<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1238838</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Enhancing drought resistance in <italic>Pogostemon cablin</italic> (Blanco) Benth. through overexpression of ACC deaminase gene using thin cell layer regeneration system</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Warsi</surname>
<given-names>Zafar I.</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/2340202"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Khatoon</surname>
<given-names>Kahkashan</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Singh</surname>
<given-names>Pooja</given-names>
</name>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Rahman</surname>
<given-names>Laiq Ur</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2343166"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Central Institute of Medicinal and Aromatic Plants, Council of Scientific and Industrial Research (CSIR)</institution>, <addr-line>Lucknow</addr-line>, <country>India</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Rajib Roychowdhury, Volcani Center, Israel</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Vibha Pandey, National Botanical Research Institute (CSIR), India; Yavar Vafaee, University of Kurdistan, Iran; Jitendriya Panigrahi, Shri Alpesh N Patel PG Institute of Science and Research Anand, India</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Laiq Ur Rahman, <email xlink:href="mailto:faizslaiq@gmail.com">faizslaiq@gmail.com</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>11</day>
<month>08</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1238838</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>06</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>20</day>
<month>07</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Warsi, Khatoon, Singh and Rahman</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Warsi, Khatoon, Singh and Rahman</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Pogostemon cablin</italic> cultivation faces massive constraints because of its susceptability to drought stress that reduces patchouli propagation and oil yield. The present study has achieved an efficient and rapid direct regeneration system for the transgenic production of <italic>P. cablin</italic> using Agrobacterium-mediated genetic transformation. To establish an efficient regeneration protocol for fast <italic>in-vitro</italic> multiplication of patchouli plants, leaf, petiole, and transverse thin cell layer (tTCL) explants were used and inoculated on an MS medium supplemented with different combinations of phytohormones. A comparative study showed a maximum regeneration frequency of 93.30 &#xb1; 0.56% per explant was obtained from leaf segments on optimal MS medium fortified with 0.2mg/L BAP and 0.1mg/L NAA. Leaf and petiole explants took 25-35 days to regenerate while tTCL section showed regeneration in just 15-20 days on the same medium. Subsequently, productive genetic transformation protocol OD<sub>600</sub> 0.6, AS 200&#xb5;M, 30mg/L kanamycin, and infection time 5 min. was standardized and best-suited explants were infected at optimum conditions from the <italic>Agrobacterium tumefaciens</italic> (LBA 4404) strain harboring <italic>ACC deaminase</italic> to generate transgenic <italic>P. cablin</italic> Benth. (CIM-Samarth) plants. The investigation suggested that the optimized protocol provides a maximum transformation frequency of 42 &#xb1; 1.9% in 15-20 days from tTCL. The transgenic plants were shifted to the greenhouse with a 52.0 &#xb1; 0.8% survival frequency. A molecular docking study confirmed significant binding affinity of ligand ACC with <italic>ACC deaminase</italic> at the catalytic site, and ligand interactions showed four H-bonds at the binding pocket with amino acids Cys-196, Val-198, Thr-199, and Gly-200 that validate gene relative expression in transgenic plants. Among all transgenic acclimatized greenhouse-grown patchouli plants, line PT4 showed improved drought resistance under severe water stress as its RWC was 71.7 &#xb1; 2.3% to 75.7 &#xb1; 2.1% which is greater than the RWC of the control plant, 58.30 &#xb1; 0.21%. Analysis of the other physiological indicators, H<sub>2</sub>O<sub>2</sub>, chlorophyll content, and ROS result support drought resistance ability. Our study concluded that the first report on <italic>P. cablin</italic>, tTCL direct regeneration, and standardized transformation protocol created a new opportunity for genetic manipulation to achieve drought-resistant patchouli plants for cultivation in all seasons at the commercial level.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Pogostemon cablin</italic>
</kwd>
<kwd>direct regeneration</kwd>
<kwd>genetic transformation</kwd>
<kwd>tTCLs</kwd>
<kwd>ACC deaminase</kwd>
<kwd>molecular docking</kwd>
<kwd>drought resistance</kwd>
</kwd-group>
<counts>
<fig-count count="9"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="90"/>
<page-count count="16"/>
<word-count count="8254"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Plant Biotechnology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>The plant patchouli <italic>(Pogostemon cablin.</italic>, family Lamiaceae); is an essential aromatic herb, native to tropical regions of Asia (<xref ref-type="bibr" rid="B86">Wang et&#xa0;al., 2019</xref>). Patchouli oil (PO) is commercially utilized in the perfumery, cosmetic, and aromatherapy industries worldwide. Besides being used in cosmetics, it is used as an antidepressant, antiphlogistic, antiseptic, aphrodisiac, astringent, diuretic, febrifuge, and fungicide (<xref ref-type="bibr" rid="B39">Miyazawa et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B10">Bunrathep et&#xa0;al., 2006</xref>). The major component of patchouli essential oil are patchoulene, caryophyllene, pogostol, guaiene, patchoulol, and &#x3b1;-patchoulene (<xref ref-type="bibr" rid="B90">Zhou et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B35">Liu et&#xa0;al., 2015</xref>). Patchoulol and &#x3b1;- patchoulene are responsible for maintaining the quality of PO (<xref ref-type="bibr" rid="B50">Ramya et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B44">Pandey et&#xa0;al., 2021</xref>). The potential application of PO in pharmacology and agriculture has led to an enormous global demand. The estimated global patchouli oil production is 800 tonnes/year, about 60% of which is produced by Indonesia (<xref ref-type="bibr" rid="B81">Tahir et&#xa0;al., 2019</xref>). Patchouli cultivation in India is approximately 600 ha, producing 20 tonnes of oil/annum (<xref ref-type="bibr" rid="B12">Choudhri et&#xa0;al., 2023</xref>).</p>
<p>Global climatic changes impose a wide range of stresses over crop cultivation and production (<xref ref-type="bibr" rid="B11">Chakraborty et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B55">Roychowdhury, 2014</xref>; <xref ref-type="bibr" rid="B56">Roychowdhury et&#xa0;al., 2020</xref>). The cultivation of shade-loving patchouli faces significant constraints due to its susceptibility to various biotic stresses (pests, fungi, viruses, and root-knot nematodes) and abiotic stresses (<xref ref-type="bibr" rid="B67">Singh et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B9">Bhau et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B76">Suhesti et&#xa0;al., 2022</xref>). In Southeast Asia, patchouli cultivation dominantly occurs in dry land therefore, <italic>P. cablin</italic> faces drought stress which limits its rapid growth and productivity (<xref ref-type="bibr" rid="B76">Suhesti et&#xa0;al., 2022</xref>). These stresses induce excess ethylene synthesis, resulting in senescence, abscission, and leaf yellowing ultimately reducing its essential oil yield (<xref ref-type="bibr" rid="B18">Glick, 2014</xref>). Until now, among all the major varieties of patchouli, none of them are showing improved drought tolerance capability. Consequently, preference has been given to developing varieties resistant/tolerant to drought stress with high biomass and better PO quality (<xref ref-type="bibr" rid="B76">Suhesti et&#xa0;al., 2022</xref>). Moreover, various conventional propagation methods cannot be practiced for genetic modification of <italic>P. cablin-</italic>resistant varieties because of the low transformation efficiency. Therefore, biotechnological applications could be successful in performing <italic>Agrobacterium tumefaciens-</italic> mediated genetic transformation with specific genes (<xref ref-type="bibr" rid="B61">Roychowdhury and Tah, 2013</xref>; <xref ref-type="bibr" rid="B57">Roychowdhury et&#xa0;al., 2023</xref>). The genetic manipulation provides a new dimension to develop superior patchouli drought resistant lines to meet the industrial demand of PO by cultivating in all seasons (<xref ref-type="bibr" rid="B46">Paul et&#xa0;al., 2012</xref>).</p>
<p>Recently, biotechnological techniques have been developed for microbial-plant interactions to utilize beneficial micro-biome characteristics for improving plant quantity and quality (<xref ref-type="bibr" rid="B40">Moon and Ali, 2022</xref>; <xref ref-type="bibr" rid="B32">Li et&#xa0;al., 2023a</xref>; <xref ref-type="bibr" rid="B33">Li et&#xa0;al., 2023b</xref>). One such technique is using <italic>ACC deaminase</italic>-PGPR for regenerative agriculture, which has shown to be highly advantageous (<xref ref-type="bibr" rid="B18">Glick, 2014</xref>; <xref ref-type="bibr" rid="B21">Han et&#xa0;al., 2021</xref>). During stress, plants produce excess ethylene called &#x2018;stress ethylene&#x2019;, which can impair primary metabolism (<xref ref-type="bibr" rid="B69">Singh et&#xa0;al., 2021</xref>). Drought stress compromises various physiological and metabolic pathways, resulting in stunted plant growth, interrupted photosynthesis, and abnormal metabolism leading to plant death (<xref ref-type="bibr" rid="B22">Hasanuzzaman et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B3">Anumalla et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B88">Zhang et&#xa0;al., 2018</xref>). As per the literature study, PGPRs that produce <italic>ACC deaminase</italic> have been found to reduce stress ethylene phytohormone levels under biotic and abiotic stresses (<xref ref-type="bibr" rid="B48">Penrose &amp; Glick, 2003</xref>) by catalyzing ACC into &#x3b1;-ketobutyrate and ammonia (<xref ref-type="bibr" rid="B34">Li et&#xa0;al., 2019</xref>). It is reported by <xref ref-type="bibr" rid="B18">Glick (2014)</xref> that the transformation of the bacterial <italic>ACC deaminase</italic> gene supports reducing ethylene concentration and improving root permeability along with nitrate availability. Therefore, <italic>Agrobacterium</italic>-mediated genetic engineering is crucial for decreasing ethylene accumulation without affecting plant growth and development.</p>
<p>To genetically improve <italic>P. cablin</italic>, an efficient, fast, and highly reproducible regeneration system has been acquired in the present research to transform the <italic>ACC deaminase</italic> gene for large-scale cultivation in every season. <xref ref-type="bibr" rid="B84">Van (1973)</xref> developed the thin cell layer (TCL) technique, a low-cost, fast multiplication, and highly reproducible <italic>in-vitro</italic> propagation method for large-scale production of genetically stable plants. Either longitudinal (lTCL) or transverse (tTCL) section of ~0.1-5mm thin explants can be used for the propagation and preservation of various significant plants, including endangered ones (<xref ref-type="bibr" rid="B54">Rout et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B70">Singh et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B89">Zhao et&#xa0;al., 2007</xref>). Although regeneration and transformation protocols have been reported in <italic>P. cablin</italic> (<xref ref-type="bibr" rid="B47">Paul et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B46">Paul et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B75">Sugimura et&#xa0;al., 2005</xref>) from callus and direct regeneration from leaf disc, the transformation parameters were not well-concluded to provide better variety.</p>
<p>By keeping the detailed literature in mind, the present study demonstrates the establishment of an efficient direct regeneration system from leaf, petiole, and internodal transverse thin cell layer (tTCL) explants of patchouli to avoid somaclonal variation for large-scale multiplication in every season. The consequence of fast regeneration provides a smooth platform to address <italic>Agrobacterium tumefaciens-</italic>mediated genetic transformation with a construct harboring the <italic>ACC deaminase</italic> gene to analyse the tolerance level of acclimatized greenhouse-grown transgenic <italic>P. cablin</italic> plants against drought stress.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Establishment of <italic>in vitro</italic> and direct regeneration protocols</title>
