<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1266699</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Genome-wide identification and expression analysis of the <italic>NHX</italic> gene family under salt stress in wheat (<italic>Triticum aestivum</italic> L)</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Sharma</surname>
<given-names>Pradeep</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/53618"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mishra</surname>
<given-names>Shefali</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Pandey</surname>
<given-names>Bharati</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/396911"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Singh</surname>
<given-names>Gyanendra</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Crop Improvement division, ICAR-Indian Institute of Wheat and Barley Researh</institution>, <addr-line>Karnal</addr-line>, <country>India</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Division of AgriBioinformatics, ICAR-Indian Agricultural Statistics Research Institute</institution>, <addr-line>New Delhi</addr-line>, <country>India</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Sushil Satish Chhapekar, University of Missouri, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Shumayla, Texas Tech University, United States; Parviz Heidari, Shahrood University of Technology, Iran</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Pradeep Sharma, <email xlink:href="mailto:Pradeep.Sharma@icar.gov.in">Pradeep.Sharma@icar.gov.in</email>
</p>
</fn>
<fn fn-type="present-address" id="fn003">
<p>&#x2020;Present address: Bharti Pandey, ICAR-National Dairy Research Institute, Karnal, India</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>04</day>
<month>12</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1266699</elocation-id>
<history>
<date date-type="received">
<day>25</day>
<month>07</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>06</day>
<month>11</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Sharma, Mishra, Pandey and Singh</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Sharma, Mishra, Pandey and Singh</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Salt stress affects plant growth and development, resulting in the loss of crop yield across the world, and sodium-proton antiporters (NHXs) are one of the genes known to promote salt tolerance in transgenic plants. In this study, we conducted a comprehensive genome-wide analysis and expression profile of <italic>NHX</italic> genes in wheat under salinity stress. We identified 30 <italic>TaNHX</italic> genes in wheat based on the Na<sup>+</sup>/H<sup>+</sup> exchanger domain, with all genes containing an amiloride motif except one, a known for inhibiting Na<sup>+</sup> ions in plants. Phylogenetic analysis classified these genes into three classes with subfamilies: 12 were localized in vacuoles, while 18 were in the endoplasmic reticulum and plasma membrane. Promoter analysis revealed stress-related <italic>cis</italic>-acting elements, indicating their potential role in abiotic stress tolerance. The non-synonymous (K<sub>a</sub>)/synonymous (K<sub>s</sub>) ratios highlighted that the majority of <italic>TaNHX</italic> genes experienced robust purifying selection throughout their evolutionary history. Transcriptomis data analysis and qRT-PCR demonstrated distinct expression patterns for <italic>TaNHX</italic> genes across various tissues when subjected to salt stress. Additionally, we predicted 20 different miRNA candidates targeting the identified <italic>TaNHX</italic> genes. Protein-protein interaction prediction revealed NHX6&#x2019;s involvement in the SOS1 pathway, while <italic>NHX1</italic> gene exhibit proton antiporter activity. Molecular dynamics (MD) simulations were also conducted to examine the interactions of <italic>TaNHX1</italic>, <italic>TaNHX2</italic>, and <italic>TaNHX3</italic>. These results represent a significant advancement in our understanding of the molecular mechanisms governing Na<sup>+</sup> transporters. This may also offer promising avenues for future studies aimed at unraveling the intricate details of their biological roles and applications.</p>
</abstract>
<kwd-group>
<kwd>Na +/H + antiporter</kwd>
<kwd>amiloride-binding site</kwd>
<kwd>molecular dynamics</kwd>
<kwd>gene expression</kwd>
<kwd>salt stress</kwd>
<kwd>wheat</kwd>
</kwd-group>
<counts>
<fig-count count="10"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="48"/>
<page-count count="17"/>
<word-count count="8794"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Plant Abiotic Stress</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Soil salinity stands as a formidable challenge with far-reaching consequences for agriculture on a global scale, impacting a staggering 45 million hectares of irrigated land (<xref ref-type="bibr" rid="B43">Wu et&#xa0;al., 2019</xref>). This issue carries immense significance, as it directly influences the capacity to sustain agricultural productivity. This becomes particularly critical when we consider that irrigated lands, renowned for their ability to yield twice the food production compared to rain-fed areas (<xref ref-type="bibr" rid="B2">Aharon et&#xa0;al., 2003</xref>), are pivotal in addressing the pressing concerns of food security and resource sustainability. Furthermore, projections indicate that around 50% of cultivable land could be affected by excessive salinization by 2050 (<xref ref-type="bibr" rid="B12">Gaxiola et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B29">Pehlivan et&#xa0;al., 2016</xref>). The increasing global population further underscores the need to resolve this issue to secure food security and the sustainability of agricultural practices.</p>
<p>In response to the adverse effects of salt stress, plants activate a range of sophisticated mechanisms to ensure their survival. These include complex hormonal regulation of plant growth and metabolism, precise osmotic regulation, and ion homeostasis maintenance (<xref ref-type="bibr" rid="B41">Wu et&#xa0;al., 2019a</xref>). The role of sodium/hydrogen antiporter (NHX) proteins is pivotal in regulating ion homeostasis. These proteins intricately modulate the equilibrium of ions, as underscored by their interplay with the essential proton pumps, the H+-PPase and H+-ATPase enzymes. Together, they meticulously orchestrate the translocation of sodium ions (Na+) from the dynamic cytoplasmic milieu to designated cellular destinations, including vacuolar compartments and extracellular regions. This ion flux operation serves as a vigilant guardian, staunchly preventing the potential deleterious accrual of Na<sup>+</sup> ions within the intricate confines of cellular compartments (<xref ref-type="bibr" rid="B2">Aharon et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B9">Dragwidge et&#xa0;al., 2019</xref>).</p>
<p>The <italic>TaNHX</italic> gene family encodes widely distributed transmembrane proteins classified under the monovalent cation/proton antiporter 1 (CPA1) category (<xref ref-type="bibr" rid="B11">Fukuda et&#xa0;al., 2011</xref>). Prior studies (<xref ref-type="bibr" rid="B41">Wu et&#xa0;al., 2019a</xref>) have revealed that NHX proteins typically encompass 10&#x2013;12 transmembrane helices (TMs) and predominantly inhabit vacuolar, endosomal, and plasma membrane locales (<xref ref-type="bibr" rid="B2">Aharon et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B29">Pehlivan et&#xa0;al., 2016</xref>). In <italic>A. thaliana</italic>, eight distinct NHX genes were identified (<xref ref-type="bibr" rid="B12">Gaxiola et&#xa0;al., 1999</xref>). These genes exhibit diverse subcellular distributions, with two <italic>NHX</italic> genes (AtNHX7 and AtNHX8) residing within the plasma membrane (PM-class), four inhabiting vacuoles (Vac-class), and two localizing to endosomes (Endo-class) (<xref ref-type="bibr" rid="B33">Shi et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B2">Aharon et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B5">Brett et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B4">Bassil et&#xa0;al., 2011</xref>). NHX proteins are distributed in a way that they reflects the specific roles they play in maintaining ion homeostasis in different environmental conditions.</p>
<p>Understanding the different mechanisms of <italic>NHX</italic> gene function is critical for decoding the plants complex response to salt stress. We can gain a valuable understanding of the critical roles that <italic>TaNHX</italic> genes play in regulating salt stress in various plant species by examining their regulatory functions, and evolutionary relationships. Such bioinformatics studies and experimental investigations pave the way for future research and manipulation of <italic>NHX</italic> genes, contributing to the production of salt-tolerant crop varieties and enhancing agricultural productivity in salt-affected regions.</p>
<p>
<italic>NHX</italic> genes are intricately involved in a multitude of biological processes, including response to salt stress, regulation of cell growth, modulation of membrane vesicle trafficking, and maintenance of pH homeostasis (<xref ref-type="bibr" rid="B9">Dragwidge et&#xa0;al., 2019</xref>). After inactivating the mutation in <italic>AtNHX5</italic> and <italic>AtNHX6</italic>, it was observed that there were development-related disorders and anomalies in cell division in tissues of the embryo and roots (<xref ref-type="bibr" rid="B9">Dragwidge et&#xa0;al., 2019</xref>). <italic>OsNHX1, OsNHX2, OsNHX3</italic>, and <italic>OsNHX5</italic> in rice become activated when they are exposed to salt stress, hyperosmotic stress, and ABA stress conditions. Determining the salt tolerance mechanisms within the rice plant may be delineated by the nuanced expression patterns of <italic>NHX</italic> genes across diverse tissue types (<xref ref-type="bibr" rid="B11">Fukuda et&#xa0;al., 2011</xref>). In other experiments, rye grass engineered with the rice vacuolar membrane <italic>OsNHX1</italic> gene endured high salt conditions (350 mM) for 10 weeks, while transgenic <italic>B. napus</italic> plants thrived even in the presence of 200 mM NaCl. Introducing the Vac-class membrane gene <italic>AgNHX1</italic> from <italic>A. gmelinii</italic> into rice plants conferred the ability to withstand 300 mM NaCl for three days, surpassing the salt sensitivity of wild-type rice. Overexpression of <italic>AtNHX1</italic> from <italic>A. thaliana</italic> into tomato and <italic>SsNHX1</italic> from <italic>Salsola collina</italic> into <italic>M. sativa</italic> significantly improves salt tolerance in plants. These findings underscore the potential of <italic>NHX</italic> genes to enhance salt tolerance in various plant species (<xref ref-type="bibr" rid="B25">Manik et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B40">Wilkins et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B20">Kumari et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B41">Wu et&#xa0;al., 2019a</xref>). The most widely grown crop in the world is wheat. Its growth is significantly impeded by salt stress since it is not a halophyte. When exposed to salt, wheat cells quickly increase their Na<sup>+</sup> concentration. Due to the relatively low net uptake compared to unidirectional inflow (<xref ref-type="bibr" rid="B17">Khare et&#xa0;al., 2015</xref>), it was expected that wheat roots would experience high rates of Na<sup>+</sup> efflux. The ability of a wheat Na<sup>+</sup>/H<sup>+</sup> antiporter (TaSOS1) to extrude Na<sup>+</sup> across the plasma membrane has been experimentally studied (<xref ref-type="bibr" rid="B27">Parveen et&#xa0;al., 2021</xref>). Overexpression of the vacuolar NHX antiporter <italic>AtNHX1</italic> from Arabidopsis led to an increase in wheat salt tolerance (<xref ref-type="bibr" rid="B27">Parveen et&#xa0;al., 2021</xref>). The putative wheat Na<sup>+</sup>/H<sup>+</sup> antiporter TaNHX1 provided salt tolerance to transgenic Arabidopsis plants (<xref ref-type="bibr" rid="B31">Ramesh et&#xa0;al., 2019</xref>). In a previous study, <italic>TaNHX2</italic> was cloned from bread wheat, and it was examined for its expression and function of the protein and yeast. The proposition that <italic>TaNHX2</italic> mediates the compartmentalization of Na<sup>+</sup> into vacuoles holds promise for elucidating its pivotal role in enhancing a plant&#x2019;s salt tolerance. Nevertheless, the precise mechanisms underlying TaNHX2&#x2019;s participation in Na<sup>+</sup>/H<sup>+</sup> exchange and its subcellular localization within plant cells remain unverified (<xref ref-type="bibr" rid="B34">Shuai et&#xa0;al., 2013</xref>). In this study, we performed a genome-wide investigation of all <italic>TaNHX</italic> gene family members in wheat. The <italic>TaNHX</italic> genes were identified using gene structure, chromosomal locations, phylogenetic relationships, <italic>cis-</italic>element, and expression profiling, as well as molecular dynamic simulations. The expression patterns obtained from <italic>in-silico</italic> analysis were then confirmed using qRT-PCR. <italic>TaNHX</italic> can be used to breed salt tolerance using genome-editing methods. The results taken here are necessary to systematically explore the gene function of the wheat <italic>TaNHX</italic> gene family.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Identification, characterization, phylogenetic analysis and gene ontology of sodium proton antiporters</title>
<p>To identify <italic>TaNHX</italic> genes in wheat, we employed a bioinformatics approach. Firstly, we obtained protein sequences of NHX from Arabidopsis, cotton, sorghum, and barley, which served as query sequences. These query sequences were then searched against the wheat genome available at the Ensembl Genomes database (fp://fp.ensemblgenomes.org/pub/plants/release-51/fasta/triticumaestivum/pep/) using the BLASTP algorithm. We selected all homologous protein sequences of NHX candidates that met the specified criteria, including an e-value threshold of 1e-10 and a bit score value higher than 100 percent. To further validate the presence of the Na<sup>+</sup>_H<sup>+</sup>_Exchanger domain (PF00999) characteristic of NHX transporters, the obtained sequences were scanned against this domain using the HMMER 3.1b2 online software (<ext-link ext-link-type="uri" xlink:href="https://www.ebi.ac.uk/Tools/hmmer/">https://www.ebi.ac.uk/Tools/hmmer/</ext-link>) (<xref ref-type="bibr" rid="B30">Potter et&#xa0;al., 2018</xref>).</p>
<p>For the subcellular localization, Wolf Psort (<ext-link ext-link-type="uri" xlink:href="https://wolfpsort.hgc.jp/">https://wolfpsort.hgc.jp/</ext-link>) was used. The physio-chemical properties were predicted using the online programme ProtParam (<ext-link ext-link-type="uri" xlink:href="http://web.expasy.org/protparam/">http://web.expasy.org/protparam/</ext-link>).To study the evolutionary linkage, Clustal W software was used to analyze NHX protein sequences from Arabidopsis, barley, sorghum, cotton, and wheat (<xref ref-type="bibr" rid="B21">Larkin et&#xa0;al., 2007</xref>). Following that, an unrooted phylogenetic tree was built in MEGA-X with 1000 bootstrap repetitions using Maximum likelihood (ML) with default parameters the JTT model with uniform rates and 4 number of threads (<xref ref-type="bibr" rid="B19">Kumar et&#xa0;al., 2018</xref>). NHX members in wheat were classified into subfamilies based on their Arabidopsis, barley, sorghum, and cotton homologs.</p>
