the pipme1 gene expression was observed, and the expression level increased significantly, reaching the highest at 72 hours post inoculation. The pipme1 of DL04 began to express at 24 h after infection, and the expression level increased significantly, reaching the highest at 56 h post inoculation. Although the two strains had the same trend of pipme1 expression after infection, the expression patterns were different. Therefore, the gene expression of DL04 strain with strong pathogenicity was faster than that of HZ02, indicating that the gene was a major factor leading to the pathogenic difference and the speed of leaf disease development.