<p>Immature nodal explants were collected from 3-4 month old healthy patchouli plants (CIM-Samarth) cultivated by CSIR-CIMAP experimental farm itself, as shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>. The explants were washed with Tween20 (HiMedia, Maharashtra) and then rinsed with running tap water for 15-20 min. To sterilize the explants, they were treated with mercuric chloride (HgCl<sub>2</sub>, 0.1%) for 2-5 min. and then rinsed 2-3 times with sterile distilled water to remove any residual HgCl<sub>2</sub>. The sterilized explants were then transferred to full and half-strength MS medium (<xref ref-type="bibr" rid="B41">Murashige and Skoog, 1962</xref>) for <italic>in vitro</italic> plant establishment, as shown in <xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, C</bold>
</xref>. Further, the <italic>in vitro</italic> grown plants were taken as an opportunity to standardize the direct regeneration system using leaf, petiole, and internodal tTCL as explants (~0.1 to 1.0 cm in size). Eighteen explants of each type were inoculated onto MS medium containing various compositions of auxin (1-naphthaleneacetic acid- 0.01 mg/L to 1 mg/L) along with cytokinin (6-benzylaminopurine hydrochloride- 1 mg/L to 6 mg/L) for direct regeneration system (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). The inoculated plates were maintained in the culture room at 25 &#xb1; 2&#xb0;C with 16L-H: 8D-H photoperiods. After 45 days, the regenerated explants were shifted to full and half-strength MS medium for root induction (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1G</bold>
</xref>). The rooted plants were shifted to autoclaved sand for hardening, then after acclimatization plants were shifted to a mixture of soil and vermicompost (3:1) as shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Direct regeneration of <italic>Pogostemon cablin.</italic> <bold>(A)</bold> Source of <italic>P. cablin</italic> plant from CIMAP experimental farm. <bold>(B)</bold> Nodal explants were surface sterilized and shifted to half/full strength MS medium. <bold>(C)</bold> <italic>In vitro</italic> established rooted Patchouli plants. <bold>(D)</bold> Leaves and petioles were on regeneration medium (MS media supplemented with 0.2 mg/L BAP + 0.1 mg/L NAA). <bold>(E)</bold> Direct regeneration was observed from both explants. <bold>(F)</bold> Multiple shoots of a single explant and its microscopic view. <bold>(G)</bold> Regenerated shoots were shifted on MS medium for root induction. <bold>(H)</bold> Rooted plants were acclimatized in the greenhouse.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g001.tif"/>
</fig>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Response of different hormonal combinations to induce direct regeneration from petiole and leaf explants.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" rowspan="3" align="left">Media composition<break/>(MS + Hormones mg/L)<break/>&#xa0;</th>
<th valign="top" colspan="4" align="center">Explants used</th>
</tr>
<tr>
<th valign="top" colspan="2" align="left">Petiole</th>
<th valign="top" colspan="2" align="left">Leaf</th>
</tr>
<tr>
<th valign="top" align="center">No. of Shoots</th>
<th valign="top" align="center">Regeneration frequency*(%)</th>
<th valign="top" align="center">No. of Shoots</th>
<th valign="top" align="center">Regeneration frequency*(%)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<bold>MS</bold>
</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">0.00</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">0.00</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>1.0 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">2.30 &#xb1; 0.57<sup>b</sup> c<sup>+</sup>
</td>
<td valign="top" align="left">10.00 &#xb1; 0.57<sup>abc</sup>
</td>
<td valign="top" align="left">5.60 &#xb1; 0.80<sup>b</sup> c<sup>+</sup>
</td>
<td valign="top" align="left">33.30 &#xb1; 1.00<sup>cdef</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>1.0 BAP + 0.5 NAA</bold>
</td>
<td valign="top" align="left">1.60 &#xb1; 0.58<sup>ab</sup> c*</td>
<td valign="top" align="left">21.60 &#xb1; 0.58<sup>abcd</sup>
</td>
<td valign="top" align="left">1.50 &#xb1; 0.54<sup>a</sup> c*</td>
<td valign="top" align="left">10.00 &#xb1; 0.57<sup>abc</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>1.5 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">4.60 &#xb1; 1.10<sup>c</sup> c<sup>++</sup>
</td>
<td valign="top" align="left">33.30 &#xb1; 1.00<sup>cde</sup>
</td>
<td valign="top" align="left">1.80 &#xb1; 0.75<sup>a</sup> c<sup>++</sup>
</td>
<td valign="top" align="left">16.70 &#xb1; 0.90<sup>abcd</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>1.5 BAP + 0.5 NAA</bold>
</td>
<td valign="top" align="left">1.60 &#xb1; 0.60<sup>ab</sup> c*</td>
<td valign="top" align="left">26.60 &#xb1; 0.50<sup>bcd</sup>
</td>
<td valign="top" align="left">0.60 &#xb1; 0.51<sup>a</sup> c*</td>
<td valign="top" align="left">5.00 &#xb1; 0.50<sup>ab</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>2.0 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">0.0 c+++</td>
<td valign="top" align="left">0</td>
<td valign="top" align="left">0.0 c+++</td>
<td valign="top" align="left">0</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.1 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">19.30 &#xb1; 1.15<sup>f</sup>
</td>
<td valign="top" align="left">71.60 &#xb1; 1.10<sup>fg</sup>
</td>
<td valign="top" align="left">15.10 &#xb1; 1.16<sup>ef</sup>
</td>
<td valign="top" align="left">66.70 &#xb1; 1.10<sup>gh</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.2 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">33.60 &#xb1; 1.52<sup>i</sup> c<sup>-</sup>
</td>
<td valign="top" align="left">88.30 &#xb1; 1.12<sup>g</sup>
</td>
<td valign="top" align="left">37.30 &#xb1; 1.63<sup>i</sup> c<sup>-</sup>
</td>
<td valign="top" align="left">93.30 &#xb1; 0.56<sup>i</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.3 BAP + 0.1NAA</bold>
</td>
<td valign="top" align="left">27.60 &#xb1; 1.53<sup>h</sup> c</td>
<td valign="top" align="left">76.60 &#xb1; 0.54<sup>gf</sup>
</td>
<td valign="top" align="left">26.00 &#xb1; 1.78<sup>h</sup> c</td>
<td valign="top" align="left">76.70 &#xb1; 0.55<sup>hi</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.4 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">24.60 &#xb1; 1.51<sup>g</sup> c<sup>+</sup>
</td>
<td valign="top" align="left">55.00 &#xb1; 0.40<sup>ef</sup>
</td>
<td valign="top" align="left">18.60 &#xb1; 1.50<sup>g</sup> c<sup>+</sup>
</td>
<td valign="top" align="left">55.00 &#xb1; 0.58<sup>fg</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.5 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">19.30 &#xb1; 1.15<sup>f</sup> c<sup>++</sup>
</td>
<td valign="top" align="left">38.30 &#xb1; 0.52<sup>ed</sup>
</td>
<td valign="top" align="left">15.00 &#xb1; 2.09<sup>f</sup> c<sup>++</sup>
</td>
<td valign="top" align="left">43.30 &#xb1; 0.57<sup>ef</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.6 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">11.60 &#xb1; 0.50<sup>e</sup> c<sup>+++</sup>
</td>
<td valign="top" align="left">26.60 &#xb1; 1.20<sup>bcd</sup>
</td>
<td valign="top" align="left">13.50 &#xb1; 1.20<sup>e</sup> c<sup>+++</sup>
</td>
<td valign="top" align="left">38.30 &#xb1; 1.15<sup>def</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.7 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">8.30 &#xb1; 1.52<sup>d</sup> c<sup>+++</sup>
</td>
<td valign="top" align="left">16.60 &#xb1; 1.52<sup>abcd</sup>
</td>
<td valign="top" align="left">10.30 &#xb1; 0.51<sup>d</sup> c<sup>+++</sup>
</td>
<td valign="top" align="left">38.30 &#xb1; 0.50<sup>def</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.8 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">3.30 &#xb1; 0.50<sup>bc</sup> c*</td>
<td valign="top" align="left">16.60 &#xb1; 0.49<sup>ab</sup>
</td>
<td valign="top" align="left">8.50 &#xb1; 0.50<sup>c</sup> c*</td>
<td valign="top" align="left">26.70 &#xb1; 0.53<sup>bcde</sup>
</td>
</tr>
<tr>
<td valign="top" align="left">
<bold>0.9 BAP + 0.1 NAA</bold>
</td>
<td valign="top" align="left">1.60 &#xb1; 0.57<sup>ab</sup> c*</td>
<td valign="top" align="left">5.00 &#xb1; 0.58<sup>ab</sup>
</td>
<td valign="top" align="left">6.60 &#xb1; 0.81<sup>bc</sup> c*</td>
<td valign="top" align="left">21.70 &#xb1; 0.49<sup>abcde</sup>
</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Values shows mean &#xb1; SD. Means followed by the same letters (a, b, c, d, e, f, g, h, i) within column do not differ significantly at p &#x2264; 0.05 according to Duncan&#x2019;s multiple range test 0.0 = No response on MS medium, c-= Direct regeneration without callus, c+ = Direct regeneration with little callus, c++ = Shoot regeneration with more callus, c+++ = Maximum callus, c*= callus hard and brown.</p>
</fn>
<fn>
<p>Regeneration frequency (%) = no. of explants regenerated/ Total no. of explants inoculated x 100.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Histological analysis of transverse thin cell layer explants</title>
<p>The initial and regenerated explants were prepared for imaging under Leica Microsystem limited (Switzerland, version 2.1.0) and scanning electron microscope (SEM) to visualize histological information. Initially, explants were washed three times with deionized water to remove traces of agar, and then the transverse section was cut. The unprocessed samples were mounted on aluminum stubs using two-sided adhesive copper tape and placed in the SEM specimen chamber (FEI-Quanta 250). Images were taken in low vacuum mode using a large field detector (LFD) at a chamber pressure of 120 Pa. An accelerated voltage of 20 Kv and a working distance of 12.9 mm were used. Relatively low magnification (61X- 174X) was used to obtain the image, and the optimum spot size (4.0) was chosen to achieve better resolution.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Establishment of a genetic transformation using <italic>Agrobacterium tumefaciens</italic>
</title>
<p>For selecting putative transgenic <italic>Pogostemon cablin</italic> plants containing the <italic>ACC deaminase</italic> gene, standardization of kanamycin concentration, acetosyringone concentration, optical density, and treatment time are prerequisites (<xref ref-type="bibr" rid="B46">Paul et&#xa0;al., 2012</xref>). Two constructs were used in this study for the genetic transformation of <italic>P. cablin</italic>, and both constructs were in <italic>A. tumefaciens</italic> strain LBA4404. One of the constructs contained a gene of interest, <italic>ACC deaminase</italic>, while the other was a pBI121 binary vector used as a control. The control vector carried the <italic>gusA/uidA</italic> reporter gene, controlled by constitutive promoter CaMV 35S and Tnos terminator. Moreover, each construct has a selection marker <italic>nptII.</italic>
</p>
<sec id="s2_3_1">
<label>2.3.1</label>
<title>Optimization of Kanamycin concentration for selection of transformants</title>
<p>For the efficient selection of putative transformants, kanamycin concentration was optimized. Excised untransformed explants were transferred to the regeneration medium 0.2mg/L BAP and 0.1mg/L NAA containing kanamycin concentration varies from 05 to 50mg/L for screening of transformants. After 30-45 days of inoculation, plates were screened for optimized kanamycin concentration (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Standardization of <italic>Agrobacterium-</italic>mediated genetic transformation protocol in <italic>Pogostemon cablin.</italic> <bold>(A)</bold> Optimization of kanamycin concentration for selection of regenerated transformants. <bold>(B)</bold> Effect of <italic>A. tumefaciens</italic> optical density on transient <italic>uidA</italic> expression of <italic>P. cablin.</italic> <bold>(C)</bold> Detection of optimum acetosyringone concentration on behalf of transient GUS expression. <bold>(D)</bold> Evaluation of optimum infection time to get maximum transformation frequency. The bars indicate mean &#xb1; SD.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g002.tif"/>
</fig>
</sec>
<sec id="s2_3_2">
<label>2.3.2</label>
<title>Standardization of optical density, infection time, and acetosyringone concentration</title>
<p>The determination of optimum optical density was also checked to obtain the maximum transformation frequency in <italic>P. cablin.</italic> A single colony of <italic>A. tumefaciens</italic> strain LBA4404 with pBI121 vector was used as the inoculum in Yeast extract broth (YEB) as per <xref ref-type="bibr" rid="B68">Singh et&#xa0;al. (2017)</xref> to get optimal OD<sub>600.</sub> The bacterial cells were harvested at various OD (0.2-1.2) by centrifugation at 5000rpm for 10 min. at 4&#xb0; C. The pellet was then re-suspended in a liquid MS medium. All OD ranges were used to infect all explants to detect the optimal OD of bacterial strain (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). To standardize infection time; explants were infected with a pBI121 vector having optimal OD<sub>600</sub> 0.6 for a different time interval (5-25 min.) (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). Activation of <italic>VirA</italic> gene is requisite to obtain the maximum <italic>Agrobacterium-mediated</italic> transformation frequency. Acetosyringone of different concentrations ranging from 50&#xb5;M to 300&#xb5;M, shown in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>, was added to the co-cultivation medium just before infection of the explants.</p>