<p>Functional annotation of the identified genes was performed using Blast2GO (<ext-link ext-link-type="uri" xlink:href="https://www.blast2go.com/">https://www.blast2go.com/</ext-link>). This analysis enabled the elucidation of molecular functions, biological processes, and cellular components intricately linked to the genes under investigation. Additionally, we harnessed the KEGG (Kyoto Encyclopaedia of Genes and Genomes) database (<ext-link ext-link-type="uri" xlink:href="http://www.genome.jp/kegg/">http://www.genome.jp/kegg/</ext-link>) to annotate the metabolic pathways, thus furnishing invaluable insights into the precise pathways where these genes actively participate. The combination of Blast2GO and KEGG analysis allowed for a comprehensive understanding of the functional properties and metabolic roles of the identified genes.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Conserved motifs, gene structure, promoter analysis and physical mapping of NHX genes</title>
<p>To unravel the presence of conserved motifs within the identified genes, we used the MEME webserver (Multiple Em for Motif Elicitation). Employing default parameters, which encompassed the exploration of 2-20 motif sites, the extraction of up to 10 motifs, and a motif width range extending from 6 to 50 (<xref ref-type="bibr" rid="B3">Bailey et&#xa0;al., 2009</xref>), this analysis provided an intricate glimpse into the genetic signatures. Furthermore, we delved into the gene structure using the Gene Structure Display Server (GSDS) tool (<xref ref-type="bibr" rid="B16">Hu et&#xa0;al., 2015</xref>), unravelling the intricacies of these genes&#x2019; architectural features. This comprehensive approach not only unveiled conserved motifs but also shed light on the structural nuances inherent to the genes under study. The promoter sequences, of up to 2 kb in size, were used for <italic>cis</italic>-acting element analysis and submitted to the PLANTCARE webserver. The <italic>cis-</italic>acting elements that were produced were categorized according to their functional class.</p>
<p>Based on the position sites, the chromosomal locations of the wheat <italic>TaNHX</italic> genes were examined. The Ensembl database is used to retrieve information about the Ta<italic>NHX</italic> gene&#x2019;s locations. Physical mapping of the transporters was constructed using Map-Chart software to construct the location on the wheat genome (<xref ref-type="bibr" rid="B39">Voorrips, 2002</xref>).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Protein-protein interaction, miRNA targeting, and gene duplication events</title>
<p>For the identification of functional protein-protein interactions, the STRING v1054 databases were employed (<xref ref-type="bibr" rid="B36">Szklarczyk et&#xa0;al., 2015</xref>). However, Arabidopsis was used as the reference species to search the interactive network in the database. Blast the sequences with set parameters to an e-value of 1e-10, and the <italic>A. thaliana</italic> genome was searched against all known interaction partners. The best-hit gene for each gene was chosen using Cytoscape 58 to create a PPI network. Using Cytoscape&#x2019;s cyto Hubba plugin, the top hub gene from the interaction network was finally determined. Furthermore, we conducted an analysis to pinpoint significant Gene Ontology (GO) terms (FDR &#x2264; 0.01) related to the molecular functions and biological processes of the interaction network nodes using the iDEP webtool (<xref ref-type="bibr" rid="B13">Ge et&#xa0;al., 2018</xref>). The transcript sequences of the <italic>TaNHX</italic> gene were obtained using the Ensembl plant database. Now, the transcript sequences of <italic>TaNHX</italic> and the mature miRNA sequences from miRbase (<xref ref-type="bibr" rid="B18">Kozomara and Griffiths-Jones, 2014</xref>) were analyzed by using the psRNATarget service&#x2019;s default settings (<xref ref-type="bibr" rid="B8">Dai and Zhao, 2011</xref>) to find the targets of miRNAs.</p>
<p>We accessed the coding sequences (CDS) of <italic>T. urartu</italic> (A genome), <italic>A. tauschii</italic> (D genome), and <italic>T. dicoccoides</italic> (AB genome) from Ensembl plants (fp://fp.ensemblgenomes.org/- pub/plants/release-42/fasta/triticum_urartu,fp://fp.ensemblgenomes.org/pub/release-42/plants/fasta/aegilops_tauschii/cds,fp://fp.ensemblgenomes.org/pub/release-42/plants/fasta/triticum_dicoccoides/cds/). These genomes served as references for the A, D, and AB genomes, respectively. We conducted BLASTn searches using these sequences against the TaNHX CDS sequences in <italic>T. aestivum</italic> to identify orthologous genes. Top hits were designated as orthologs within each species, adhering to stringent criteria, including an e-value cut-off of 1e-10 and a 150-bit-score cut-off. This approach was similarly applied to search for orthologous genes in other monocots and dicots, including <italic>O. sativa</italic>, <italic>H. vulgare</italic>, <italic>Z. mays</italic>, and <italic>A. thaliana</italic>. To examine the synteny relationships of the <italic>NHX</italic> gene family within and across various species, we employed TBtools for a comprehensive analysis.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Gene expression profiling using RNA-seq data</title>
<p>To determine <italic>in-silico</italic> gene expression in different tissues under salinity stress, the log<sub>2</sub> value of the FPKM value was calculated using the SRA data (SRP304900) from NCBI. Heatmaps were created with Clustvis (<ext-link ext-link-type="uri" xlink:href="https://biit.cs.ut.ee/clustvis/">https://biit.cs.ut.ee/clustvis/</ext-link>).</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Sample collection and treatments</title>
<p>To investigate the expression patterns of <italic>TaNHX</italic> genes in response to salinity stress, we sourced wheat genotypes, specifically KRL213 and HD2009, from the Germplasm Unit of the ICAR-Indian Institute of Wheat and Barley Research, located in Karnal, India. In a controlled environment, we initiated the germination process by placing the seeds in Petri dishes at a temperature of 22&#xb0;C. Prior to germination, the seeds were sterilization using a 1% sodium hypochlorite solution for duration of 10 minutes, followed by thorough rinsing with distilled water, ensuring the removal of any residual sterilization agents. After five days of germination, seedlings were transferred to full-strength Hoagland&#x2019;s solution phytojars and incubated for 14 days in a BOD incubator with two sets of three biological replicates of each genotype. For salt stress, two contrasting wheat genotypes, HD2009 (salt sensitive) and KRL213 (salt tolerant), were used. Both genotypes at the two-leaf seedling stage were stressed with 150 mM NaCl. After the treatment, the leaf samples were taken at 0, 3, 24, and 48 hours. For total RNA isolation, all acquired samples were immediately wrapped in foil and frozen in liquid nitrogen at -80&#xb0;C.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>RNA extraction and qRT-PCR analysis</title>
<p>To isolate RNA, we employed TRIzol reagent following the manufacturer&#x2019;s guidelines. The extracted RNA was further processed to eliminate any residual DNA through DNase I treatment (NEB, USA). Utilizing Superscript-III reverse transcriptase (Invitrogen, USA), 1 &#xb5;g of total RNA was converted into the first strand of cDNA. This resulting cDNA was subsequently diluted at 1:2 ratio, and 1 &#xb5;l of the diluted cDNA was employed as a template within a 10 &#xb5;l reaction volume for real-time qRT-PCR analysis. We conducted SYBR Green-based real-time quantitative RT-PCR analysis using the BIO-RAD CFX96 system (Bio-Rad). For normalization purposes, we employed wheat actin as an endogenous control (<xref ref-type="bibr" rid="B26">Muthusamy et&#xa0;al., 2016</xref>). The expression levels were quantified as relative fold changes through the application of the 2<sup>&#x25b3;&#x25b3;-Ct</sup> method (<xref ref-type="bibr" rid="B23">Livak and Schmittgen, 2001</xref>). All the samples were set up in 3 biological replicates. Experimental data was statistically analyzed by a one-way Analysis of Variance (ANOVA) and Tukey&#x2019;s multiple range test was used for mean value separation by PAST software (<xref ref-type="bibr" rid="B15">Hammer et&#xa0;al., 2001</xref>). P-value of &lt;0.05 was considered statistically significant.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Molecular modelling and dynamics simulations</title>
<p>The three-dimensional structure for TaNHX was generated using AlphaFold2 (<xref ref-type="bibr" rid="B35">Skolnick et&#xa0;al., 2021</xref>), as it employs deep learning techniques, specifically deep neural networks, to predict protein structures with remarkable accuracy. It leverages vast amounts of protein sequence and structural data to generate predictions of protein structures, even for proteins with no known structures.</p>
<p>The molecular dynamics simulations (MDS) were performed using GROMCAS 5.0 (<xref ref-type="bibr" rid="B1">Abraham et&#xa0;al., 2015</xref>). The simulations aimed to investigate the conformational changes of the TaNHX protein structures in the presence of a solvent system. To set up the simulations, the OPLS_2005 force field (<xref ref-type="bibr" rid="B10">Dubay et&#xa0;al., 2012</xref>) was employed to describe the interactions within the proteins. The system was solvated in a cubic water box using the SPC water model. The protein atoms were kept at a minimum distance of 10 &#xc5; from the edges of the box. To achieve a neutral charge for the systems, counter ions were added, and a 0.15 M ionic concentration was maintained by including Na<sup>+</sup> and Cl ions. First, each system underwent 50,000 steps of steepest descent energy minimization, which helped eliminate steric overlap and stabilize the initial configurations. Following the energy minimization, a two-step equilibration phase was performed. The first step was NVT equilibration, where the number of particles, volume, and temperature were kept constant. This phase ran for 100 picoseconds (ps) to stabilize the system&#x2019;s temperature. The V-rescale temperature-coupling method was used for NVT, with a constant coupling time of 1 ps and a target temperature of 303.15 K. The second step was NPT equilibration, where the number of particles, pressure, and temperature were maintained constant. This phase also ran for 100 ps, and it involved using the Nose-Hoover pressure coupling method with a constant coupling time of 1 ps and a target temperature of 303.15 K. During this phase, the system was relaxed, and the protein was restrained using position restraints (h-bonds). To account for electrostatic interactions, the Particle Mesh Ewald method was employed for both NVT and NPT simulations. After the equilibration phases, each system underwent a full production run of 30 nanoseconds (ns) without any restraints. The integration time step used was 0.002 ps, and coordinates were recorded every 10 ps using an xtc collection interval of 5,000 steps.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Characterization, phylogenetic analysis, and gene ontology of TaNHX genes in wheat</title>
<p>In order to identify members of the <italic>TaNHX</italic> gene family within the wheat genome, we employed a two-step approach. Firstly, utilized known NHX sequences from other species as queries and performed a blast search against the wheat proteome database (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>). This enabled us to retrieve putative <italic>TaNHX</italic> genes in wheat. Subsequently, we eliminated redundant sequences and confirmed the gene identifications based on the presence of the Na<sup>+_</sup>H<sup>+</sup>_Exchanger domain (PF00999). This stringent filtering process resulted in the identification of 30 <italic>TaNHX</italic> genes in <italic>T. aestivum</italic>.</p>
<p>To understand the physio-chemical properties of the wheat <italic>TaNHX</italic> genes, we conducted a comprehensive analysis, the results of which are summarized in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. Hence, to determine the subcellular localization of NHX proteins, prediction tools have been employed, which were found to predominantly reside on the plasma membrane, endosomes, and vacuoles. Furthermore, we assessed several parameters, including the number of amino acids, which ranged from 374 to 1191, reflecting the diversity in NHX protein lengths. Additionally, the molecular weight of the NHX proteins revealed a wide range of values. For instance, TaNHX16 exhibited a molecular weight of 40.84 kDa, whereas TaNHX11 displayed the highest molecular weight of 131.42 kDa. The findings presented in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref> shed light on the distinct physiochemical characteristics of the identified wheat <italic>NHX</italic> genes.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Features of the 30 NHX proteins from <italic>T. aestivum</italic> identified in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene Name</th>
<th valign="top" align="center">Transcript ID</th>
<th valign="top" align="center">Chr. No.</th>
<th valign="top" align="center">Start</th>
<th valign="top" align="center">End</th>
<th valign="top" align="center">No. of aa</th>
<th valign="top" align="center">Mole.weight</th>
<th valign="top" align="center">pI</th>
<th valign="top" align="center">Inst.Index</th>
<th valign="top" align="center">Aliphatic index</th>
<th valign="top" align="center">GRAVY</th>
<th valign="top" align="center">Sub-cellul. Loc.</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center">TaNHX1</td>
<td valign="top" align="center">TraesCS1A02G102300.1</td>
<td valign="top" align="center">1A</td>
<td valign="top" align="center">98242495</td>
<td valign="top" align="center">98247975</td>
<td valign="top" align="center">546</td>
<td valign="top" align="center">59704.39</td>
<td valign="top" align="center">8.13</td>
<td valign="top" align="center">31.03</td>
<td valign="top" align="center">117.66</td>
<td valign="top" align="center">0.675</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX2</td>
<td valign="top" align="center">TraesCS1B02G112700.1</td>
<td valign="top" align="center">1B</td>
<td valign="top" align="center">130636812</td>
<td valign="top" align="center">130643984</td>
<td valign="top" align="center">1034</td>
<td valign="top" align="center">114574.21</td>
<td valign="top" align="center">5.92</td>
<td valign="top" align="center">44.44</td>
<td valign="top" align="center">100.93</td>
<td valign="top" align="center">0.074</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX3</td>
<td valign="top" align="center">TraesCS1D02G093900.1</td>
<td valign="top" align="center">1D</td>
<td valign="top" align="center">79434999</td>
<td valign="top" align="center">79440799</td>
<td valign="top" align="center">546</td>
<td valign="top" align="center">59718.42</td>
<td valign="top" align="center">8.13</td>
<td valign="top" align="center">31.26</td>
<td valign="top" align="center">117.84</td>
<td valign="top" align="center">0.679</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX4</td>
<td valign="top" align="center">TraesCS2A02G034700.1</td>
<td valign="top" align="center">2A</td>
<td valign="top" align="center">15185525</td>
<td valign="top" align="center">15223170</td>
<td valign="top" align="center">546</td>
<td valign="top" align="center">59712.37</td>
<td valign="top" align="center">8.14</td>
<td valign="top" align="center">31.01</td>
<td valign="top" align="center">117.66</td>
<td valign="top" align="center">0.68</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX5</td>
<td valign="top" align="center">TraesCS2A02G121000.1</td>
<td valign="top" align="center">2A</td>
<td valign="top" align="center">70876938</td>
<td valign="top" align="center">70881306</td>
<td valign="top" align="center">538</td>
<td valign="top" align="center">59112.45</td>
<td valign="top" align="center">8.41</td>
<td valign="top" align="center">33.39</td>
<td valign="top" align="center">112.17</td>
<td valign="top" align="center">0.591</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX6</td>
<td valign="top" align="center">TraesCS2A02G133600.1</td>
<td valign="top" align="center">2A</td>
<td valign="top" align="center">80270608</td>
<td valign="top" align="center">80279857</td>
<td valign="top" align="center">760</td>
<td valign="top" align="center">84097.17</td>
<td valign="top" align="center">6.52</td>
<td valign="top" align="center">31.25</td>
<td valign="top" align="center">110.76</td>
<td valign="top" align="center">0.321</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX7</td>
<td valign="top" align="center">TraesCS2B02G141900.1</td>
<td valign="top" align="center">2B</td>
<td valign="top" align="center">108237682</td>
<td valign="top" align="center">108242312</td>
<td valign="top" align="center">598</td>
<td valign="top" align="center">66390.72</td>
<td valign="top" align="center">9.2</td>
<td valign="top" align="center">41.21</td>
<td valign="top" align="center">105.97</td>
<td valign="top" align="center">0.393</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX8</td>
<td valign="top" align="center">TraesCS2D02G123000.1</td>
<td valign="top" align="center">2D</td>
<td valign="top" align="center">71767337</td>
<td valign="top" align="center">71771197</td>
<td valign="top" align="center">532</td>
<td valign="top" align="center">58542.8</td>
<td valign="top" align="center">8.13</td>
<td valign="top" align="center">32.62</td>
<td valign="top" align="center">112.71</td>
<td valign="top" align="center">0.604</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX9</td>
<td valign="top" align="center">TraesCS2D02G135600.1</td>
<td valign="top" align="center">2D</td>
<td valign="top" align="center">79692600</td>
<td valign="top" align="center">79701662</td>
<td valign="top" align="center">771</td>
<td valign="top" align="center">85272.1</td>
<td valign="top" align="center">6.56</td>
<td valign="top" align="center">33.29</td>
<td valign="top" align="center">110.45</td>
<td valign="top" align="center">0.337</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX10</td>
<td valign="top" align="center">TraesCS3A02G023200.2</td>
<td valign="top" align="center">3A</td>
<td valign="top" align="center">12969505</td>
<td valign="top" align="center">12980909</td>
<td valign="top" align="center">1142</td>
<td valign="top" align="center">126220.06</td>
<td valign="top" align="center">6.87</td>
<td valign="top" align="center">43.19</td>
<td valign="top" align="center">104.84</td>
<td valign="top" align="center">0.113</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX11</td>
<td valign="top" align="center">TraesCS3B02G021600.2</td>
<td valign="top" align="center">3B</td>
<td valign="top" align="center">9165564</td>
<td valign="top" align="center">9177438</td>
<td valign="top" align="center">1191</td>
<td valign="top" align="center">131426.28</td>
<td valign="top" align="center">8.52</td>
<td valign="top" align="center">45.66</td>
<td valign="top" align="center">103.16</td>
<td valign="top" align="center">0.085</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX12</td>
<td valign="top" align="center">TraesCS3D02G022900.1</td>
<td valign="top" align="center">3D</td>
<td valign="top" align="center">7256680</td>
<td valign="top" align="center">7268617</td>
<td valign="top" align="center">1137</td>
<td valign="top" align="center">125621.34</td>
<td valign="top" align="center">6.87</td>
<td valign="top" align="center">43.91</td>
<td valign="top" align="center">104.71</td>
<td valign="top" align="center">0.107</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX13</td>
<td valign="top" align="center">TraesCS4A02G145300.1</td>
<td valign="top" align="center">4A</td>
<td valign="top" align="center">246708879</td>
<td valign="top" align="center">246714419</td>
<td valign="top" align="center">540</td>
<td valign="top" align="center">59245.5</td>
<td valign="top" align="center">8.52</td>
<td valign="top" align="center">34.99</td>
<td valign="top" align="center">111.22</td>
<td valign="top" align="center">0.549</td>
<td valign="top" align="center">vacu:</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX14</td>
<td valign="top" align="center">TraesCS4B02G125700.1</td>
<td valign="top" align="center">4B</td>
<td valign="top" align="center">156526868</td>
<td valign="top" align="center">156534017</td>
<td valign="top" align="center">416</td>
<td valign="top" align="center">45825.48</td>
<td valign="top" align="center">8.72</td>
<td valign="top" align="center">38.44</td>
<td valign="top" align="center">109.69</td>
<td valign="top" align="center">0.438</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX15</td>
<td valign="top" align="center">TraesCS4D02G147600.1</td>
<td valign="top" align="center">4D</td>
<td valign="top" align="center">139042047</td>
<td valign="top" align="center">139047298</td>
<td valign="top" align="center">477</td>
<td valign="top" align="center">52617.06</td>
<td valign="top" align="center">8.53</td>
<td valign="top" align="center">30.19</td>
<td valign="top" align="center">119.39</td>
<td valign="top" align="center">0.692</td>
<td valign="top" align="center">vacu /Plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX16</td>
<td valign="top" align="center">TraesCS5A02G176100.1</td>
<td valign="top" align="center">5A</td>
<td valign="top" align="center">370239620</td>
<td valign="top" align="center">370247353</td>
<td valign="top" align="center">374</td>
<td valign="top" align="center">40846.21</td>
<td valign="top" align="center">5.06</td>
<td valign="top" align="center">47.58</td>
<td valign="top" align="center">115.75</td>
<td valign="top" align="center">0.866</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX17</td>
<td valign="top" align="center">TraesCS5A02G260700.1</td>
<td valign="top" align="center">5A</td>
<td valign="top" align="center">474579384</td>
<td valign="top" align="center">474586850</td>
<td valign="top" align="center">532</td>
<td valign="top" align="center">58648.64</td>
<td valign="top" align="center">5.12</td>
<td valign="top" align="center">45.41</td>
<td valign="top" align="center">103.42</td>
<td valign="top" align="center">0.409</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX18</td>
<td valign="top" align="center">TraesCS5B02G173800.2</td>
<td valign="top" align="center">5B</td>
<td valign="top" align="center">318992910</td>
<td valign="top" align="center">319002092</td>
<td valign="top" align="center">374</td>
<td valign="top" align="center">40862.21</td>
<td valign="top" align="center">5.06</td>
<td valign="top" align="center">48.09</td>
<td valign="top" align="center">115.48</td>
<td valign="top" align="center">0.859</td>
<td valign="top" align="center">plas/vac</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX19</td>
<td valign="top" align="center">TraesCS5B02G259100.1</td>
<td valign="top" align="center">5B</td>
<td valign="top" align="center">441532328</td>
<td valign="top" align="center">441539514</td>
<td valign="top" align="center">522</td>
<td valign="top" align="center">57654.52</td>
<td valign="top" align="center">5.1</td>
<td valign="top" align="center">45.1</td>
<td valign="top" align="center">104.1</td>
<td valign="top" align="center">0.443</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX20</td>
<td valign="top" align="center">TraesCS5D02G180800.1</td>
<td valign="top" align="center">5D</td>
<td valign="top" align="center">281021983</td>
<td valign="top" align="center">281031600</td>
<td valign="top" align="center">534</td>
<td valign="top" align="center">58431.65</td>
<td valign="top" align="center">5.03</td>
<td valign="top" align="center">47.01</td>
<td valign="top" align="center">102.45</td>
<td valign="top" align="center">0.46</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX21</td>
<td valign="top" align="center">TraesCS5D02G268200.1</td>
<td valign="top" align="center">5D</td>
<td valign="top" align="center">371663980</td>
<td valign="top" align="center">371671626</td>
<td valign="top" align="center">532</td>
<td valign="top" align="center">58789.86</td>
<td valign="top" align="center">5.2</td>
<td valign="top" align="center">44.96</td>
<td valign="top" align="center">103.97</td>
<td valign="top" align="center">0.406</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX22</td>
<td valign="top" align="center">TraesCS7A02G228400.1</td>
<td valign="top" align="center">7A</td>
<td valign="top" align="center">198804283</td>
<td valign="top" align="center">198808214</td>
<td valign="top" align="center">527</td>
<td valign="top" align="center">58011</td>
<td valign="top" align="center">8.61</td>
<td valign="top" align="center">33.71</td>
<td valign="top" align="center">108.39</td>
<td valign="top" align="center">0.61</td>
<td valign="top" align="center">vacu</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX23</td>
<td valign="top" align="center">TraesCS7A02G242300.1</td>
<td valign="top" align="center">7A</td>
<td valign="top" align="center">217580011</td>
<td valign="top" align="center">217587424</td>
<td valign="top" align="center">542</td>
<td valign="top" align="center">59354.31</td>
<td valign="top" align="center">5.29</td>
<td valign="top" align="center">48.14</td>
<td valign="top" align="center">103.3</td>
<td valign="top" align="center">0.347</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX24</td>
<td valign="top" align="center">TraesCS7A02G397700.2</td>
<td valign="top" align="center">7A</td>
<td valign="top" align="center">576440908</td>
<td valign="top" align="center">576454559</td>
<td valign="top" align="center">998</td>
<td valign="top" align="center">109881.16</td>
<td valign="top" align="center">5.77</td>
<td valign="top" align="center">34.71</td>
<td valign="top" align="center">105.64</td>
<td valign="top" align="center">0.207</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX25</td>
<td valign="top" align="center">TraesCS7A02G462000.1</td>
<td valign="top" align="center">7A</td>
<td valign="top" align="center">658637042</td>
<td valign="top" align="center">658651135</td>
<td valign="top" align="center">991</td>
<td valign="top" align="center">109173.5</td>
<td valign="top" align="center">5.9</td>
<td valign="top" align="center">36.22</td>
<td valign="top" align="center">107.37</td>
<td valign="top" align="center">0.219</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX26</td>
<td valign="top" align="center">TraesCS7B02G149100.2</td>
<td valign="top" align="center">7B</td>
<td valign="top" align="center">196868440</td>
<td valign="top" align="center">196874596</td>
<td valign="top" align="center">537</td>
<td valign="top" align="center">58832.88</td>
<td valign="top" align="center">5.37</td>
<td valign="top" align="center">46.55</td>
<td valign="top" align="center">105.53</td>
<td valign="top" align="center">0.429</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX27</td>
<td valign="top" align="center">TraesCS7B02G191300.1</td>
<td valign="top" align="center">7B</td>
<td valign="top" align="center">329030544</td>
<td valign="top" align="center">329034430</td>
<td valign="top" align="center">527</td>
<td valign="top" align="center">58145.11</td>
<td valign="top" align="center">8.76</td>
<td valign="top" align="center">34.19</td>
<td valign="top" align="center">106.36</td>
<td valign="top" align="center">0.572</td>
<td valign="top" align="center">vacu</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX28</td>
<td valign="top" align="center">TraesCS7B02G475500.1</td>
<td valign="top" align="center">7B</td>
<td valign="top" align="center">731431027</td>
<td valign="top" align="center">731444592</td>
<td valign="top" align="center">1141</td>
<td valign="top" align="center">126185.71</td>
<td valign="top" align="center">6.25</td>
<td valign="top" align="center">42.41</td>
<td valign="top" align="center">101.52</td>
<td valign="top" align="center">0.082</td>
<td valign="top" align="center">plas</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX29</td>
<td valign="top" align="center">TraesCS7D02G226200.1</td>
<td valign="top" align="center">7D</td>
<td valign="top" align="center">186316884</td>
<td valign="top" align="center">186320911</td>
<td valign="top" align="center">527</td>
<td valign="top" align="center">58058.03</td>
<td valign="top" align="center">8.61</td>
<td valign="top" align="center">33.95</td>
<td valign="top" align="center">107.1</td>
<td valign="top" align="center">0.593</td>
<td valign="top" align="center">vacu</td>
</tr>
<tr>
<td valign="top" align="center">TaNHX30</td>
<td valign="top" align="center">TraesCS7D02G241200.1</td>
<td valign="top" align="center">7D</td>
<td valign="top" align="center">205547583</td>
<td valign="top" align="center">205554255</td>
<td valign="top" align="center">543</td>
<td valign="top" align="center">59569.54</td>
<td valign="top" align="center">5.31</td>
<td valign="top" align="center">49.17</td>
<td valign="top" align="center">104.18</td>
<td valign="top" align="center">0.352</td>
<td valign="top" align="center">plas</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>To analyze the evolutionary lineages of the <italic>NHX</italic> gene family across different species, a dataset comprising 63 NHX protein sequences was utilized. The sequences were obtained from five species, namely <italic>A. thaliana, H. vulgare, G. hirsutum, S. bicolor</italic>, and <italic>T. aestivum</italic> (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>). These sequences were employed to construct a phylogenetic tree, as depicted in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. The analysis involved the utilization of previously reported genes, resulting in the classification of the 63 genes into three distinct categories: class I (endo-class), class II (PM-class), and class III (vac-class). Among the five species, the largest group was class III (vac-class), which encompassed 39 proteins. Specifically, this group comprised 4 NHX proteins in <italic>A. thaliana</italic>, 2 in <italic>H. vulgare</italic>, 15 in <italic>G. hirsutum</italic>, 6 in <italic>S. bicolor</italic>, and 12 in <italic>T. aestivum</italic>. It is worth noting that 9 TaNHX proteins were distributed evenly between classes I (endo-class) and II (PM-class), as shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Phylogenetic trees showing relationships of <italic>NHX</italic> genes family of <italic>T. aestivum, A. thaliana, S. bicolor, H. vulgare, and G. hirusitum</italic>. The trees were constructed using the maximum likelihood method and a bootstrap replicate of 1000. The trees with the highest bootstrap support for each gene class have been shown here. The three major classes (Vac-, Endo-, and PM-) are marked with different colors.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g001.tif"/>