</sec>
<sec id="s2_3_3">
<label>2.3.3</label>
<title>Co-cultivation, regeneration, and root induction in transgenic plants</title>
<p>The explants were treated with all the optimized parameters and inoculated onto MS medium for 24-72h of co-cultivation in the dark. Subsequently, the explants were shifted to a regeneration medium (as mentioned above) containing 30mg/L kanamycin and 250mg/L cefotaxime for selection of putative transformants and inhibition of <italic>A. tumefaciens</italic> overgrowth after co-cultivation, respectively. The regenerated putative transformants were transferred to half strength MS medium for root induction. Moreover, the rooted plants were then shifted to pots filled with a mixture of sand: soil (1:1) for hardening and acclimatization in the glass house, as depicted in <xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3H, I</bold>
</xref>, (<xref ref-type="bibr" rid="B68">Singh et&#xa0;al., 2017</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Regeneration and development of putatively transformed <italic>P. cablin</italic> plants. <bold>(A, C)</bold> <italic>Agrobacterium-</italic>infected explants (leaves, petioles, and internodal tTCL) were inoculated onto a regeneration medium with a selection marker. <bold>(B)</bold> Direct regeneration of leaves and petiole explants after 25-30 days of inoculation on selection medium. <bold>(D)</bold> tTCL section showed regeneration after 15-20 days on kanamycin-containing media. <bold>(E)</bold> Microscopic view of regenerated shoots. <bold>(F, G)</bold> Putative shoots were shifted to a half-strength MS medium with a selection marker for root induction. <bold>(H, I)</bold> Rooted putative transgenic plants were shifted in the greenhouse for hardening and acclimatization. <bold>(J)</bold> Non-transformed leaf (control) <bold>(K)</bold> Transient GUS expression of patchouli leaf. <bold>(L, M)</bold> Stable GUS expression of regenerated shoots and leaf of <italic>P. cablin</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g003.tif"/>
</fig>
</sec>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>GUS histochemical assay</title>
<p>To validate transgenic plants, both transient and stable GUS expression was observed using the procedure described by <xref ref-type="bibr" rid="B24">Jefferson (1987)</xref>. The leaf and petiole explants were dipped in a solution comprising 1mM X-Gluc, Thermo scientific (5-bromo-4-chloro-3-indolyl glucuronide), 0.1mM potassium ferrocyanide, 0.1mM potassium ferricyanide, 0.1M sodium phosphate buffer (pH 7.0), and 0.1% triton X-100 (HiMedia). The explants were then incubated at 37&#xb0;C for 16h in the dark chamber or covered with aluminum foil (<xref ref-type="bibr" rid="B26">Khan et&#xa0;al., 2015</xref>). After incubation, the explants were washed with 70% ethanol until completely removing chlorophyll content and analyzed under the stereomicroscope for transient expression after ten days of infection, as shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3K</bold>
</xref>. In contrast, putative transgenic plants cultivated on the kanamycin-containing medium were checked for stable GUS expression after 8-10 weeks of infection (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3L, M</bold>
</xref>). The presence of blue color confirmed the expression of putative transgenic plants.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Molecular characterization of putative transgenic plants</title>
<sec id="s2_5_1">
<label>2.5.1</label>
<title>Polymerase chain reaction</title>
<p>The twelve randomly selected putative transgenic plants were evaluated for integrating <italic>ACC deaminase</italic> and <italic>nptII</italic> genes amplification through polymerase chain reaction (PCR). The plants&#x2019; genomic DNA was isolated using the CTAB method. Quantification and purification of genomic DNA were evaluated for the PCR reaction. The primer sequences used for <italic>nptII</italic> and <italic>ACC deaminase</italic> gene amplification are presented in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. The PCR reaction (Takara master mix) program for <italic>nptII</italic> gene amplification was as follows: 95&#xb0;C for 5 min. as initial denaturation, 35 cycles of 95&#xb0;C for the 30s as secondary denaturation, 53&#xb0;C for 40s as annealing, and 72&#xb0;C for 1 min. as elongation, and 72&#xb0;C for 10 min. as a final extension. Subsequently, <italic>ACC deaminase</italic> amplification was performed, as reported by (<xref ref-type="bibr" rid="B69">Singh et&#xa0;al., 2021</xref>). The reaction performed for 25 &#xb5;l reaction (50ng DNA, 10 pmole primers, 2X PCR buffer, and 1.25 unit of Taq DNA Polymerase, Takara) at 94&#xb0;C for 5 min. as primary denaturation, 35 following cycles of 94&#xb0;C for the 30s as secondary denaturation, 57&#xb0;C for 30s as annealing, 72&#xb0;C for 2 min. as elongation, and 72&#xb0;C for 5 min. as a final extension. Both amplified products, <italic>nptII</italic>, and <italic>ACC deaminase</italic>, were analyzed in 0.8% (w/v) agarose gel prepared in 1X TAE buffer in the presence of 6 &#xb5;l/100ml EtBr.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>list of primers used in PCR and RT-PCR.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="center">Primer sequence (from 5&#x2019; - 3&#x2019;)</th>
<th valign="top" align="center">Accession number</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>nptII</italic>
</td>
<td valign="top" align="left">F-AAGATGGATTGCACGCAGGT<break/>R-TCAGAAGAACTCGTCAAGAAGGC</td>
<td valign="top" align="left">AF485783</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>PcACCD</italic>
</td>
<td valign="top" align="left">F- ATGGATCTGCAACGCTTTCCCC<break/>R- TTATCCGTTGCGGTAGAG</td>
<td valign="top" align="left">WP_013392321</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>PcActin</italic>
</td>
<td valign="top" align="left">F- TCCCTCATGCAATCCTTCGT<break/>R- CCTCACAATTTCCCGCTCTG</td>
<td valign="top" align="left">KP676600</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>PcACCD</italic> (RT-PCR)</td>
<td valign="top" align="left">F- CTATTCGGACGCGGTCTACG<break/>R- GAAGCCGATGTCGAAACCCT</td>
<td valign="top" align="left">WP_013392321</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>F - Forward, R - Reverse.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_5_2">
<label>2.5.2</label>
<title>Gene expression analysis through real-time PCR</title>
<p>The relative expression of the <italic>ACC deaminase</italic> gene in PCR-positive lines was confirmed through RT-PCR. Total RNA was isolated from 7 transformed lines and one non-transformed plant (negative control) using TRI reagent<sup>&#xae;</sup> (Sigma). Quantification was performed by Nanodrop spectrophotometer ND1000. The cDNA was prepared using 5&#xb5;g of total isolated RNA with Gene Sure First strand cDNA synthesis kit (Pure gene). RT-PCR-specific Primers for <italic>ACC deaminase</italic> and <italic>Actin</italic> (endogenous control) were designed using Primer3 software and are listed in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. To perform RT-PCR, cDNA was diluted to 100-150 ng/&#xb5;l, and 5pmol of forward and reverse primers were used. Moreover, the target gene&#x2019;s relative expression was calculated by the 2-<sup>&#x394;&#x394;Ct</sup> method (<xref ref-type="bibr" rid="B2">Afroz et. al., 2022</xref>), and normalization of the target gene was done using the comparative Ct value of endogenous control.</p>
</sec>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Structure modeling and molecular docking</title>
<p>Currently, computational studies have been used extensively to understand the ligand-receptor interaction between ACC and <italic>ACC deaminase</italic> to mitigate abiotic stress (<xref ref-type="bibr" rid="B78">Suresh et&#xa0;al., 2022</xref>). The 3D structure was deduced by depositing <italic>ACC deaminase</italic> (<italic>Achromobacter xylosoxidance</italic>) primary protein sequence from the NCBI database (<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov">http://www.ncbi.nlm.nih.gov</ext-link>) (WP_013392321.1) in SWISS-MODEL (<ext-link ext-link-type="uri" xlink:href="http://swissmodel.expasy.org/workspace">http://swissmodel.expasy.org/workspace</ext-link>). Further, the result was narrowed to get a representative model 1F2D for homology modeling, which has &gt;98% query coverage and &gt;59% identity. The best preliminary predicted model was processed for refinement by Galaxy refine (<ext-link ext-link-type="uri" xlink:href="http://galaxy.seoklab.org/">http://galaxy.seoklab.org/</ext-link>) server. Stereo-chemical properties of the build model were further analyzed using the PROCHECK tool in the SAVES server (<ext-link ext-link-type="uri" xlink:href="http://nihserver.mbi.ucla.edu/SAVES/">http://nihserver.mbi.ucla.edu/SAVES/</ext-link>) based on the Ramachandran plot to know the quality of the built model (<xref ref-type="bibr" rid="B31">Laskowski et&#xa0;al., 1993</xref>). The model was further visualized by PyMOL (<xref ref-type="bibr" rid="B15">DeLano, 2002</xref>).</p>
<p>Molecular docking was performed using AutoDock tool version 4.2.6 (Perkin Elmer, Massachusetts, USA). The modeled structure was docked with ligand ACC (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>) (Compound CID: 535). Grid Box was modified to cover the binding pocket of <italic>ACC deaminase</italic> at center X = 35.964, center Y= 118.074, center Z= 15.704, and the number of points in all dimensions was 60A&#xb0;. Genetic algorithm simulation was performed for 50 independent docked calculations. The docked conformation with the lowest energy was visualized by PyMOL version 2.4.0 and discovery studio version 21.1 to study interactions in active sites binding pockets (<xref ref-type="bibr" rid="B15">DeLano, 2002</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Homology modeling and molecular docking. <bold>(A)</bold> 3D homology model of receptor ACC deaminase. <bold>(B)</bold> ACC ligand molecule <bold>(C)</bold> Molecular docking of receptor and ligand at the active site of target protein ACC deaminase. <bold>(D)</bold> PyMOL pictorial representation showed H-bonds interaction at the catalytic subunit. <bold>(E)</bold> 2D Docking- showed interaction of the ligand with amino acid present at the active site of target protein, green dots indicating conventional H-bonds. <bold>(F)</bold> Docking stable conformation at the binding pocket between ACC and ACC deaminase.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g004.tif"/>
</fig>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Drought stress treatments</title>
<p>To investigate the response of <italic>ACC deaminase</italic> expression, 2-3 months old 12 transgenic lines (PT4) and 12 non-transformed plants were selected to undergo drought stress in the glasshouse control environment. Three different watering conditions were prepared as per <xref ref-type="bibr" rid="B87">Yamasaki and Dillenburg (1999)</xref>. Different setups were planned, i.e., sufficient water (15% soil moisture, 100ml distilled water on alternate days), modest water (12% soil moisture, 100ml distilled water on every fifth day), and extreme water stress (8% soil moisture, no water given until day20). Well-watered treatment was used as control. On the day 21 of the dehydration experiment, samples were collected for various morphological and physiological analyses.</p>
<sec id="s2_7_1">
<label>2.7.1</label>
<title>Assessment of relative water and chlorophyll content</title>
<p>The third leaf of each plant (Control and transgenic) was used for analysis. To get relative water content (RWC), the fresh weight (FW) of leaves was taken. Afterward, the leaves were kept in water for 180 min. to obtain turgid weight (TW). The turgid leaves were then kept in the oven at 42&#xb0;C for 30h, and dry weight (DW) was taken. The RWC was calculated by the formula RWC (%) = [(FW-DW)/(TW-DW)] X 100.</p>
<p>To calculate the amount of chlorophyll a and b, 100 mg of powder (crushed leaves in liq. N<sub>2</sub>) were kept overnight at 4&#xb0;C in 10 ml of 80% acetone. The next day, samples of drought stress were centrifuged at 5000rpm, 4&#xb0;C for 15 min. Then the supernatant was collected, and absorbance was checked at A<sub>663</sub> and A<sub>645</sub>nm by using a spectrophotometer (Multiskan&#x2122; Go, Thermo Scientific) to measure chlorophylls as described by <xref ref-type="bibr" rid="B5">Arnon (1949)</xref>.</p>
</sec>
<sec id="s2_7_2">
<label>2.7.2</label>
<title>Quantification of reactive oxygen species production</title>