</fig>
<p>GO enrichment analysis was conducted to uncover the potential functions of the <italic>NHX</italic> genes. Among the twenty <italic>TaNHX</italic> genes, significant enrichment was observed in biological processes (BP), molecular functions (MF), and cellular components (CC). In BP, the enriched terms included &#x201c;sodium ion transmembrane transport,&#x201d; &#x201c;response to salt stress,&#x201d; &#x201c;potassium ion homeostasis,&#x201d; and &#x201c;regulation of pH,&#x201d; among others (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S3</bold>
</xref>). The enriched MF terms encompassed &#x201c;binding,&#x201d; &#x201c;antiporter activity,&#x201d; and &#x201c;potassium: proton antiporter activity.&#x201d; Furthermore, the enriched CC terms were associated with &#x201c;plasma membrane&#x201d; and &#x201c;vacuolar membrane.&#x201d; Notably, individual <italic>TaNHX</italic> genes exhibited enrichment in specific GO terms, indicating their involvement in distinct processes. For comprehensive information on the enriched GO terms and their functions see <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S3</bold>
</xref>.</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Analysis of conserved motifs, gene structure, cis-regulatory elements, and physical mapping</title>
<p>The MEME web-server with default settings was employed to predict conserved motifs, shedding light on the evolutionary preservation of specific functional amino acids within the NHX protein family. Based on the protein sequences of all NHXs, we discovered a total of 10 potential motifs (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). The length of the TaNHXs&#x2019; anticipated motifs ranged from 6 to 50 amino acids. Members of the same subfamily shared a similar motif arrangement. Logos of the motifs were presented in <xref ref-type="supplementary-material" rid="SF7">
<bold>Supplementary Figure S1</bold>
</xref>. The descriptive details of domains were given in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S4</bold>
</xref>.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>
<bold>(A)</bold> Distribution of conserved motifs identified in proteins encoded by TaNHX. <bold>(B)</bold> Gene structures showing the organization of exons and introns, <italic>TaNHX</italic> genes.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g002.tif"/>
</fig>
<p>Using Gene Structure Display Server v.2.0, the intron/exon architecture of the genes was examined to determine the structural properties of the wheat <italic>TaNHX</italic>s. The number of introns and exons differed significantly depending on the intron/exon patterns studied, which further explains the diversity in gene length. Non-coding sequences are frequently found in the genome, which is thought to be a sign of genomic complexity. Thus, examining these intron configurations reveals important details about the development, regulation and functionality of the NHXs. The examination of the wheat <italic>TaNHX</italic> gene architectures revealed significant variations across the three classes in terms of the number of introns and exons. The bulk of the Vac-class family among the 30 wheat <italic>TaNHX</italic>s included UTR (untranslated region) sequences at both the 5&#x2019; and 3&#x2019; ends. However, 6 out of the 12 Vac-class <italic>TaNHX</italic>s had 14 exons, 3 had more than 20 exons, and the rest were less than 10. The endo-class <italic>TaNHX</italic> had more than 10 exons except <italic>TaNHX26</italic> (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). However, the PM-class <italic>TaNHX</italic> (<italic>TaNHX9</italic> and <italic>TaNHX10</italic>) had the highest share of intron-exons, with 27, 37 exons and 14, 20 introns, respectively. It was found that the distribution of introns and exons in the genes belonging to the same clade was very comparable. The exon lengths and intron regions of genes in the same class were mostly conserved. The analysis of amino acid sequence identity further confirmed the wheat TaNHXs&#x2019; sequence conservation (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>).</p>
<p>In order to better understand transcriptional control and gene expression, the promoter sequences of wheat <italic>TaNHX</italic> were identified by PlantCARE software (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). The major focus of the analysis was on <italic>cis</italic>-acting components associated with stress and hormones. Twenty two of the <italic>cis</italic>-acting components that were discovered had a hormonal connection, including ABA, salicylic acid (SA), gibberellin (GA), and jasmonate. The <italic>TaNHX</italic> comprised of phytohormones were <italic>TaNHX1, TaNHX3, TaNHX5, TaNHX7, TaNHX12, TaNHX13, TaNHX19, TaNHX22, TaNHX23</italic>, and <italic>TaNHX29</italic> (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). Eleven <italic>cis</italic>-acting components, including anaerobic environments and low temperatures, were responsible for stress. The number of light-responsive elements was higher among these components. These cis-acting elements&#x2019; findings imply that <italic>TaNHX</italic>s may be crucial for the control of hormones and the response to stress in wheat.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Predicted <italic>cis</italic>-elements in TaNHX promoters. The upstream length to the translation starting site can be inferred according to the scale at the bottom. The green, yellow, pink, red, orange and violet-colored boxes stand for DSR, SA, MeJA, Me, ABRE and MYB cis-elements, respectively.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g003.tif"/>
</fig>
<p>To better comprehend how the <italic>TaNHX</italic> gene family evolved, we further examined the gene duplication occurrences. Thirty <italic>TaNHX</italic> genes were unevenly mapped onto six (A, B, D) chromosomes of the 21 <italic>T. aestivum</italic> chromosomes (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). Two chromosomes (Chr2 and Chr5) contained six <italic>TaNHX</italic> genes and three chromosomes (Chr1, Chr3, and Chr4) contained only one <italic>TaNHX</italic> gene on each A, B, and D sub-genome (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). No genes were present on chromosome 6. Gene duplication events, which are a primary mechanism of gene family growth, gave chances for the synthesis of additional genes and their functional divergence.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>The distribution of NHX genes on chromosomes of <italic>T. aestivum</italic>. Chromosome numbers have been indicated on the top of each chromosome. The position of each gene on the respective chromosome has been depicted in terms of mega base-pairs by numbers beside each gene.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g004.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Protein-protein interaction, miRNA targeting, and duplication events in NHX genes</title>
<p>The response to salt stress is one of the major biological processes in which NHXs play a significant role. The PPI network was created by the STRING database to further examine the potential role of TaNHXs during potential interactions with other proteins (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). TaNHX proteins are not expected to have any direct interactions with one another. Out of thirty TaNHX proteins, six were participating in the protein-protein interaction network. They shared a similar kind of putative interactive protein. TaNHX1, TaNHX2, TaNHX7, and TaNHX20 were involved in proton exchange and belong to monovalent and proton antiporters (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). Numerous physiological processes, including vesicle trafficking, pH control, K<sup>+</sup> homeostasis, protein transport, and growth and development, are regulated by the antiporters. In contrast, TaNHX6 interacted with SOS1, which is crucial for the expulsion of Na<sup>+</sup> ions from cells.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Interaction network among NHX protein in wheat.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g005.tif"/>
</fig>
<p>This study employed network analysis, using <italic>TaNHX</italic> gene expression data, to uncover key insights into sodium ion transport mechanisms in plants. Significant Gene Ontology (GO) terms (FDR &lt; 0.001) were identified, revealing <italic>TaNHX</italic> genes&#x2019; involvement in cellular processes, particularly transmembrane transport. Intriguingly, our analysis revealed intricate interactions between sodium ion transport and the regulation of biological quality, chemical homeostasis, and metal ion homeostasis (<xref ref-type="supplementary-material" rid="SF8">
<bold>Supplementary Figure S2</bold>
</xref>). Subcellular localization indicated that <italic>TaNHX</italic> proteins primarily reside in plasma membranes, endosomes, and vacuoles, emphasizing their role in Na<sup>+</sup>/-H antiporter activity and ion homeostasis. The findings also imply potential gene interactions affecting activity levels, paving the way for further investigations into these regulatory networks in plant sodium ion transport (<xref ref-type="supplementary-material" rid="SF8">
<bold>Supplementary Figure S2</bold>
</xref>). This research contributes valuable insights to plant biology and ion homeostasis regulation.</p>
<p>The psRNATarget service has been used to look at how miRNAs regulate the expression of <italic>TaNHX</italic> genes. For twenty distinct miRNAs, we identified 32 <italic>TaNHX</italic> genes as potential targets (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Tae-miR395 is implicated in the regulation of eight <italic>TaNHX</italic> genes (<italic>TaNHX6, TaNHX9, TaNHX10, TaNHX11, TaNHX12, TaNHX24, TaNHX25</italic>, and <italic>TaNHX28</italic>). Tae-miR9666 accounted for regulating the expression of four <italic>TaNHX</italic> genes (T<italic>aNHX6, TaNHX9, TaNHX24</italic>, and <italic>TaNHX25</italic>). The expression of <italic>TaNHX</italic> genes (<italic>TaNHX1, TaNHX3</italic>, and <italic>TaNHX29</italic>) may be influenced by Tae-miR9656 (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Tae-miR9772, Tae-miR9773, and Tae-miR9774 were predicted to regulate the expression of <italic>TaNHX22</italic>, <italic>TaNHX13</italic>, and <italic>TaNHX9</italic>, respectively.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Prediction of Tae-MIR genes and their targets by using the psRNATarget server with default parameters.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">miRNA_Acc.</th>
<th valign="top" align="center">Target_Acc.</th>
<th valign="top" align="center">Target_start</th>
<th valign="top" align="center">Target_end</th>
<th valign="top" align="center">miRNA_aligned_fragment</th>
<th valign="top" align="center">Target_aligned_fragment</th>
<th valign="top" align="center">Inhibition</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="2" align="left">tae-miR9773</td>
<td valign="top" align="left">TaNHX13</td>
<td valign="top" align="left">2688</td>
<td valign="top" align="left">2710</td>
<td valign="top" align="left">UUUGUUUUUAUGUUAUUUUGUGA</td>
<td valign="top" align="left">AAACCAGAAACCAUAAAAACAAA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX13</td>
<td valign="top" align="left">2334</td>
<td valign="top" align="left">2356</td>
<td valign="top" align="left">UUUGUUUUUAUGUUAUUUUGUGA</td>
<td valign="top" align="left">UUUGAAAAUGACGUAAUAAUAAU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" rowspan="12" align="left">tae-miR395a</td>
<td valign="top" align="left">TaNHX24</td>
<td valign="top" align="left">1731</td>
<td valign="top" align="left">1751</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCAC</td>
<td valign="top" align="left">Translation</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX25</td>
<td valign="top" align="left">1674</td>
<td valign="top" align="left">1694</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCAC</td>
<td valign="top" align="left">Translation</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX9</td>
<td valign="top" align="left">1731</td>
<td valign="top" align="left">1751</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCAC</td>
<td valign="top" align="left">Translation</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX6</td>
<td valign="top" align="left">1731</td>
<td valign="top" align="left">1751</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCAC</td>
<td valign="top" align="left">Translation</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX24</td>
<td valign="top" align="left">549</td>
<td valign="top" align="left">569</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCAC</td>
<td valign="top" align="left">Translation</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX11</td>
<td valign="top" align="left">2244</td>
<td valign="top" align="left">2264</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCGU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX11</td>
<td valign="top" align="left">2226</td>
<td valign="top" align="left">2246</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCGU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX10</td>
<td valign="top" align="left">2095</td>
<td valign="top" align="left">2115</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCGU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX10</td>
<td valign="top" align="left">1969</td>
<td valign="top" align="left">1989</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCGU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX12</td>
<td valign="top" align="left">2080</td>
<td valign="top" align="left">2100</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCGU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX12</td>
<td valign="top" align="left">2065</td>
<td valign="top" align="left">2085</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCGU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX28</td>
<td valign="top" align="left">2031</td>
<td valign="top" align="left">2051</td>
<td valign="top" align="left">GUGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCGU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" rowspan="3" align="left">tae-miR9656-3p</td>
<td valign="top" align="left">TaNHX1</td>
<td valign="top" align="left">1822</td>
<td valign="top" align="left">1842</td>
<td valign="top" align="left">CUUCGAGACUCUGAACAGCGG</td>
<td valign="top" align="left">ACGCUGUGUAGAGUUUUGGGA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX3</td>
<td valign="top" align="left">2166</td>
<td valign="top" align="left">2186</td>
<td valign="top" align="left">CUUCGAGACUCUGAACAGCGG</td>