<p>The severity of stress in treated and non-treated plants can be achieved by calculating the hydrogen peroxide production rate assay. To perform 100mg of leaf samples grounded in 0.1% Tri-chloroacetic acid (TCA) followed by centrifugation at 12000rpm, 20 min., 4&#xb0;C. Further, a mixture of 400 &#xb5;l supernatant, 400 &#xb5;l of 10mM phosphate buffer (pH -7.2), and 800 &#xb5;l of Potassium iodide was used to estimate absorbance at 390nm and compared with the standard curve of H<sub>2</sub>O<sub>2</sub> (<xref ref-type="bibr" rid="B69">Singh et&#xa0;al., 2021</xref>). Moreover, hydrogen peroxide and superoxide were visualized on tested leaves by using 1mg/ml solution of 3, 3&#x2019;-Diaminobenzidine (DAB) (pH-3.8) and nitro blue tetrazolium (NBT), respectively. Leaves in both solutions were kept overnight in light, and stained leaves were washed 3-4 times with 70% ethanol to remove chlorophyll content. Observe brown and blue spots in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref> that appear due to the production of H<sub>2</sub>O<sub>2</sub> and O<sub>2</sub>
<sup>-</sup> respectively. Further, data were correlated with literature to evaluate drought tolerance rate in transgenic plants compared to control.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Evaluation of ROS production in transgenic plants under drought stress <bold>(A-D)</bold> NBT stained wild-type patchouli leaves, indicating as the severity of dehydration stress has increased from 15-8% of soil moisture in pots; blue dots increased which represent amplified superoxide, as compared to <bold>(A1-D1)</bold> transgenic <italic>P. cablin</italic> leaves <bold>(E-H)</bold> DAB-stained leaves showed with increasing drought stress accumulation of H<sub>2</sub>O<sub>2</sub> (brown spots) has enhanced in wild type as compared to <bold>(E1-H1)</bold> transgenic patchouli leaves.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g005.tif"/>
</fig>
</sec>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Data analysis</title>
<p>All experiments were carried out in three biological replicates, and data were shown as mean &#xb1; S.D. Statistical studies were conducted using one-way ANOVA to analyze significant differences between means using IBM SPSS statistics 29.0 (SPSS Inc. USA). The one-way variance was performed using Duncan&#x2019;s multiple range test at a significant value of p&lt;0.05 (<xref ref-type="bibr" rid="B16">Duncan, 1955</xref>).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Establishment of Direct regeneration system from petiole explants</title>
<p>In the present research leaf, petiole, and tTCL were used as explants for direct regeneration (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>) and compared for regenerative potential under various growth regulator treatments (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). Different plant growth regulators (BAP and NAA) were used to supplement the MS medium for optimization of regeneration frequency in <italic>Pogostemon cablin</italic>. As per the data analysis, the increment in BAP concentrations from 0.1 to 1.0 mg/L showed that no. of shoots were gradually increasing. Subsequently, the role of NAA in different combinations with BAP was analyzed, and it is concluded that the addition of NAA increased no. of shoots per explant to 0.1 mg/L, further enhancement of NAA, leading to callus formation. <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref> shows that maximum regeneration frequency was 88.30 &#xb1; 1.12%, 93.30 &#xb1; 0.56% per explant acquired from petiole and leaf, respectively, on MS medium supplemented with 0.2 mg/L BAP and 0.1 mg/L NAA without callus (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1E, F</bold>
</xref>). A comparative study revealed that the best direct shoot organogenesis observed from leaf explants which were 93.30 &#xb1; 0.56%. As per <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1G</bold>
</xref> regenerated shoots with 6-8 leaves were shifted on a half-strength MS medium for root induction. Further rooted plantlets were shifted to pots containing a mixture of soil: vermicompost (3:1) for acclimatization in greenhouse conditions, showing a survival frequency of 66.0 &#xb1; 0.6% (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>).</p>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Histological analysis of tTCL</title>
<p>The microanatomy information of transverse thin cell layer section of different stages (0, 5, 10, and 15 days) showed that as the cells move from initial to 5 days, cell size gradually changes from meristematic cells, different from nearby cells. Regeneration of cells was visualized at 10 days of inoculation from vascular cells, and subsequently, shoot buds were visualized at 15 days of inoculation (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6B, C</bold>
</xref>) as compared to the initial stage of the tTCL section (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). As per analysis optimum regeneration was faster (15-20 days) than conventional explants (25-35 days). Further, multiple shoot meristem were developed into <italic>in-vitro</italic> plants.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Microanatomy of <italic>P. cablin</italic>, tTCL internodal section and its direct regeneration at different stages on regeneration medium. <bold>(A-D)</bold> Microscopic view of tTCL section at different stages (0, 10, 15, and dead cells) of direct regeneration. <bold>(A0-D0)</bold> Scanning electron microscopic view of tTCL section of above mention stages. <bold>(A1-D1)</bold> SEM of the initially induced organogenesis with different time intervals (0, 10, 15 days - A1, B1, and C1 respectively) at 61x magnification and D1 showed dead cells at the same magnification. <bold>(A2&#x2013;D2)</bold> Different developmental stages of emerging multiple shoot buds at 174x magnification.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g006.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Optimization of Kanamycin concentration for selection of putative transformants</title>
<p>Obtained data were analyzed based on inhibition of regeneration frequency, shoot number, and necrosis of shoot to optimize kanamycin concentration. Explants inoculated on a regeneration medium containing 5mg/L antibiotic dose showed maximum regeneration frequency (91.0 &#xb1; 0.05%) whereas, further increments in antibiotic concentration gradually decreased the regeneration. At 30mg/L, no regeneration from the explant was obtained (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>) whereas at 25mg/L few shoots buds were regenerated and most of them were gradually bleached after 3-4 weeks on the selection medium. Above 30mg/L, kanamycin indicated inhibition of shoot regeneration. These observations concluded that 30mg/L kanamycin concentration was optimum for selecting putatively transformed patchouli shoots on regeneration medium.</p>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Evaluation of <italic>Agrobacterium tumefaciens</italic> optical density and infection time on transformation</title>
<p>The efficacy of bacterial OD was checked at various OD ranges (0.2-1.2) to get maximum transformation frequency. With the increase in (OD<sub>600</sub>) from 0.2 to 0.6, the efficacy of transient GUS expression was enhanced from 10.6 &#xb1; 0.8% to 88.3 &#xb1; 0.8% (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>) with fewer brownish explants. Earlier reports convey similar results where optimal transformation frequency was achieved from cell density 0.6-0.8 (<xref ref-type="bibr" rid="B53">Ribas et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B68">Singh et&#xa0;al., 2017</xref>). Further increment in optical cell density till 1.0 showed a decline in transient GUS expression, which indicate a decrease in transformation frequency (14.0 &#xb1; 1.0%) and 83.0 &#xb1; 0.1% explants turned brown.</p>
<p>The effect of infection time with <italic>Agrobacterium</italic> is another essential factor in the transformation efficiency. Hence, a range of time periods of 5-25 min. was assessed. As the time period increased from 0 to 5 minutes, transient GUS expression was increased and reached its maximum at 5 min. of incubation 61.3 &#xb1; 0.7%, as presented in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>. However, continuous increment in infection time leads to a decline in transformation frequency 5.6 &#xb1; 0.6% at 20 min. (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). Earlier, <xref ref-type="bibr" rid="B46">Paul et&#xa0;al. (2012)</xref> analyzed that longer infection time can reduce transient GUS expression due to the death of explants.</p>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Impact of acetosyringone concentration on transformation frequency</title>
<p>To enhance <italic>Agrobacterium-</italic>mediated transformation frequency, various acetosyringone (AS) concentration of 50&#xb5;M-300&#xb5;M was used in an <italic>Agrobacterium</italic> co-cultivation medium with pricking as an injury making explants more susceptible to infection. After a few days of infection, transient GUS expression of explants was analyzed that showed a gradual increment from 41.3 &#xb1; 0.5 to 89.3 &#xb1; 0.9 on the addition of AS from 50&#xb5;M to 200&#xb5;M respectively. As acetosyringone concentration was increased further from 200&#xb5;M to 300&#xb5;M, transient GUS expression declined to 30.3 &#xb1; 0.7 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). This result concluded that 200&#xb5;M AS concentration is best for achieving maximum transformation frequency in <italic>P. cablin.</italic>
</p>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Regeneration and development of putative transformed explant</title>
<p>Transformation with <italic>Agrobacterium</italic> strain vector containing <italic>ACC deaminase</italic> and control was performed as per standardized protocol. Further, Putative transformed explants were inoculated after co-cultivation on regeneration media with optimized 30mg/L kanamycin and 250mg/L cefotaxime concentration for regeneration and allowed to regenerate for 25-35 days. Leaf and petiole explants took 25-35 days to regenerate, whereas tTCL explants took only 15-20 days (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A&#x2013;E</bold>
</xref>). Regeneration frequency was 46.10 &#xb1; 0.35% onto regeneration medium supplemented with kanamycin. Subsequently, regenerated shoots were subcultured five times to remove the chimera. Putative transformed shoots were placed onto root induction media supplemented with kanamycin for approximately 8-10 weeks to get rooted plants and shifted to the greenhouse for hardening and acclimatization (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3F&#x2013;I</bold>
</xref>). During the hardening procedure survival rate of healthy rooted plants was 52.0 &#xb1; 0.8%.</p>
</sec>
<sec id="s3_7">
<label>3.7</label>
<title>GUS assay</title>
<p>Transient GUS Expression was analyzed after 5-6 days of infected explants, i.e., optimized infection time 15 min, co-cultivation, AS concentration 200&#xb5;M, and OD<sub>600</sub> 0.5. GUS positive putative transformed explants were showing blue color. Moreover, stable <italic>gusA</italic> expression was also analyzed for transformed and non-transformed plants under the microscope after 8- 10 weeks. As illustrated in <xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3J&#x2013;M</bold>
</xref>, leaves and petioles were blue.</p>
</sec>
<sec id="s3_8">
<label>3.8</label>
<title>Molecular Analysis of Transformed <italic>Pogostemon cablin</italic> Plants</title>
<sec id="s3_8_1">
<label>3.8.1</label>
<title>PCR and RT-PCR amplification</title>
<p>The selection marker <italic>nptII</italic> gene-specific PCR product was analyzed through gel electrophoresis that showed the presence of the expected size of a single band (500bp) in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>. Further, a few healthy lines were analyzed for <italic>ACC deaminase</italic> gene integration into the genome of patchouli. The PCR products confirmed the integration of &#x2018;<italic>ACCD</italic>&#x2019; (1017bp) in the above-mentioned line as presented in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>. Genomic DNA of wild-type patchouli plant was used as a negative control, and vector construct was used as the positive control. Quantitative PCR analysis showed actin and ACC deaminase gene transcripts in four of the PCR-confirmed transformed plants. Moreover, <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7C</bold>
</xref> showed that line T4 has maximum relative expression.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Molecular analysis of transformed <italic>P. cablin</italic> plants. <bold>(A)</bold> Genomic DNA was used to verify the presence of selection marker <italic>nptII</italic> gene (500bp PCR product, LD- 1kb+ ladder; - Ve &#x2013;negative control; +Ve &#x2013;positive control; N1-N12 are <italic>nptII</italic> positive transgenic lines). <bold>(B)</bold> Healthy transgenic lines were screened for <italic>ACC deaminase</italic> gene-specific PCR amplification to obtain 1017bp product on 1% agarose gel (LD- 1kb+ ladder; -Ve &#x2013;negative control; +Ve &#x2013;positive control; T1-T8 are <italic>ACC deaminase</italic> +ve transgenic lines). <bold>(C)</bold> RT-PCR analysis for relative expression of <italic>ACC deaminase</italic> gene in different transgenic <italic>P. cablin</italic> lines and <italic>actin</italic> gene was used for normalization of the template (WT- Wild type; VC- Vector control; PT- Patchouli transgenic lines). The bars indicate mean &#xb1; SD.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s3_9">
<label>3.9</label>
<title>Homology modeling and docking validation</title>
<p>Successful <italic>in-vitro</italic> results were worth performing homology modeling and molecular docking studies. The 3D model of the target enzyme was prepared in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>, using SWISS-MODEL, by considering the best match &#x2018;1f2d&#x2019; as a template (<xref ref-type="bibr" rid="B65">Schwede et&#xa0;al., 2003</xref>). The model protein was validated using different online servers, and quality was evaluated by Ramachandran plot of <italic>ACC deaminase</italic> (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>) showed 94.6% (539) of amino acid residues resided in the most favorable region. The residue falling in generously favourable regions was 4.9% (28), and no residues 0.0% (0) were in additional favour, while only 0.5% (3) of residues were in unfavourable regions. As per <xref ref-type="bibr" rid="B36">Lovell (2003)</xref>, these data were expected statistics. Afterward, the validated protein model was considered to carry out the docking procedure using the Autodock tool. Multiple docking poses were analyzed for optimal ligand-receptor complex, indicating the best scoring and lowest binding energy to get maximum binding affinity. Further best confirmation was used to visualize in discovery studio, and PyMOL for ligand interaction showed four hydrogen bonds between ACC and surrounding amino acids (Cys-196, Val-198, Thr-199, and Gly-200), indicating high binding affinity with receptor shown in <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C&#x2013;F</bold>
</xref>.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>The 3D crystal structure of ACC deaminase was validated by using the online server PROCHECK. According to the Ramachandran plot, only 0.5% of residues fall in the disallowed region and 99.5% of residues come under the allowed region.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g008.tif"/>
</fig>
</sec>
<sec id="s3_10">
<label>3.10</label>
<title>
<italic>PcACC deaminase</italic> heterologous expression enhanced drought stress tolerance</title>
<sec id="s3_10_1">
<label>3.10.1</label>
<title>Estimation of RWC and Chlorophyll content in transgenic lines</title>
<p>RWC is an indicator of plant water retention capacity; therefore, it works as an experiment to analyze drought stress tolerance (<xref ref-type="bibr" rid="B43">Naing et&#xa0;al., 2021</xref>). On the day 21 of the experiment, the RWC of pots having 15% soil moisture was 83.5 &#xb1; 0.4% in control and 84.9 &#xb1; 1.4% in transgenic one as compared to pots having 12% soil moisture (65.4 &#xb1; 2.3% control and 76.6 &#xb1; 3.8% Transgenic line). Whereas, transgenic plants had better RWC than control plants in modestly watered stress conditions. The pots containing only 8% soil moisture had an RWC of 71.7 &#xb1; 2.3% to 75.7 &#xb1; 2.1%, more significant than the RWC of the control plant, 58.30 &#xb1; 0.21% at severe stress conditions (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>).</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Validation of enhanced drought stress tolerance in transgenic patchouli plants, <bold>(A)</bold> at day 21 of the experiment, pots with only 8% soil moisture retained RWC 71.7 &#xb1; 2.3% to 75.7 &#xb1; 2.1% which is higher as compared to the RWC of control 58.3 &#xb1; 0.21%. <bold>(B)</bold> With the increase in water scarcity, the total chlorophyll content of control dropped to ~ 2.3 fold, although the transgenic line showed ~1.6 fold decrease as compared to the control. <bold>(C)</bold> WT showed a higher accumulation of H<sub>2</sub>O<sub>2</sub> ~6.6 fold than transgenic plants ~5 fold. All experiments were performed in three biological replicates. Bars showed mean &#xb1; SD, statistical analysis was carried out using one-way ANOVA using Duncan&#x2019;s multiple range test at a significance value of p&lt;0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1238838-g009.tif"/>
</fig>
<p>Chlorophyll, a photosynthetic pigment has a significant role in the absorption of light energy during photosynthesis; therefore, any variation in chlorophyll content due to stress leads to a change in the photosynthetic system of plants. Under drought stress, the total chlorophyll content of control and transgenic lines showed a ~1.5-fold decrease in 12% soil moisture condition as compared to sufficient water treatment (used as control) in <xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>. As the severity of drought increased (8% soil moisture) chlorophyll content lessened to ~2.14-fold in wild type as compared to wild control plants. In contrast, the transgenic line showed a ~1.67-fold decrement in chlorophyll content as correlated to transgenic control. (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>). The finding evaluates, <italic>P. cablin</italic> transgenic plants have ~1.32-fold higher chlorophyll content in contrast to wild type to combat the drought stress under severe stress conditions.</p>
</sec>
<sec id="s3_10_2">
<label>3.10.2</label>
<title>Estimation of ROS (H<sub>2</sub>O<sub>2</sub> and O<sub>2</sub>
<sup>-</sup>) production under dehydration treatment</title>
<p>Analysis of H<sub>2</sub>O<sub>2</sub> storage in plants was observed and found that as scarcity of water increases, ROS concentration elevated to ~6.6 fold in control and ~5 fold in transgenic lines as compared to well-watered plants (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9C</bold>
</xref>). DAB, used for histochemical investigation of <italic>P. cablin</italic> leaves revealed that <italic>ACC deaminase</italic> expressing transgenic lines were showing less amplified brown spots as compared to wild type under severe stress (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5E&#x2013;H, E1&#x2013;H1</bold>
</xref>). Another ROS (O<sub>2</sub>
<sup>-</sup>) accumulation was detected by NBT solution by observing various ranges of blue spots based on soil moisture content in both wild and transgenic plants (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A-D, A1-D1</bold>
</xref>). The result showed that transgenic lines expressing heterologous genes generate less O<sub>2</sub> than the wild type, which combines with NBT and produces insoluble blue formazan.</p>
</sec>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>The commercial demand for patchouli has been increasing due to its tremendous aromatic and medicinal properties. However, the supply of patchouli oil, to meet this global demand, is mainly provided by Indonesia, which massively cultivates versatile patchouli varieties. <italic>P. cablin</italic> cultivars face drought stress while maintaining healthy patchouli plants, which limits its propagation rate. In this study, a transgenic patchouli drought-resistant variety has been developed that keeps the promise of maintaining propagation rate and yield under drought stress. For the development of transgenic plants an efficient and quick regeneration system was required hence a comprehensive analysis on the basis of culture media, explants, and the effect of different phytohormones was performed (<xref ref-type="bibr" rid="B60">Roychowdhury and Tah, 2011</xref>; <xref ref-type="bibr" rid="B59">Roychowdhury et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B52">Reddy et&#xa0;al., 2013</xref>). During this study plant growth hormone was optimized for better regeneration and explants were compared to achieve a higher multiplication rate under sterile conditions. In our findings, maximum direct shoot organogenesis was obtained from leaf explants on MS medium supplemented with 0.2 mg/L BAP and 0.1 mg/L NAA without callus (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1E, F</bold>
</xref>). As per the literature, <italic>P. cablin is</italic> commonly propagated through leaf discs like most herbaceous plants (<xref ref-type="bibr" rid="B47">Paul et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B79">Swamy and Sinniah, 2016</xref>). An analysis of previously documented studies, MS medium supplemented with BAP showed considerable efficacy in shoot regeneration but much less than meta-topolin (<xref ref-type="bibr" rid="B30">Lalthafamkimi et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B29">Kumaraswamy and Anuradha, 2010</xref>; <xref ref-type="bibr" rid="B28">Kukreja et&#xa0;al., 1990</xref>; <xref ref-type="bibr" rid="B25">Jin et&#xa0;al., 2014</xref>). <xref ref-type="bibr" rid="B77">Sun et&#xa0;al. (2009)</xref> have also reported that cytokinins are known for shoot organogenesis. However, <xref ref-type="bibr" rid="B63">Sales and Butardo (2014)</xref> revealed that PGRs BAP and NAA are significant causes of clonal variability among micro-propagated plants. The presence of NAA combination with BAP in MS medium has been reported to improve shoot induction frequency from petiole explant in <italic>Pelargonium graveolens</italic> (<xref ref-type="bibr" rid="B68">Singh et&#xa0;al., 2017</xref>) and <italic>Mentha piperita</italic> (<xref ref-type="bibr" rid="B64">Sarwar et&#xa0;al., 2009</xref>).</p>
<p>
<xref ref-type="bibr" rid="B84">Van (1973)</xref> has introduced the thin cell layer (TCL) technique which is an economical, rapid, and thoroughly reproducible <italic>in-vitro</italic> propagation method for the up-scale production of genetically stable plants. The recent study is the first contribution to support <italic>in vitro</italic> multiplication of <italic>P. cablin</italic> using tTCL explants. The histological analysis of direct shoot regeneration using tTCL was validated to hold the strategy of rapid propagation (15-20 days) as compared to other explants (25-35 days) on a more suitable MS medium supplemented with 0.2 mg/L BAP and 0.1 mg/L NAA (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6B, C</bold>
</xref>) and half-strength MS medium was found to be efficient for rooting. Previously, as per <xref ref-type="bibr" rid="B82">Tripathi et&#xa0;al. (2018)</xref> report, it was observed that vascular zone cells have a high tendency to generate new shoot buds and the regeneration capacity of explants depends on nutrient transport across media to tTCL, which has more exposed cells on media as compared to conventional large-size explants. Similar studies have also been reported in <italic>Talinum triangulare</italic>, <italic>Bacteris gasipaes</italic>, and <italic>Dendrobium candidum</italic> (<xref ref-type="bibr" rid="B73">Steinmacher et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B89">Zhao et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B80">Swarna and Ravindhran, 2013</xref>). According to the literature, TCL explants have a more significant reproducing tendency than conventional explants (<xref ref-type="bibr" rid="B14">Da Silva and Dobr&#xe1;nszki, 2015</xref>). Moreover, <xref ref-type="bibr" rid="B51">Raomai et&#xa0;al. (2015)</xref> observed that the developed rhizomes of endangered <italic>Paris polyphylla</italic> using tTCL basal stem explant showed significant enhancement of secondary metabolite production and mass propagation system.</p>
<p>Recent advancement in R&amp;D technologies provides insight into microbial-plant interactions that help us to enhance crop yield and quality through vast biotechnological approaches such as genetic manipulation (<xref ref-type="bibr" rid="B37">Mamgain et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B58">Roychowdhury et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B27">Khan et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B45">Pathak et&#xa0;al., 2022</xref>). In a drought state, the plant produces stress ethylene that causes various physiological and metabolic damages in plants (<xref ref-type="bibr" rid="B88">Zhang et&#xa0;al., 2018</xref>). Literature confirmed that <italic>ACC deaminase</italic> has the capacity to reduce stress ethylene levels under abiotic stresses (<xref ref-type="bibr" rid="B48">Penrose and Glick, 2003</xref>) by degrading ACC into &#x3b1;-ketobutyrate and ammonia (<xref ref-type="bibr" rid="B34">Li et&#xa0;al., 2019</xref>). Generally, for the production of putative transgenic <italic>P. cablin</italic> plants having <italic>ACC deaminase</italic> gene, <italic>Agrobacterium-</italic>mediated genetic transformation protocol establishment is required for the highest transformation frequency. The present study revealed OD<sub>600</sub> 0.6, AS 200&#xb5;M, 30mg/L kanamycin, and an infection time of 5 min. is optimum to achieve the maximum transformation rate (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;D</bold>
</xref>). Kanamycin, used as a selection marker, has been well studied to optimize its concentration for versatile crops. Earlier <xref ref-type="bibr" rid="B46">Paul et&#xa0;al. (2012)</xref> has been reported a lower 20mg/L and <xref ref-type="bibr" rid="B75">Sugimura et&#xa0;al. (2005)</xref> reported a higher 100mg/L concentration of kanamycin for indirect regenerated putative transformed shoot selection.</p>