<td valign="top" align="left">ACGCUGUGUAGAGUUUUGGGA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX29</td>
<td valign="top" align="left">1745</td>
<td valign="top" align="left">1765</td>
<td valign="top" align="left">UUUAUGAUCACUCUCGUUUUG</td>
<td valign="top" align="left">GGAGACCAGAGUGCUUAUAAU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" rowspan="12" align="left">tae-miR395b</td>
<td valign="top" align="left">TaNHX11</td>
<td valign="top" align="left">2244</td>
<td valign="top" align="left">2263</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX11</td>
<td valign="top" align="left">2226</td>
<td valign="top" align="left">2245</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX10</td>
<td valign="top" align="left">2095</td>
<td valign="top" align="left">2114</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX10</td>
<td valign="top" align="left">1969</td>
<td valign="top" align="left">1988</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX12</td>
<td valign="top" align="left">2080</td>
<td valign="top" align="left">2099</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX12</td>
<td valign="top" align="left">2065</td>
<td valign="top" align="left">2084</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX28</td>
<td valign="top" align="left">2031</td>
<td valign="top" align="left">2050</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">ACAUUCCCUCAGGUGCUUCG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX24</td>
<td valign="top" align="left">1731</td>
<td valign="top" align="left">1750</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX25</td>
<td valign="top" align="left">1674</td>
<td valign="top" align="left">1693</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX9</td>
<td valign="top" align="left">1731</td>
<td valign="top" align="left">1750</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX6</td>
<td valign="top" align="left">1731</td>
<td valign="top" align="left">1750</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX24</td>
<td valign="top" align="left">549</td>
<td valign="top" align="left">568</td>
<td valign="top" align="left">UGAAGUGUUUGGGGGAACUC</td>
<td valign="top" align="left">AAGUUUUAUCACAUACUUCA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" rowspan="3" align="left">tae-miR7757-5p</td>
<td valign="top" align="left">TaNHX30</td>
<td valign="top" align="left">881</td>
<td valign="top" align="left">902</td>
<td valign="top" align="left">AUAAAACCUUCAGCUAUCCAUC</td>
<td valign="top" align="left">ACAUGCUAGCUGAAGGCUUUGG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX26</td>
<td valign="top" align="left">800</td>
<td valign="top" align="left">821</td>
<td valign="top" align="left">AUAAAACCUUCAGCUAUCCAUC</td>
<td valign="top" align="left">ACAUGCUAGCUGAAGGCUUUGG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX26</td>
<td valign="top" align="left">422</td>
<td valign="top" align="left">443</td>
<td valign="top" align="left">AUAAAACCUUCAGCUAUCCAUC</td>
<td valign="top" align="left">ACAUGCUAGCUGAAGGCUUUGG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" rowspan="4" align="left">tae-miR9666b-3p</td>
<td valign="top" align="left">TaNHX24</td>
<td valign="top" align="left">1154</td>
<td valign="top" align="left">1176</td>
<td valign="top" align="left">CGGUUGGGCUGUAUGA-UGGCGA</td>
<td valign="top" align="left">GUGCUAGUGAUACAGCUCAACCU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX25</td>
<td valign="top" align="left">1175</td>
<td valign="top" align="left">1197</td>
<td valign="top" align="left">CGGUUGGGCUGUAUGA-UGGCGA</td>
<td valign="top" align="left">GUGCUAGUGAUACAGCUCAACCU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX9</td>
<td valign="top" align="left">1154</td>
<td valign="top" align="left">1176</td>
<td valign="top" align="left">CGGUUGGGCUGUAUGA-UGGCGA</td>
<td valign="top" align="left">GUGCUAGUGAUACAGCUCAACCU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">TaNHX6</td>
<td valign="top" align="left">1154</td>
<td valign="top" align="left">1176</td>
<td valign="top" align="left">CGGUUGGGCUGUAUGA-UGGCGA</td>
<td valign="top" align="left">AUGCUAGUGAUACAGCUCAACCU</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">tae-miR9772</td>
<td valign="top" align="left">TaNHX22</td>
<td valign="top" align="left">481</td>
<td valign="top" align="left">501</td>
<td valign="top" align="left">UGAGAUGAGAUUACCCCAUAC</td>
<td valign="top" align="left">GUAUUCGGUGUUUUCAUCUCG</td>
<td valign="top" align="left">Translation</td>
</tr>
<tr>
<td valign="top" align="left">tae-miR9773</td>
<td valign="top" align="left">TaNHX13</td>
<td valign="top" align="left">2299</td>
<td valign="top" align="left">2321</td>
<td valign="top" align="left">UUUGUUUUUAUGUUAUUUUGUGA</td>
<td valign="top" align="left">UCGGUAUAUACCAUAAAAACCAA</td>
<td valign="top" align="left">Cleavage</td>
</tr>
<tr>
<td valign="top" align="left">tae-miR9774</td>
<td valign="top" align="left">TaNHX9</td>
<td valign="top" align="left">1584</td>
<td valign="top" align="left">1605</td>
<td valign="top" align="left">CAAGAUAUUGGGUAUUUCUGUC</td>
<td valign="top" align="left">UCAAGCUACAGCCAAUAUUUUG</td>
<td valign="top" align="left">Cleavage</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Comparative analysis was utilized to evaluate the orthologous of <italic>TaNHX</italic> gene duplication in wheat and <italic>A. tauschii</italic>. We discovered 28 orthologous gene pairs among all the <italic>NHX</italic> genes from wheat and <italic>A. tauschii</italic>. Contrarily, there were 27 <italic>NHX</italic> orthologous gene pairs discovered between wheat and rice, 29 between wheat and <italic>T. dicoccoides</italic>, and 30 between wheat and Arabidopsis (<xref ref-type="supplementary-material" rid="ST4">
<bold>Supplementary Table S4</bold>
</xref>). Orthologous associations between several species can be found through the analysis of collinearity correlations. <italic>NHX</italic> gene pairings between the genomes of <italic>T. aestivum</italic> and <italic>A. thaliana</italic> were syntenized. The findings revealed that 12 <italic>T. aestivum NHX</italic> genes shared syntenic relationships with <italic>AtNHX</italic> genes (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>), indicating that these genes may have aided in the development of the <italic>TaNHX</italic> gene family.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Interspecies synteny of <italic>T. aestivum</italic>, <italic>A. thaliana</italic>, <italic>O. indica</italic>, and <italic>H. vulgare</italic> on the basis of orthologous genes. Gray lines in the background indicate the collinear blocks within <italic>T. aestivum</italic>, <italic>A. thaliana</italic>, <italic>O. sativa, and H. vulgare</italic> while the red lines highlight the syntenic <italic>NHX</italic> gene pairs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g006.tif"/>
</fig>
<p>We conducted an analysis of synonymous substitutions (K<sub>s</sub>) and non-synonymous substitutions (K<sub>a</sub>) values to investigate the selective pressures underlying the duplication events of <italic>TaNHX</italic> genes, considering all nucleotide sequences. Our findings unveiled intriguing patterns, notably identifying six gene pairs (<italic>TaNHX7/TaNHX5, TaNHX15/TaNHX14, TaNHX22/TaNHX27, TaNHX1/TaNHX3, TaNHX20/TaNHX18</italic>, and <italic>TaNHX26/TaNHX23</italic>) characterized by K<sub>a</sub>/K<sub>s</sub> ratios lower than 1. These results suggest that these gene pairs experienced purifying selection, indicative of their evolutionary conservation (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;5</bold>
</xref>). Our analysis detected nine distinct segmental duplication events occurring across various chromosomes, along with one notable tandem duplication event within the same chromosome. These findings underscore the pivotal role of segmental duplications in driving the expansion of <italic>TaNHX</italic> genes within the wheat genome. Furthermore, our observations suggest that certain <italic>TaNHX</italic> genes may have originated as a consequence of gene duplication events, shedding light on the evolutionary mechanisms responsible for the diversification of this gene family. But it may be due to selection pressure that the number of <italic>TaNHX</italic> genes was not expended in comparison to other transcription factors in wheat. Genes from three subfamilies (PM, endo and vac.) participated in the tandem and segmental duplication. We also investigated how frequently tandem duplications occur. This region contained 10 <italic>TaNHX</italic> gene pairs, all of which were closely linked. Notably, the sequence identities among these genes exceeded 80%, strongly suggesting their involvement in tandem duplication events. Given the profound impact of gene duplication on the emergence of novel functionalities and gene families, we conducted a comprehensive exploration of <italic>TaNHX</italic> gene duplication events within the wheat genome. The paralogous gene pairs were employed to construct a circos plot (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>), enabling us to visualize and elucidate the intricate patterns of duplication events and their implications.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>The synteny analysis of TaNHX family in <italic>T. aestivum</italic>. Different colors represent NHX family on A, B and D sub-genome red lines indicate duplicated <italic>TaNHX</italic> gene pairs on A sub-genome, green lines indicated on B sub-genome and blue represented D sub-genome. The chromosome number is indicated at the bottom of each chromosome.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g007.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Tissue-specific expression profiles of NHX genes</title>
<p>
<italic>TaNHX</italic> expression levels were analyzed in wheat roots and leaf tissues exposed to salt stress. The expression analysis was done using RNA-seq data (SRP304900) from NCBI. Under normal conditions, <italic>TaNHX1, TaNHX2, TaNHX3, TaNHX5, TaNHX10, TaNHX11</italic>, and <italic>TaNHX20</italic> were found to be upregulated in all tissues except in grain (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>). However, <italic>TaNHXs</italic> displayed differential gene expression levels among the tissue types in different genes. It was observed that 23 out of 30 <italic>TaNHX</italic> genes were expressed very highly in both tissues. Whereas, the genes e.g., <italic>TaNHX4, TaNHX17, TaNHX21, TaNHX22, TaNHX27, TaNHX28</italic>, and <italic>TaNHX29</italic> expression were downregulated in all tissues under salt stress conditions (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>). However, it was found that <italic>TaNHX3, TaNHX5, TaNHX7, TaNHX11, TaNHX16, TaNHX18</italic>, and <italic>TaNHX20</italic> expressed upregulation in all tissues under heat, drought, and cold (<xref ref-type="supplementary-material" rid="SF9">
<bold>Supplementary Figure S3</bold>
</xref>) stresses.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Normalized expression profiles of <italic>NHX</italic> genes of <italic>T. aestivum</italic> in various plant tissues under; <bold>(A)</bold> control and <bold>(B)</bold> salt stress conditions. CG represented the control wheat root samples, TG: 150mM NaCl treated wheat root, TMG: 5mM 3-Methylamide + 150mM NaCl treated wheat root, CY: control wheat leaves, TY: 150mM NaCl treated wheat leaves, TMY: 5mM 3-MA + 150mM NaCl treated leaves.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g008.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Validation of NHX genes using qRT- PCR under salinity stress</title>
<p>Using qRT-PCR analysis, we quantitatively evaluated the expression patterns of ten <italic>TaNHXs</italic> genes under control and salt-stress conditions to observe the potential functions that TaNHXs may play in wheat in responses to salinity stress. The findings demonstrated that salt tolerance (KRL213) and salt-sensitive (HD2009) wheat cultivars both stimulated all <italic>TaNHX</italic> genes in leaf and root tissues in a concentration-dependent manner (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9</bold>
</xref>). The tissues with the highest induction were the roots, followed by the leaves. <italic>TaNHX</italic> gene overexpression caused by salinity was greater in KRL213 than HD2009. Out of ten <italic>TaNHX</italic> genes, five genes [<italic>TaNHX2</italic> (~14 folds), <italic>TaNHX12</italic> (~9 folds), <italic>TaNHX16</italic> (~7 folds), <italic>TaNHX20</italic> (~10 folds), <italic>TaNHX23</italic> (~3 folds)] showed up-regulation, in the roots of KRL213 at 48 h under 150 mM NaCl stress condition (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). On the other hand, expression levels of <italic>TaNHX2, TaNHX16</italic>, and <italic>TaNHX20</italic> were expressed more than twofold in roots treated with 150 mM NaCl at different time intervals. It was observed that <italic>TaNHX2, TaNHX12</italic>, and <italic>TaNHX20</italic> expression levels were higher in the leaves of KRL213 (~10, ~5, and ~16 times, respectively) than HD2009 were down-regulated at 48 h of 150 mM NaCl treatment (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). Salinity stress clearly shows up-regulation of TaNHXs in the leaves of KRL213, whereas in HD2009 two genes <italic>TaNHX2</italic> and <italic>TaNHX20</italic>, were expressed higher in leaf tissue at 0 h and 3 h of stress. In KRL213 leaf tissue, all genes used for the validation were up-regulated at 3 h of salt stress (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). The gene expression profiles of individual <italic>TaNHX</italic> members were evaluated in both leaf and root tissues under salinity stress conditions, yielding results that consistently mirrored the salt tolerance characteristics of the two wheat genotypes under study.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>qRT-PCR expression analysis of selected genes in contrasting wheat varieties KRL213 and HD2009 for salt tolerance. <bold>(A)</bold> leaf tissues and, <bold>(B)</bold> root tissues under salt stress (150mM NaCl) at different time intervals. The names of the genes are shown in the x-axis, and y-axis represents the fold changes of expression of the genes. The data represents the mean &#xb1; standard deviation with n = 3. * Above the bars indicate significant correlation at the 0.05, as analyzed by Student&#x2019;s T-test.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g009.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>MD simulation analysis</title>
<p>The Root Mean Square Deviation (RMSD) serves a crucial statistic for assessing the average changes of a set of atoms concerning a reference frame. Analyzing the RMSD of the protein backbone atoms relative to their initial positions can yield valuable insights into the protein conformational dynamics. In our investigation, the RMSD values for all three proteins were below 2.5 nm. <xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10A</bold>