<p>Hence, the plant has innate natural resistance against kanamycin; therefore, sensitivity towards kanamycin varies among plant tissues and species of plants (<xref ref-type="bibr" rid="B13">Colby and Meredith, 1990</xref>). In literature, other parameters such as bacterial optical density and infection time were studied for optimum heterologous transgene expression. <xref ref-type="bibr" rid="B17">Dutt and Grosser (2009)</xref> recommended maximum transformation frequency on lower optical cell density. Moreover, several studies have also suggested that higher OD<sub>600</sub> values reduce transformation frequency (<xref ref-type="bibr" rid="B62">Saini and Jaiwal, 2007</xref>). In addition, similar studies were shown better transformation frequency in less than 30 min. in other plants (<xref ref-type="bibr" rid="B26">Khan et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B7">Benazir et&#xa0;al., 2013</xref>), unlike (<xref ref-type="bibr" rid="B19">Gupta and Rahman, 2015</xref>; <xref ref-type="bibr" rid="B68">Singh et&#xa0;al., 2017</xref>). From these observations, we can conclude that variation in infection time to get maximum transformation frequency depends on tissues, species, and plants.</p>
<p>
<xref ref-type="bibr" rid="B72">Stachel et&#xa0;al. (1985)</xref>, reported that AS is a potent phenolic signaling molecule that is generally secreted by wounded plant tissues and helps in the transfer of T-DNA from Ti- plasmid by inducing a signaling cascade of all <italic>Vir</italic> genes after binding to the <italic>VirA</italic> protein of bacterial cell. Though every plant has less than the threshold value of endogenous phenolic molecules for efficient transformation, the external addition of AS in the co-cultivation medium fulfills the demand for signaling molecules to obtain optimum transformation frequency. Our study reported 200&#xb5;M AS limit was best suited for transgenic development whereas in other reports 150&#xb5;M of AS is optimum for patchouli leaf transformation (<xref ref-type="bibr" rid="B46">Paul et&#xa0;al., 2012</xref>), Adverse effect on transformation frequency of plants has also been reported in other species with an increment of AS concentration (<xref ref-type="bibr" rid="B74">Subramanyam et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B68">Singh et&#xa0;al., 2017</xref>). The study showed optimized transformation protocol was able to produce putative transgenic patchouli plants harboring the <italic>ACC deaminse</italic> gene with durability 52.0 &#xb1; 0.8% (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3I</bold>
</xref>) after hardening and acclimatization. The putatively transformed CIM-Samarth lines were screened at first by PCR for the existence of transgene and selection marker (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A, B</bold>
</xref>). Similar studies have also been reported in <italic>Ocimum gratissimum</italic>, <italic>Tagetes erecta</italic>, and <italic>Pelargonium graveolens</italic> (<xref ref-type="bibr" rid="B19">Gupta and Rahman, 2015</xref>; <xref ref-type="bibr" rid="B26">Khan et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B68">Singh et&#xa0;al., 2017</xref>). In this research, (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7C</bold>
</xref>) signifies that PT4 showed a high relative expression of <italic>ACC deaminase</italic> transgene among other best-propagating transgenic lines. The variation in transgene expression among transgenic lines could be due to the constitutive CaMV 35S promoter activity influenced by several regulatory systems (<xref ref-type="bibr" rid="B8">Benfey and Chua, 1990</xref>).</p>
<p>Sustainable results were significant in building a homology model of our target gene and checking <italic>in silico</italic> docking affinity of ligand ACC with receptor <italic>ACC deaminase.</italic> We found that the Ramachandran plot of the model (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>) showed 94.6% (539) of amino acid residues fell in the most favorable region. Similar data that validate the build model have also been mentioned by <xref ref-type="bibr" rid="B49">Pramanik et&#xa0;al. (2017)</xref>. The best conformation of our docking result revealed four H-bonds between ACC and surrounding amino acids Cys-196, Val-198, Thr-199, and Gly-200 of the receptor (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C-F</bold>
</xref>) These studies were equivalent to other literature (<xref ref-type="bibr" rid="B85">Vijesh et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B23">Jasim et&#xa0;al., 2015</xref>). Additionally, as per <xref ref-type="bibr" rid="B66">Singh and Kashyap et&#xa0;al. (2012)</xref>, few other amino acids that are conserved in other ACC deaminase sequences interact with ACC.</p>
<p>In this investigation, we have created a severe drought stress experiment where our best transgenic patchouli line PT4 confirmed by different molecular analyses was able to survive without compromising other physiological parameters such as RWC, chlorophyll content, and ROS production (<xref ref-type="fig" rid="f9">
<bold>Figures&#xa0;9</bold>
</xref>, <xref ref-type="fig" rid="f5">
<bold>5</bold>
</xref>). This result correlates with previous reports indicating that under-stress plants develop mechanisms to maintain water retention and transpiration rate ratio (<xref ref-type="bibr" rid="B38">Merah, 2001</xref>; <xref ref-type="bibr" rid="B71">Soltys-Kalina et&#xa0;al., 2016</xref>). Our study mentioned ~75% of RWC in the transgenic line as opposed to to the control plant&#x2019;s ~58% in severe stress conditions. However, an earlier study of <italic>Pelargonium graveolens</italic> RWC of transgenic was 88% in severe stress (<xref ref-type="bibr" rid="B69">Singh et&#xa0;al., 2021</xref>). Additionally it has been analyzed that the result depends on various properties of plants such as plant age, species, growth condition, and pot size. Elevated RWC in transgenic lines after severe watered stress over control plants becomes significant in drought conditions. Chlorophyll, a photosynthetic pigment, has a significant role in photosynthesis therefore variation in chlorophyll content may damage the plant photosystem. In our result, chlorophyll content decreased to ~2.3 fold in WT compared to transgenic plants that showed a ~1.6 fold decrease. This denotes that suitable transgenic lines can deal with drought stress without hampering the photosynthetic system. Similar strategies by <xref ref-type="bibr" rid="B1">Afridi et&#xa0;al. (2019)</xref>; <xref ref-type="bibr" rid="B20">Han et&#xa0;al. (2017)</xref>, and <xref ref-type="bibr" rid="B6">Bahieldin et&#xa0;al. (2005)</xref> have also suggested the same relationship between chlorophyll content and the rate of photosynthesis. Literature surveys suggest, during various biochemical reactions, the ROS produced in different organelles has an important role in growth, development, and function as a defense system in abiotic stress. Moreover, if excess ROS cannot detoxify by antioxidants, it leads to oxidative stress (<xref ref-type="bibr" rid="B4">Apel and Hirt, 2004</xref>; <xref ref-type="bibr" rid="B83">Tripathy and Oelm&#xfc;ller, 2012</xref>), which causes versatile cellular damage and may even cause the death of the plant. In our finding, DAB and NBT histochemical analysis of transgenic <italic>P. cablin</italic> leaves were showing less magnified brown and blue spots respectively compared to WT under severe stress conditions (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>) That indicated less ROS (H<sub>2</sub>O<sub>2</sub>, O<sub>2</sub>
<sup>-</sup>) production in transgenic plants expressing <italic>ACC deaminase</italic> gene. Similar research has also been reported on <italic>Petunia hybrida</italic> and <italic>Pelargonium graveolens</italic> (<xref ref-type="bibr" rid="B69">Singh et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B42">Naing et&#xa0;al., 2022</xref>).</p>
</sec>
<sec id="s5" sec-type="conclusion">
<label>5</label>
<title>Conclusion</title>
<p>Our research is novel in establishing an efficient direct regeneration and genetic transformation protocol using tTCL in only 15-20 days, which effectively enhances <italic>Agrobacterium</italic>-mediated genetic transformation frequency in <italic>Pogostemon cablin</italic>. tTCL sections regenerated faster than leaf and petiole explants, which improves micropropagation by reducing transgenic development time. The comprehensive study is the first report of <italic>ACC deaminase</italic> integration into the genome for developing transgenic patchouli to deal with drought stress, one of the significant problems in the propagation of aromatic plant &#x2018;patchouli&#x2019;. There is no report on the physiological parameters RWC, H<sub>2</sub>O<sub>2</sub>, and chlorophyll content of transgenic patchouli to support improved drought tolerance than wild-type plants. In our work, an <italic>in-silico</italic> study revealed better ligand interaction with the active site amino acid of the receptor. The regeneration and transformation protocol provides a platform for reverse genetics and helps in the modulation of metabolic pathways to enhance secondary metabolites and PO yield. Furthermore, the heterologous expression of <italic>ACC deaminase</italic> will support the management of PO global demand and develop a superior drought-tolerant variety of <italic>P. cablin</italic> plants.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>ZW: Conceptualisation, Methodology, Visualization, Investigation, Data curation, Formal analysis, Writing-original draft, Writing- review &amp; editing, Insilico data analysis, Validation. KK: Writing-review &amp; editing, Formal analysis, Methodology, Insilico data analysis, conceptualisation, Validation. PS: review &amp; editing, SEM analysis, provide ACC deaminase construct. LR: Conceptualisation, Investigation, Methodology, Supervision, Writing and editing. All authors contributed to the article and approved the submitted version</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>ZW is also thankful to CSIR Project Aroma Mission (HCP-0007) for financial support.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors are deeply grateful to Director CSIR-CIMAP, Lucknow, India for providing the scientific platform to carry out all the experiments.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Afridi</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Mahmood</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Salam</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mukhtar</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Mehmood</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Induction of tolerance to salinity in wheat genotypes by plant growth promoting endophytes: Involvement of ACC deaminase and antioxidant enzymes</article-title>. <source>Plant Physiol. Biochem.</source> <volume>139</volume>, <fpage>569</fpage>&#x2013;<lpage>577</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plaphy.2019.03.041</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Afroz</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Warsi</surname> <given-names>Z. I.</given-names>
</name>
<name>
<surname>Khatoon</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Sangwan</surname> <given-names>N. S.</given-names>
</name>
<name>
<surname>Khan</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Rahman</surname> <given-names>L. U.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Molecular cloning and characterization of triterpenoid biosynthetic pathway gene HMGS in <italic>Centella asiatica</italic> (Linn.)</article-title>. <source>Mol. Biol. Rep.</source> <volume>49</volume> (<issue>6</issue>), <fpage>4555</fpage>&#x2013;<lpage>4563</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11033-022-07300-9</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anumalla</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Geda</surname> <given-names>C. K.</given-names>
</name>
<name>
<surname>Bharathkumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Goutam</surname> <given-names>K. D.</given-names>
</name>
<name>
<surname>Mohandev</surname> <given-names>T. S. S.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Mechanism of stress signal transduction and involvement of stress inducible transcription factors and genes in response to abiotic stresses in plant</article-title>. <source>Int. J. Recent Sci. Res.</source> <volume>7</volume> (<issue>8</issue>), <fpage>12754</fpage>&#x2013;<lpage>12771</lpage>.</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Apel</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Hirt</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Reactive oxygen species: metabolism, oxidative stress, and signal transduction</article-title>. <source>Annu. Rev. Plant Biol.</source> <volume>55</volume>, <fpage>373</fpage>&#x2013;<lpage>399</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.arplant.55.031903.141701</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arnon</surname> <given-names>D. I.</given-names>