</xref> illustrates a stabilizing trend in the RMSD values around 10 ns mark, suggesting the attainment of equilibrium within the simulation. This stabilization milestone serves as an optimal foundation for subsequent analysis.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>MD simulations analysis of NHX Proteins. <bold>(A)</bold> Root mean square deviation, <bold>(B)</bold> Root mean square fluctuations <bold>(C)</bold> Radius of gyration during 30 ns simulations. Superimposition between pre- and post-MD structure shown with different colours for; <bold>(D)</bold> TaNHX1, <bold>(E)</bold> TaNHX2 and, <bold>(F)</bold> TaNHX3 proteins.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1266699-g010.tif"/>
</fig>
<p>Moreover, the Root Mean Square Fluctuation (RMSF) analysis delves into the localized fluctuations occurring along the protein chain during the molecular dynamics (MD) simulations RMSF graph uncovered fluctuations primarily at the C-terminals of the proteins, while the core of the TaNHX proteins displayed no substantial variations (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10B</bold>
</xref>). Additionally, the radius of gyration (Rg) value for the TaNHX structure exhibited a decreasing trend as the simulation time progressed, indicating a progressive compaction of the modeled structure. This observation aligns with the results from the initial run of the simulations. The radius of gyration is a measure of the overall size and compactness of a protein structure. A lower Rg value suggests a more tightly folded and compact conformation, while a higher Rg value indicates a more extended or flexible structure. Therefore, the lower Rg values obtained for the TaNHX protein structure suggest that they adopt a more compact and stable conformation (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10C</bold>
</xref>).</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Sodium-proton (Na<sup>+</sup>/H<sup>+</sup>) antiporters, which are encoded by genes belonging to the NHX family, play a pivotal role in upholding ion equilibrium and aiding in membrane trafficking. Their significance is particularly pronounced in plant cells exposed to the challenges of salinity stress, as elucidated by <xref ref-type="bibr" rid="B29">Pehlivan et&#xa0;al. (2016)</xref>. The <italic>NHX</italic> gene families have undergone comprehensive identification and functional characterization in various plant species such as Arabidopsis, rice, wheat, sugar beet, and cotton (<xref ref-type="bibr" rid="B25">Manik et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B40">Wilkins et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B20">Kumari et&#xa0;al., 2018</xref>; and <xref ref-type="bibr" rid="B43">Wu et&#xa0;al., 2019</xref>). A comprehensive genome-wide investigation of <italic>TaNHX</italic> genes in <italic>T. aestivum</italic> has not been conducted yet. Our study aimed to fill this gap by identifying <italic>TaNHX</italic> genes in the wheat genome and conducting a thorough characterization, including phylogenetic relationships, their characterization, and expression profiling under varying salinity stress conditions, along with molecular dynamic simulation.</p>
<p>Our analysis revealed that <italic>TaNHX</italic> members in wheat could be classified into three groups based on multiple sequence alignments and sub-cellular localization. For instance, <italic>TaNHX7</italic> and <italic>TaNHX8</italic> were found to be localized in the plasma membrane, <italic>TaNHX5</italic> and <italic>TaNHX6</italic> in the endo-membrane, while the remaining members were localized in the vacuole. This localization pattern was comparable with the prior studies in Arabidopsis (<xref ref-type="bibr" rid="B31">Ramesh et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B27">Parveen et&#xa0;al., 2021</xref>). Notably, the similarity observed in NHX families across lower to higher plant taxa suggests the retention of functional importance throughout evolutionary processes (<xref ref-type="bibr" rid="B34">Shuai et&#xa0;al., 2013</xref>). Sub-cellular localization of NHX transporters significantly influences their functionality. NHX family members situated on both the plasma membrane and tonoplast play an integral role in maintaining ionic equilibrium by sequestering and eliminating excessive sodium ions (Na<sup>+</sup>).</p>
<p>In our analysis, we identified ten conserved motifs in TaNHXs. Notably, a key element of profound importance is the remarkably conserved membrane-spanning pore and cation-binding domain, exemplified by the nonapeptide sequence &#x201c;FFIYLLPPI,&#x201d; renowned as the amiloride-binding site. This distinctive characteristic defines the membrane-bound NHX transporters in plants (<xref ref-type="bibr" rid="B42">Wu et&#xa0;al., 2011</xref>). This site is well-known for its role in inhibiting cation/H<sup>+</sup> exchange when amiloride is present. Interestingly, we found that this region is conserved in the second motif of all TaNHX peptides, indicating that TaNHXs, as a whole, exhibit functional and sequence-based similarities, with the exception of <italic>TaNHX14</italic> (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). Similar sequence characteristics have been observed in Arabidopsis (<xref ref-type="bibr" rid="B2">Aharon et&#xa0;al., 2003</xref>), soybean (<xref ref-type="bibr" rid="B7">Chen et&#xa0;al., 2015</xref>), and tea (<xref ref-type="bibr" rid="B28">Paul et&#xa0;al., 2021</xref>). These findings contribute to our understanding of the conserved motifs and functional characteristics of TaNHX proteins in wheat and highlight the evolutionary relationships among TaNHXs based on their gene structures.</p>
<p>
<italic>cis</italic>-acting elements, serving as genetic switches for gene transcription, exert significant control over biological processes, encompassing responses to hormonal fluctuations, environmental stress, and developmental stresses (<xref ref-type="bibr" rid="B32">Ren et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B47">Zhang et&#xa0;al., 2020</xref>). Phytohormones such as gibberellins, methyl jasmonic acid, and abscisic acid wield immense influence over growth, development, and stress responses (<xref ref-type="bibr" rid="B48">Zhao et&#xa0;al., 2021</xref>). It is conceivable that TaNHXs actively participate in hormone signaling throughout wheat&#x2019;s developmental stages and stress responses. This conjecture finds support in the presence of ABREs (abscisic acid responsive elements) and MeJA (methyl jasmonate) responsive elements within the promoter regions of these genes (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Our findings are in tune with those in <italic>P. trichocarpa</italic> (<xref ref-type="bibr" rid="B34">Shuai et&#xa0;al., 2013</xref>) and <italic>S. bicolor</italic> (<xref ref-type="bibr" rid="B20">Kumari et&#xa0;al., 2018</xref>), which unveiled stress-responsive elements in <italic>NHX</italic> gene promoters. Furthermore, the promoter regions of <italic>TaNHX</italic>s harbor elements associated with light responsiveness and low-temperature sensitivity, suggesting their potential involvement in pivotal regulatory processes encompassing phytohormonal dynamics, stress responses, cellular development, and metabolism. By identifying these <italic>cis</italic>-acting elements and their association with TaNHXs in wheat, our study sheds light on their potential role in the regulation of <italic>TaNHX</italic> gene expression and their involvement in crucial physiological processes. These findings deepen our understanding of the intricate signaling networks that coordinate hormone responses, stress adaptation, and overall plant development in wheat.</p>
<p>The association of TaNHXs with other proteins, such as SOS2, contributes to the production of a protein kinase that plays a vital role in alleviating salt stress in Arabidopsis (<xref ref-type="bibr" rid="B40">Wilkins et&#xa0;al., 2016</xref>). Another protein, SOS3, acts as a calcium ion sensor and facilitates the transportation of SOS2 and SOS1, leading to the efflux of sodium ions from the cells (<xref ref-type="bibr" rid="B33">Shi et&#xa0;al., 2000</xref>). The analysis of protein-protein interactions (PPI) revealed a predicted interaction between PM-bounded TaNHX6 and SOS1. TaNHX6, known to possess several hormone- and stress-related <italic>cis</italic>-acting elements, plays a pivotal role in facilitating the exclusion of Na<sup>+</sup> ions from the cell. Similar results have been observed by <xref ref-type="bibr" rid="B25">Manik et&#xa0;al. (2015)</xref> in honeysuckle. However, it is important to note that the regulation of salt tolerance involves a complex and interconnected network of interactions (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). Among the key players in this network are the membrane-bound pyrophosphatases, namely H<sup>+</sup>-PPase and H<sup>+</sup>-ATPase related proteins. These proton transporters, dependent on potassium, are crucial for plant responses to stress as well as growth and development. A balanced Na<sup>+</sup>/K<sup>+</sup> ratio is essential for various vital functions, including proper stomatal function, protein synthesis, cell osmoregulation, photosynthesis, and turgor maintenance (<xref ref-type="bibr" rid="B27">Parveen et&#xa0;al., 2021</xref>). Given the importance of TaNHXs and potassium transport-related proteins in maintaining this balance, it is justified to include them in protein interaction networks in current research endeavors.</p>
<p>miRNAs have been previously reported as having abiotic stress-responsiveness (<xref ref-type="bibr" rid="B31">Ramesh et&#xa0;al., 2019</xref>), indicating their potential involvement in regulating stress-related processes. Specific miRNA families have known roles in different aspects of plant development and response to abiotic stresses (<xref ref-type="bibr" rid="B34">Shuai et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B14">Gupta et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B24">Luan et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B46">Zhang and Chen, 2021</xref>; <xref ref-type="bibr" rid="B22">Liu et&#xa0;al., 2022</xref>). We identified a total of 20 different miRNAs targeting 26 distinct <italic>TaNHX</italic> genes (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Differential expression patterns of <italic>TaNHX</italic> genes observed in our study can be linked to the stress-responsive miRNAs that target these genes, further emphasizing their role in stress adaptation and plant development.</p>
<p>The analysis of 30 salt-responsive genes in <italic>T. aestivum</italic> revealed interesting insights. Collinearity analysis indicated that 18 <italic>TaNHX</italic> genes resulted from whole-genome duplication or segmental duplication, a pattern observed in various gene families, including cotton MADS-Box, GT47, and soybean WRKY, highlighting the role of gene duplication in their evolution (<xref ref-type="bibr" rid="B6">Cannon et&#xa0;al., 2004</xref>; <xref ref-type="bibr" rid="B44">Yin et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B32">Ren et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B43">Wu et&#xa0;al., 2019</xref>). Additionally, the collinearity analysis of NHXs revealed shared ancestry among the A, B, and D genomes of NHXs, signifying their common origin. These findings shed light on the NHX family&#x2019;s evolution in wheat, primarily driven by WGD or segmental duplication events. This deepens our understanding of gene duplication mechanisms, genetic information exchange between species, and the processes shaping species evolution. Furthermore, the evaluation of non-synonymous (K<sub>a</sub>) and synonymous (K<sub>s</sub>) substitution rates among duplicated gene pairs stands as a pivotal tool for assessing selection pressure and approximating the timing of duplications. In the context of <italic>TaNHX</italic> genes in wheat, these findings robustly suggest&#xa0;that purifying selection mechanisms played a prominent role in generating genes with conserved functions and, in some&#xa0;cases, undergoing pseudogenization (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table&#xa0;S4</bold>
</xref>). Regarding the anticipated motifs within NHX proteins,&#xa0;it has become evident that genes within the duplicated gene cluster showcase functional conservation, while a few motifs&#xa0;lack discernible functional details, potentially indicating pseudogenization. This intriguing observation underscores the possibility of pseudogenization events, as indicated in (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S4</bold>
</xref>). This phenomenon can be attributed to one or more ancestral polyploidy events that transpired in numerous angiosperm plant lineages. Consequently, these gene duplications within the wheat genome have been instrumental in the emergence of evolutionary innovations. Furthermore, a thorough examination of syntenic blocks among NHX genes across wheat and several other plant species has unveiled that the closest orthologs of the wheat channels trace their origins to barley. These extensive synteny relationships at the gene level serve as compelling evidence affirming the close evolutionary affiliations between these species (<xref ref-type="bibr" rid="B38">Ullah et&#xa0;al., 2022</xref>). Variations in these evolutionary relationships can provide valuable insights into the substantial rearrangement events that have left their imprint on the genomes of wheat and its related species throughout the course of evolution.</p>
<p>Considering the association of <italic>TaNHX</italic> genes with stress-responsive <italic>cis</italic>-acting elements and miRNAs, we hypothesized that their expression patterns would exhibit variations. In our study, we observed up-regulation of <italic>TaNHX</italic> genes in both leaf and root tissues of the cultivars under salinity stress, irrespective of the severity of salt exposure and the cultivars&#x2019; salt tolerance capacity (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Remarkably, the roots, being the first organs exposed to salt, displayed significantly higher induction of <italic>TaNHX</italic> genes. Although the induction of TaNHXs in leaves was relatively lower compared to roots, it still contributed to the exclusion and improved compartmentalization of Na<sup>+</sup> ions within the cells. This heightened expression of sodium transporters directly facilitated the maintenance of Na<sup>+</sup> ion homeostasis. Additionally, we observed a gradual increase in gene expression within 3h of salt treatment in leaf tissue. Similar expression patterns were observed in cotton roots, where gene expression reached its peak at 3h, gradually declined, and then increased again at 48h (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>). These findings align with previous studies on <italic>BvNHX</italic> genes in sugar beet (<xref ref-type="bibr" rid="B43">Wu et&#xa0;al., 2019</xref>). Similarly, the wheat gene <italic>TaNHX3</italic> exhibited increased expression within 24h in both roots and leaves, followed by a gradual decrease within 48h. Consistent with previous studies on wheat transgene TaNHX, our findings highlighted the responsiveness of <italic>TaNHX2, TaNHX12</italic>, and <italic>TaNHX20</italic> to salinity stress. <xref ref-type="bibr" rid="B45">Yue et&#xa0;al. (2021)</xref> found that the addition of 3-methyladenine (3-MA) inhibits autophagy, increases ROS accumulation and impairs the tolerance of wheat seedlings to NaCl stress. Differential expression patterns of NHXs under salinity stress have also been reported in other plant species, such as <italic>Beta vulgaris</italic> with five <italic>NHX</italic>s (<xref ref-type="bibr" rid="B43">Wu et&#xa0;al., 2019</xref>), <italic>Populus trichocarpa</italic> with eight <italic>NHXs</italic> (<xref ref-type="bibr" rid="B37">Tian et&#xa0;al., 2017</xref>), and <italic>Sorghum bicolor</italic> with six <italic>NHXs</italic> (<xref ref-type="bibr" rid="B20">Kumari et&#xa0;al., 2018</xref>). Hierarchical clustering analysis (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>) revealed two distinct clusters based on the activities of TaNHXs in all tissues under saline conditions in both cultivars. This clustering suggests different regulatory mechanisms or functional roles of TaNHXs in response to salinity stress.</p>