</name>
</person-group> (<year>1949</year>). <article-title>Copper enzymes in isolated chloroplasts. Polyphenoloxidase in <italic>Beta vulgaris</italic>
</article-title>. <source>Plant Physiol.</source> <volume>24</volume> (<issue>1</issue>), <elocation-id>1</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/2Fpp.24.1.1</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bahieldin</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mahfouz</surname> <given-names>H. T.</given-names>
</name>
<name>
<surname>Eissa</surname> <given-names>H. F.</given-names>
</name>
<name>
<surname>Saleh</surname> <given-names>O. M.</given-names>
</name>
<name>
<surname>Ramadan</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Ahmed</surname> <given-names>I. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Field evaluation of transgenic wheat plants stably expressing the HVA1 gene for drought tolerance</article-title>. <source>Physiol. Plant</source> <volume>123</volume> (<issue>4</issue>), <fpage>421</fpage>&#x2013;<lpage>427</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5897/JMPR09.046</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Benazir</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Suganthi</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Chandrika</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Mathithumilan</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>
<italic>In vitro</italic> Regeneration and transformation studies on pelargonium graveolens (geranium)-an important medicinal and aromatic plant</article-title>. <source>J. Med. Plant Res.</source> <volume>7</volume> (<issue>38</issue>), <fpage>2815</fpage>&#x2013;<lpage>2822</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5897/JMPR09.046</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Benfey</surname> <given-names>P. N.</given-names>
</name>
<name>
<surname>Chua</surname> <given-names>N. H.</given-names>
</name>
</person-group> (<year>1990</year>). <article-title>The cauliflower mosaic virus 35 S promoter: combinatorial regulation of transcription in plants</article-title>. <source>Science</source> <volume>250</volume> (<issue>4983</issue>), <fpage>959</fpage>&#x2013;<lpage>966</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.250.4983.959</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bhau</surname> <given-names>B. S.</given-names>
</name>
<name>
<surname>Borah</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Ahmed</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Phukon</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Gogoi</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Sarmah</surname> <given-names>D. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Influence of root-knot nematode infestation on antioxidant enzymes, chlorophyll content and growth in <italic>Pogostemon cablin</italic> (Blanco) Benth</article-title>. <source>Indian J. Exp. Biol.</source> <volume>54</volume>, <fpage>254</fpage>&#x2013;<lpage>261</lpage>.</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bunrathep</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lockwood</surname> <given-names>G. B.</given-names>
</name>
<name>
<surname>Songsak</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Ruangrungsi</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Chemical constituents from leaves and cell cultures of <italic>Pogostemon cablin</italic> and use of precursor feeding to improve patchouli alcohol level</article-title>. <source>ScienceAsia</source> <volume>32</volume>, <fpage>293</fpage>&#x2013;<lpage>296.293</lpage>. doi: <pub-id pub-id-type="doi">10.2306/scienceasia1513-1874.2006.32.293</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Chakraborty</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Pattanayak</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mandal</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Das</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2014</year>). &#x201c;<article-title>An overview of climate change: causes, trends and implications</article-title>,&#x201d; in <source>Crop improvement in the era of climate change</source> (<publisher-loc>New Delhi</publisher-loc>: <publisher-name>IK International Publishing House</publisher-name>), <fpage>1</fpage>&#x2013;<lpage>29</lpage>.</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Choudhri</surname> <given-names>H. P. S.</given-names>
</name>
<name>
<surname>Verma</surname> <given-names>D. K.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>R. S.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Export-import performance of patchouli oil in India: growth and instability analysis</article-title>. <source>Asian J. Agric. Ext. Economics Sociol.</source> <volume>41</volume> (<issue>9</issue>), <fpage>305</fpage>&#x2013;<lpage>311</lpage>. doi: <pub-id pub-id-type="doi">10.9734/ajaees/2023/v41i92046</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Colby</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Meredith</surname> <given-names>C. P.</given-names>
</name>
</person-group> (<year>1990</year>). <article-title>Kanamycin sensitivity of cultured tissues of <italic>Vitis</italic>
</article-title>. <source>Plant Cell Rep.</source> <volume>9</volume> (<issue>5</issue>), <fpage>237</fpage>&#x2013;<lpage>240</lpage>. doi: <pub-id pub-id-type="doi">10.1007/BF00232291</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Da Silva</surname> <given-names>J. A. T.</given-names>
</name>
<name>
<surname>Dobr&#xe1;nszki</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Plant thin cell layers: update and perspectives</article-title>. <source>Folia Hortic.</source> <volume>27</volume> (<issue>2</issue>), <fpage>183</fpage>&#x2013;<lpage>190</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1515/fhort-2015-0029</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>DeLano</surname> <given-names>W. L.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Pymol: An open-source molecular graphics tool. CCP4 Newsl</article-title>. <source>Protein Crystal.</source> <volume>40</volume> (<issue>1</issue>), <fpage>82</fpage>&#x2013;<lpage>92</lpage>.</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Duncan</surname> <given-names>D. B.</given-names>
</name>
</person-group> (<year>1955</year>). <article-title>Multiple range and multiple F-test</article-title>. <source>Biometrics</source> <volume>11</volume>, <fpage>1</fpage>&#x2013;<lpage>42</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2307/3001478</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dutt</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Grosser</surname> <given-names>J. W.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Evaluation of parameters affecting Agrobacterium- mediated transformation of citrus</article-title>. <source>Plant Cell Tissue Organ Cult.</source> <volume>98</volume> (<issue>3</issue>), <fpage>331</fpage>&#x2013;<lpage>340</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-009-9567-1</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Glick</surname> <given-names>B. R.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Bacteria with ACC deaminase can promote plant growth and help to feed the world</article-title>. <source>Microbiol. Res.</source> <volume>169</volume> (<issue>1</issue>), <fpage>30</fpage>&#x2013;<lpage>39</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.micres.2013.09.009</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gupta</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Rahman</surname> <given-names>L. U.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>An efficient plant regeneration and Agrobacterium- mediated genetic transformation of <italic>Tagetes erecta</italic>
</article-title>. <source>Protoplasma</source> <volume>252</volume>, <fpage>1061</fpage>&#x2013;<lpage>1070</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00709-014-0740-y</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Han</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ban</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>He</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Rao</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Overexpression of persimmon DkXTH1 enhanced tolerance to abiotic stress and delayed fruit softening in transgenic plants</article-title>. <source>Plant Cell Rep.</source> <volume>36</volume>, <fpage>583</fpage>&#x2013;<lpage>596</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00299-017-2105-4</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Han</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Biological characteristics and salt- tolerant plant growth-promoting effects of an ACC deaminase-producing <italic>Burkholderia pyrrocinia</italic> strain isolated from the tea rhizosphere</article-title>. <source>Arch. Microbiol.</source> <volume>203</volume>, <fpage>2279</fpage>&#x2013;<lpage>2290</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00203-021-02204-x</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Hasanuzzaman</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Karmakar</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Dey</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Nahar</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Fujita</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2015</year>). &#x201c;<article-title>Recent advances in biotechnology and genomic approaches for abiotic stress tolerance in crop plants</article-title>,&#x201d; in <source>Genomics and proteomics: concepts, technologies and applications</source> (<publisher-loc>Canada</publisher-loc>: <publisher-name>Apple Academic Press</publisher-name>), <fpage>333</fpage>&#x2013;<lpage>366</lpage>.</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jasim</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Anish</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Shimil</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Jyothis</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Radhakrishnan</surname> <given-names>E. K.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Studies on plant growth promoting properties of fruit-associated bacteria from <italic>Elettaria cardamomum</italic> and molecular analysis of ACC deaminase gene</article-title>. <source>Appl. Biochem. Biotechnol.</source> <volume>177</volume>, <fpage>175</fpage>&#x2013;<lpage>189</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12010-015-1736-6</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jefferson</surname> <given-names>A. R.</given-names>
</name>
</person-group> (<year>1987</year>). <article-title>Assaying chimeric genes in plants: the GUS gene fusion system</article-title>. <source>Plant Mol. Biol. Rep.</source> <volume>5</volume>, <fpage>387</fpage>&#x2013;<lpage>405</lpage>. doi: <pub-id pub-id-type="doi">10.1007/BF02667740</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>Z. C.</given-names>
</name>
<name>
<surname>He</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Effect of explant types and plant growth regulators on direct regeneration in medicinal plant <italic>Pogostemon cablin</italic>
</article-title>. <source>Plant Omics.</source> <volume>7</volume> (<issue>5</issue>), <fpage>322</fpage>&#x2013;<lpage>327</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3316/informit.725857211503385</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Fahim</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Rahman</surname> <given-names>L. U.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>
<italic>Agrobacterium tumefaciens</italic> mediated genetic transformation of <italic>Ocimum gratissimum</italic>: a medicinally important crop</article-title>. <source>Ind. Crops Prod.</source> <volume>71</volume>, <fpage>138</fpage>&#x2013;<lpage>146</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.indcrop.2015.03.080</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Mazid</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Khan</surname> <given-names>T. A.</given-names>
</name>
<name>
<surname>Patel</surname> <given-names>H. K.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Plant derived pesticides in control of lepidopteran insects: Dictum and directions</article-title>. <source>Res. J. Biol.</source> <volume>2</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>10</lpage>.</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kukreja</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Mathur</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Zaim</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>1990</year>). <article-title>Mass production of virus-free patchouli plants (<italic>Pogostemon cablin</italic> (Blanco) Benth. by in <italic>vitro</italic> culture</article-title>. <source>Trop. Agric.</source> <volume>67</volume> (<issue>2</issue>), <fpage>101</fpage>&#x2013;<lpage>104</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3329/ptcb.v20i1.5971</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumaraswamy</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Anuradha</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Micropropagation of pogostemon cablin benth. through direct regeneration for the production of true to type plants</article-title>. <source>Plant Tissue Cult. Biotechnol.</source> <volume>20</volume> (<issue>1</issue>), <fpage>81</fpage>&#x2013;<lpage>89</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3329/ptcb.v20i1.5971</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lalthafamkimi</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Bhattacharyya</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Bhau</surname> <given-names>B. S.</given-names>