<p>To gain further insights into the TaNHX proteins, we employed molecular modeling and MD simulations to analyze their three-dimensional structure, stability, and conformational changes. The MD simulations clearly confirmed the stability of the three predicted TaNHX proteins over the entire simulation period. These findings collectively offer valuable insights into the expression patterns of <italic>TaNHX</italic> genes under salinity stress and their potential role in maintaining Na<sup>+</sup> ion homeostasis. By elucidating the distinctive expression patterns and robust stability of TaNHX proteins, our study contributes significantly to the comprehension of the molecular mechanisms that underlie salt tolerance in wheat.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusions</title>
<p>A comprehensive analysis of the <italic>TaNHX</italic> gene family in wheat was carried out in the present study. A total of 30 <italic>TaNHX</italic>s had been identified and phylogenetically divided into three subfamilies, as supported through highly conserved gene structure and motifs in addition to regulatory elements, revealing their significant role in wheat tolerance under salt stress. These thirty <italic>TaNHX</italic> genes were unevenly distributed among 18 chromosomes in wheat, except chromosomes 6A, 6B, and 6D, wherein no genes have been present. Collinearity analysis results confirmed that segmental duplication events had been essential for the expansion of <italic>TaNHX</italic> genes in the wheat genome and that certain <italic>TaNHX</italic> genes might also had been formed through gene duplication. Through qRT-PCR analysis, we observed that certain <italic>TaNHX</italic> genes in wheat showed increased expression under salt stress, with varying expression patterns at different time intervals in salt-tolerant and salt-sensitive cultivars of wheat. These findings emphasize the significance of the NHX family in wheat tolerance for salt stress response and offer a strong foundation for in addition exploration of wheat NHX genes.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>PS: Conceptualization, Formal analysis, Investigation, Supervision, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing, Project administration. SM: Data curation, Formal analysis, Methodology, Software, Validation, Writing &#x2013; original draft. BP: Data curation, Software, Validation, Writing &#x2013; review &amp; editing. GS: Funding acquisition, Writing &#x2013; review &amp; editing.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. The project work was supported by the grants from Indian Council of Agricultural Research, New Delhi. Funding body has no role in the study, data collection, analysis and manuscript writing.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors acknowledge to Germplasm Resource Unit of ICAR-IIWBR, Karnal for supply of seed material.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2023.1266699/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2023.1266699/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image_1.jpeg" id="SF7" mimetype="image/jpeg">
<label>Supplementary Figure&#xa0;1</label>
<caption>
<p>Amino acid sequences of motifs in logos format.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image_2.jpeg" id="SF8" mimetype="image/jpeg">
<label>Supplementary Figure&#xa0;2</label>
<caption>
<p>Interaction network of NHX family in wheat list of significant GO term (FDR &lt;0.01) of nodes presented in network.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Image_3.jpeg" id="SF9" mimetype="image/jpeg">
<label>Supplementary Figure&#xa0;3</label>
<caption>
<p>
<italic>In-silico</italic> expression analysis of NHX genes in various tissues under drought and heat stress.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table_1.xlsx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_2.xlsx" id="ST2" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_3.xls" id="ST3" mimetype="application/vnd.ms-excel"/>
<supplementary-material xlink:href="Table_4.xlsx" id="ST4" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_5.xls" id="ST5" mimetype="application/vnd.ms-excel"/>
<supplementary-material xlink:href="Table_6.xlsx" id="ST6" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abraham</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Murtola</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Schulz</surname> <given-names>R.</given-names>
</name>
<name>
<surname>P&#xe1;ll</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Hess</surname> <given-names>B.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Gromacs: High performance molecular simulations through multi-level parallelism from laptops to supercomputers</article-title>. <source>SoftwareX</source> <volume>1&#x2013;2</volume>, <fpage>19</fpage>&#x2013;<lpage>25</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.softx.2015.06.001</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aharon</surname> <given-names>G. S.</given-names>
</name>
<name>
<surname>Apse</surname> <given-names>M. P.</given-names>
</name>
<name>
<surname>Duan</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Hua</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Blumwald</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Characterization of a family of vacuolar Na <sup>+</sup> /H <sup>+</sup> antiporters in</article-title>. <source>Analysis</source> <volume>253</volume>(<issue>1</issue>):<fpage>245</fpage>&#x2013;<lpage>256</lpage>. <pub-id pub-id-type="doi">10.1023/A:1024577205697</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bailey</surname> <given-names>T. L.</given-names>
</name>
<name>
<surname>Boden</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Buske</surname> <given-names>F. A.</given-names>
</name>
<name>
<surname>Frith</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Grant</surname> <given-names>C. E.</given-names>
</name>
<name>
<surname>Clementi</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>MEME Suite: Tools for motif discovery and searching</article-title>. <source>Nucleic Acids Res.</source> <volume>37</volume>, <fpage>1</fpage>&#x2013;<lpage>7</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkp335</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bassil</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Tajima</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>Y. C.</given-names>
</name>
<name>
<surname>Ohto</surname> <given-names>M.a.</given-names>
</name>
<name>
<surname>Ushijima</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Nakano</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>The arabidopsis Na+/H+ antiporters NHX1 and NHX2 control vacuolar pH and K<sup>+</sup> homeostasis to regulate growth, flower development, and reproduction</article-title>. <source>Plant Cell</source> <volume>23</volume>, <fpage>3482</fpage>&#x2013;<lpage>3497</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1105/tpc.111.089581</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brett</surname> <given-names>C. L.</given-names>
</name>
<name>
<surname>Donowitz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Rao</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Evolutionary origins of eukaryotic sodium/proton exchangers</article-title>. <source>Am. J. Physiol. Cell Physiol.</source> <volume>288</volume> (<issue>2</issue>), (<fpage>223</fpage>&#x2013;<lpage>239</lpage>). doi:&#xa0;<pub-id pub-id-type="doi">10.1152/ajpcell.00360.2004</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cannon</surname> <given-names>S. B.</given-names>
</name>
<name>
<surname>Mitra</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Baumgarten</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Young</surname> <given-names>N. D.</given-names>
</name>
<name>
<surname>May</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>The roles of segmental and tandem gene duplication in the evolution of large gene families in <italic>Arabidopsis thaliana</italic>
</article-title>. <source>BMC Plant Biol.</source> <volume>4</volume>, <fpage>1</fpage>&#x2013;<lpage>21</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2229-4-10</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>H. T.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>B. Y.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>X. X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H. M.</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>X. Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Whole-genome identification and expression analysis of K<sup>+</sup> efflux antiporter (KEA) and Na<sup>+</sup>/H<sup>+</sup> antiporter (NHX) families under abiotic stress in soybean</article-title>. <source>J. Integr. Agric.</source> <volume>14</volume>, <fpage>1171</fpage>&#x2013;<lpage>1183</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S2095-3119(14)60918-7</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dai</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>P. X.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>PsRNATarget: A plant small RNA target analysis server</article-title>. <source>Nucleic Acids Res</source>. <volume>39</volume>, <fpage>W155</fpage>&#x2013;<lpage>W159</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkr319</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dragwidge</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Scholl</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Schumacher</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Gendall</surname> <given-names>A. R.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>NHX-type Na<sup>+</sup>(K<sup>+</sup>)/H<sup>+</sup> antiporters are required for TGN/EE trafficking and endosomal ion homeostasis in Arabidopsis thaliana</article-title>. <source>J. Cell Sci.</source> <volume>132</volume>, <fpage>2</fpage>&#x2013;<lpage>11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1242/jcs.226472</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dubay</surname> <given-names>K. H.</given-names>
</name>
<name>
<surname>Hall</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Hughes</surname> <given-names>T. F.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Reichman</surname> <given-names>D. R.</given-names>
</name>
<name>
<surname>Friesner</surname> <given-names>R. A.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Accurate force field development for modelling conjugated polymers</article-title>. <source>J. Chem. Theory Comput.</source> <volume>8</volume>, <fpage>4556</fpage>&#x2013;<lpage>4569</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/ct300175w</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fukuda</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Hara</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Toki</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tanaka</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Molecular and functional analyses of rice NHX-type Na<sup>+</sup>/H<sup>+</sup> antiporter genes</article-title>. <source>Planta</source> <volume>233</volume>, <fpage>175</fpage>&#x2013;<lpage>188</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00425-010-1289-4</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gaxiola</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Rao</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Sherman</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Grisafi</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Alper</surname> <given-names>S. L.</given-names>
</name>
<name>
<surname>Fink</surname> <given-names>G. R.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>The <italic>Arabidopsis thaliana</italic> proton transporters, AtNhx1 and Avp1, can function in cation detoxification in yeast</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>96</volume>, <fpage>1480</fpage>&#x2013;<lpage>1485</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.96.4.1480</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ge</surname> <given-names>S. X.</given-names>
</name>
<name>
<surname>Son</surname> <given-names>E. W.</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>iDEP: An integrated web application for differential expression and pathway analysis of RNA-Seq data</article-title>. <source>BMC Bioinf.</source> <volume>19</volume>, <fpage>1</fpage>&#x2013;<lpage>24</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12859-018-2486-6</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gupta</surname> <given-names>O. P.</given-names>
</name>
<name>
<surname>Meena</surname> <given-names>N. L.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Differential regulation of microRNAs in response to osmotic, salt and cold stresses in wheat</article-title>. <source>Mol. Biol. Rep.</source> <volume>41</volume>&#xa0;(<issue>7</issue>), <fpage>4623</fpage>&#x2013;<lpage>4629</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11033-014-3333-0</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hammer</surname> <given-names>&#xd8;.</given-names>
</name>
<name>
<surname>Harper</surname> <given-names>A. T.</given-names>
</name>
<name>
<surname>Ryan</surname> <given-names>P. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Past: Paleontological Statistics software package for education and data analysis</article-title>. <source>Palaeontologia Electronica</source> <volume>4</volume>, <fpage>9</fpage>. Available at: <uri xlink:href="http://palaeo-electronica.org/2001_1/past/issue1_01.htm">http://palaeo-electronica.org/2001_1/past/issue1_01.htm</uri>.</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>A. Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>GSDS 2.0: An upgraded gene feature visualization server</article-title>. <source>Bioinformatics</source> <volume>31</volume>, <fpage>1296</fpage>&#x2013;<lpage>1297</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btu817</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khare</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Kishor</surname> <given-names>P. B. K.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Na<sup>+</sup> and Cl<sup>-</sup> ions show additive effects under NaCl stress on induction of oxidative stress and the responsive antioxidative defense in rice</article-title>. <source>Protoplasma</source> <volume>252</volume>, <fpage>1149</fpage>&#x2013;<lpage>1165</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00709-014-0749-2</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kozomara</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Griffiths-Jones</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>MiRBase: Annotating high confidence microRNAs using deep sequencing data</article-title>. <source>Nucleic Acids Res</source>. <volume>42</volume>, <fpage>D68</fpage>&#x2013;<lpage>73</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkt1181</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Stecher</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Knyaz</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Tamura</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>MEGA X: Molecular evolutionary genetics analysis across computing platforms</article-title>. <source>Mol. Biol. Evol.</source> <volume>35</volume>, <fpage>1547</fpage>&#x2013;<lpage>1549</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molbev/msy096</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumari</surname> <given-names>P. H.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Ramesh</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Reddy</surname> <given-names>P. S.</given-names>
</name>
<name>
<surname>Nagaraju</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Prakash</surname> <given-names>A. B.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Genome-wide identification and analysis of arabidopsis sodium proton antiporter (NHX) and human sodium proton exchanger (NHE) homologs in <italic>Sorghum bicolor</italic>
</article-title>. <source>Genes.</source> <volume>9</volume> (<issue>5</issue>), <fpage>236</fpage>&#x2013;<lpage>254</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/genes9050236</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Larkin</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Blackshields</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>N. P.</given-names>
</name>
<name>
<surname>Chenna</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Mcgettigan</surname> <given-names>P. A.</given-names>
</name>
<name>
<surname>McWilliam</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>Clustal W and clustal X version 2.0</article-title>. <source>Bioinformatics</source> <volume>23</volume>, <fpage>2947</fpage>&#x2013;<lpage>2948</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btm404</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>X.</given-names>
</name>
<name>
<surname>He</surname> <given-names>X. Q.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>MiR395c Regulates secondary xylem development through sulfate metabolism in poplar</article-title>. <source>Front. Plant Sci.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2022.897376</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname> <given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2<sup>-&#x394;&#x394;CT</sup> method</article-title>. <source>Methods</source>. <volume>25</volume> (<issue>4</issue>), <fpage>402</fpage>&#x2013;<lpage>408</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Family-wide survey of miR169s and NF-YAs and their expression profiles response to abiotic stress in maize roots</article-title>. <source>PloS One</source> <volume>9</volume>, <fpage>1</fpage>&#x2013;<lpage>11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0091369</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Manik</surname> <given-names>S. M. N.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>The calcium sensor CBL-CIPK is involved in plant&#x2019;s response to abiotic stresses</article-title>. <source>Int. J. Genomics</source> <volume>2015</volume>, <fpage>10</fpage>&#x2013;<lpage>12</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2015/493191</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Muthusamy</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Dalal</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Chinnusamy</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Bansal</surname> <given-names>K. C.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Differential regulation of genes coding for organelle and cytosolic ClpATPases under biotic and abiotic stresses in Wheat</article-title>. <source>Front. Plant Sci</source>. <volume>7</volume>, <elocation-id>929</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2016.00929</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parveen</surname>
</name>
<name>
<surname>Anwar-Ul-Haq</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Aziz</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Aziz</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Maqsood</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Potassium induces carbohydrates accumulation by enhancing morpho-physiological and biochemical attributes in soybean under salinity</article-title>. <source>Arch. Agron. Soil Sci.</source> <volume>67</volume>, <fpage>946</fpage>&#x2013;<lpage>959</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/03650340.2020.1769075</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Paul</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chatterjee</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Subrahmanya</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Mishra</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>NHX gene family in <italic>Camellia sinensis</italic>: In-silico genome-wide identification, expression profiles, and regulatory network analysis</article-title>. <source>Front. Plant Sci.</source> <volume>20</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2021.777884</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pehlivan</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Jarrett</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Mishra</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Co-overexpressing a plasma membrane and a vacuolar membrane sodium/proton antiporter significantly improves salt tolerance in transgenic arabidopsis plants</article-title>. <source>Plant Cell Physiol.</source> <volume>57</volume>, <fpage>1069</fpage>&#x2013;<lpage>1084</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/pcp/pcw055</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Potter</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Luciani</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Eddy</surname> <given-names>S. R.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Lopez</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Finn</surname> <given-names>R. D.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>HMMER web server: 2018 update</article-title>. <source>Nucleic Acids Res.</source> <volume>46</volume>, <fpage>W200</fpage>&#x2013;<lpage>W204</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gky448</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramesh</surname> <given-names>S. V.</given-names>
</name>
<name>
<surname>Govindasamy</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Rajesh</surname> <given-names>M. K.</given-names>
</name>
<name>
<surname>Sabana</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Praveen</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Stress-responsive miRNAome of <italic>Glycine max</italic> (L.) Merrill: molecular insights and way forward</article-title>. <source>Planta</source> <volume>249</volume>, <fpage>1267</fpage>&#x2013;<lpage>1284</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00425-019-03114-5</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ren</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Qanmber</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Genome-wide identification of the MIKC-type MADS-Box gene family in <italic>Gossypium hirsutum</italic> L. unravels their roles in flowering</article-title>. <source>Front. Plant Sci.</source> <volume>8</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2017.00384</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Ishitani</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>J. K.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>The <italic>Arabidopsis thaliana</italic> salt tolerance gene SOS1 encodes a putative Na<sup>+</sup>/H<sup>+</sup> antiporter</article-title>. <source>Proc. Natl. Acad. Sci.</source> <volume>97</volume>, <fpage>6896</fpage>&#x2013;<lpage>6901</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.120170197</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shuai</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Xia</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Identification of drought-responsive and novel <italic>Populus trichocarpa</italic> microRNAs by high-throughput sequencing and their targets using degradome analysis</article-title>. <source>BMC Genomics</source> <volume>14</volume>, <fpage>233</fpage>&#x2013;<lpage>246</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2164-14-233</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Skolnick</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>The Alphafold2 predicted structures are not considered accurate enough for virtual screening and further research&#xa0;is required to determine the best way to process and prepare these structures for virtual screening</article-title>. <source>J. Chem. Inf. Model.</source> <volume>61</volume>, <fpage>4827</fpage>&#x2013;<lpage>4831</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jcim.1c01114.AlphaFold</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Szklarczyk</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Franceschini</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Wyder</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Forslund</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Heller</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Huerta-Cepas</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>STRING v10: Protein-protein interaction networks, integrated over the tree of life</article-title>. <source>Nucleic Acids Res.</source> <volume>43</volume>, <fpage>D447</fpage>&#x2013;<lpage>D452</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gku1003</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tian</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Expression and integrated network analyses revealed functional divergence of NHX-type Na<sup>+</sup>/H<sup>+</sup> exchanger genes in poplar</article-title>. <source>Sci. Rep.</source> <volume>7</volume>, <fpage>1</fpage>&#x2013;<lpage>17</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-017-02894-8</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ullah</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Buttar</surname> <given-names>Z. A.</given-names>
</name>
<name>
<surname>Shalmani</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Muhammad</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Ud-Din</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Genome-wide identification and expression analysis of CPP-like gene family in <italic>Triticum aestivum</italic> L. under different hormone and stress conditions</article-title>. <source>Open Life Sci.</source> <volume>17</volume>, <fpage>544</fpage>&#x2013;<lpage>562</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1515/biol-2022-0051</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Voorrips</surname> <given-names>R. E.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Mapchart: Software for the graphical presentation of linkage maps and QTLs</article-title>. <source>J. Hered.</source> <volume>93</volume>, <fpage>77</fpage>&#x2013;<lpage>78</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jhered/93.1.77</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilkins</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Matthus</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Swarbreck</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Davies</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Calcium-mediated abiotic stress signaling in roots</article-title>. <source>Front. Plant Sci.</source> <volume>7</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2016.01296</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Hao</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>a). <article-title>Genome-wide identification and characterization of Glycosyltransferase family in cotton</article-title>. <source>Front. Genet.</source> <volume>10</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fgene.2019.00824</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>G. Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S. M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Amiloride reduces sodiumtransport and accumulation in the succulent xerophyte Zygophyllum xanthoxylum under salt conditions</article-title>. <source>Biol. Trace Elem. Res.</source> <volume>139</volume>, <fpage>356</fpage>&#x2013;<lpage>367</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12011-010-8662-9</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>G. Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Genome-wide identification of Na+/H+ antiporter (NHX) genes in sugar beet (<italic>Beta vulgaris</italic> L.) and their regulated expression under salt stress</article-title>. <source>Genes.</source> <volume>10</volume> (<issue>5</issue>), <fpage>401</fpage>&#x2013;<lpage>420</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/genes10050401</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>The large soybean (<italic>Glycine max</italic>) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups</article-title>. <source>BMC Plant Biol.</source> <volume>13</volume>, <fpage>148</fpage>&#x2013;<lpage>167</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2229-13-148</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yue</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jio</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>H</given-names>
</name>
</person-group>. (<year>2021</year>). <article-title>Comparative transcriptomic and metabolic profiling provides insight into the mechanism by which the autophagy inhibitor 3-MA enhances salt stress sensitivity in wheat seedlings</article-title>. <source>BMC Plant Biol.</source> <volume>21</volume>,&#xa0;<fpage>577</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12870-021-03351-5</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Secrets of the MIR172 family in plant development and flowering unveiled</article-title>. <source>PloS Biol.</source> <volume>19</volume>, <fpage>8</fpage>&#x2013;<lpage>11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pbio.3001099</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The structure, functional evolution, and evolutionary trajectories of the H+-PPase gene family in plants</article-title>. <source>BMC Genomics</source> <volume>21</volume>, <fpage>1</fpage>&#x2013;<lpage>17</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12864-020-6604-2</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Roles of phytohormones and their&#xa0;signaling pathways in leaf development and stress responses</article-title>. <source>J. Agric. Food Chem.</source> <volume>69</volume>, <fpage>3566</fpage>&#x2013;<lpage>3584</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jafc.0c07908</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>