</name>
<name>
<surname>Wann</surname> <given-names>S. B.</given-names>
</name>
<name>
<surname>Banik</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Direct organogenesis mediated improvised mass propagation of <italic>Pogostemon cablin</italic>: A natural reserve of pharmaceutical biomolecules</article-title>. <source>S. Afr. J. Bot.</source> <volume>140</volume>, <fpage>375</fpage>&#x2013;<lpage>384</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.sajb.2020.08.018</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Laskowski</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>MacArthur</surname> <given-names>M. W.</given-names>
</name>
<name>
<surname>Moss</surname> <given-names>D. S.</given-names>
</name>
<name>
<surname>Thornton</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>PROCHECK: a program to check the stereochemical quality of protein structures</article-title>. <source>J. Appl. Crystallogr.</source> <volume>26</volume> (<issue>2</issue>), <page-range>283&#x2013;291</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1107/S0021889892009944</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Govta</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Jaiwar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>Z. Z.</given-names>
</name>
<name>
<surname>Shams</surname> <given-names>I.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>a). <article-title>Intracellular reactive oxygen species-aided localized cell death contributing to immune responses against wheat powdery mildew pathogen</article-title>. <source>Phytopathology</source> <volume>5</volume> (<issue>113</issue>), <page-range>884&#x2013;892</page-range>. doi: <pub-id pub-id-type="doi">10.1101/2022.10.06.511165</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>Z. Z.</given-names>
</name>
<name>
<surname>Sela</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Govta</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Klymiuk</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>b). <article-title>Dissection of a rapidly evolving wheat resistance gene cluster by long-read genome sequencing accelerated the cloning of Pm69</article-title>. <source>Plant Commun</source>. doi: <pub-id pub-id-type="doi">10.1016/j.xplc.2023.100646</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Qiu</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>1-Aminocyclopropane-1-carboxylate: a novel and strong chemoattractant for the plant beneficial rhizobacterium <italic>Pseudomonas putida</italic> UW4. Mol</article-title>. <source>Plant-Microbe Interact.</source> <volume>32</volume> (<issue>6</issue>), <fpage>750</fpage>&#x2013;<lpage>759</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/MPMI-11-18-0317-R</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X. H.</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>D. S.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y. N.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y. T.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>4-nor-&#x3b2;-Patchoulene sesquiterpenoids from the essential oil of <italic>Pogostemon cablin</italic>
</article-title>. <source>Phytochem. Lett.</source> <volume>12</volume>, <fpage>27</fpage>&#x2013;<lpage>30</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.phytol.2015.02.016</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lovell</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Davis</surname> <given-names>I. W.</given-names>
</name>
<name>
<surname>Arendall</surname> <given-names>W. B.</given-names>
<suffix>III</suffix>
</name>
<name>
<surname>De Bakker</surname> <given-names>P. I.</given-names>
</name>
<name>
<surname>Word</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Prisant</surname> <given-names>M. G.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Structure validation by C&#x3b1; geometry: &#x3d5;, &#x3c8; and C&#x3b2; deviation</article-title>. <source>Proteins: Struct. Funct. Genet.</source> <volume>50</volume> (<issue>3</issue>), <fpage>437</fpage>&#x2013;<lpage>450</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/prot.1028</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mamgain</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Tah</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Alternaria pathogenicity and its strategic controls</article-title>. <source>Res. J. Biol.</source> <volume>1</volume>, <fpage>1</fpage>&#x2013;<lpage>9</lpage>.</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Merah</surname> <given-names>O.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Potential importance of water status traits for durum wheat improvement under Mediterranean conditions</article-title>. <source>J. Agric. Sci.</source> <volume>137</volume> (<issue>2</issue>), <fpage>139</fpage>&#x2013;<lpage>145</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S0021859601001253</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miyazawa</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Okuno</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>S. I.</given-names>
</name>
<name>
<surname>Kosaka</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Antimutagenic activity of flavonoids from <italic>Pogostemon cablin</italic>
</article-title>. <source>J. Agric. Food Chem.</source> <volume>48</volume> (<issue>3</issue>), <fpage>642</fpage>&#x2013;<lpage>647</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/jf990160y</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moon</surname> <given-names>Y. S.</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Possible mechanisms for the equilibrium of ACC and role of ACC deaminase-producing bacteria</article-title>. <source>Appl. Microbiol. Biotechnol.</source> <volume>106</volume> (<issue>3</issue>), <fpage>877</fpage>&#x2013;<lpage>887</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00253-022-11772-x</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Murashige</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Skoog</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>1962</year>). <article-title>A revised medium for rapid growth and bioassays with tobacco tissue cultures</article-title>. <source>Physiol. Plant</source> <volume>15</volume>, <fpage>473</fpage>&#x2013;<lpage>497</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1399-3054.1962.tb08052.x</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Naing</surname> <given-names>A. H.</given-names>
</name>
<name>
<surname>Campol</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Chung</surname> <given-names>M. Y.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>C. K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Overexpression of acdS in <italic>Petunia hybrida</italic> Improved Flower Longevity and Cadmium-Stress Tolerance by Reducing Ethylene Production in Floral and Vegetative Tissues</article-title>. <source>Cells</source> <volume>11</volume> (<issue>20</issue>), <elocation-id>3197</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cells11203197</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Naing</surname> <given-names>A. H.</given-names>
</name>
<name>
<surname>Maung</surname> <given-names>T. T.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>C. K.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>The ACC deaminase- producing plant growth- promoting bacteria: influences of bacterial strains and ACC deaminase activities in plant tolerance to abiotic stress</article-title>. <source>Physiol. Plant</source> <volume>173</volume> (<issue>4</issue>), <fpage>1992</fpage>&#x2013;<lpage>2012</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/ppl.13545</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pandey</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Bhandari</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Begum</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Munda</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Baruah</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Essential oil compositions, pharmacological importance and agro technological practices of Patchouli (<italic>Pogostemon cablin</italic> Benth.): A review</article-title>. <source>J. Essent. Oil-Bear.</source> <volume>24</volume> (<issue>6</issue>), <fpage>1212</fpage>&#x2013;<lpage>1226</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/0972060X.2021.1995511</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pathak</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Rai</surname> <given-names>V. K.</given-names>
</name>
<name>
<surname>Can</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Bhardwaj</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Plant-endophyte interaction during biotic stress management</article-title>. <source>Plants</source> <volume>11</volume> (<issue>17</issue>), <fpage>2203</fpage>. doi: <pub-id pub-id-type="doi">10.3390/plants11172203</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Paul</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Bakshi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sahoo</surname> <given-names>D. P.</given-names>
</name>
<name>
<surname>Kalita</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Sahoo</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Agrobacterium- mediated genetic transformation of <italic>Pogostemon cablin</italic> (Blanco) Benth. using leaf explants: bactericidal effect of leaf extracts and counteracting strategies</article-title>. <source>Appl. Biochem. Biotechnol.</source> <volume>166</volume> (<issue>8</issue>), <fpage>1871</fpage>&#x2013;<lpage>1895</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12010-012-9612-0</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Paul</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Thapa</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Basu</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mazumdar</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Kalita</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Sahoo</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Rapid plant regeneration, analysis of genetic fidelity and essential aromatic oil content of micropropagated plants of Patchouli, <italic>Pogostemon cablin</italic> (Blanco) Benth.&#x2013;An industrially important aromatic plant</article-title>. <source>Ind. Crops Prod.</source> <volume>32</volume> (<issue>3</issue>), <fpage>366</fpage>&#x2013;<lpage>374</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.indcrop.2010.05.020</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Penrose</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Glick</surname> <given-names>B. R.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Methods for isolating and characterizing ACC deaminase- containing plant growth- promoting rhizobacteria</article-title>. <source>Physiol. Plant</source> <volume>118</volume> (<issue>1</issue>), <fpage>10</fpage>&#x2013;<lpage>15</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1034/j.1399-3054.2003.00086.x</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pramanik</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Soren</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Mitra</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Maiti</surname> <given-names>T. K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>In silico structural and functional analysis of Mesorhizobium ACC deaminase</article-title>. <source>Comput. Biol. Chem.</source> <volume>68</volume>, <fpage>12</fpage>&#x2013;<lpage>21</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.compbiolchem.2017.02.005</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramya</surname> <given-names>H. G.</given-names>
</name>
<name>
<surname>Palanimuthu</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Rachna</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>An introduction to patchouli (<italic>Pogostemon cablin</italic> Benth.)&#x2013;A medicinal and aromatic plant: It&#x2019;s importance to mankind</article-title>. <source>Agric. Eng. Int.: CIGR J.</source> <volume>15</volume> (<issue>2</issue>), <fpage>243</fpage>&#x2013;<lpage>250</lpage>.</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raomai</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kumaria</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kehie</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tandon</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Plantlet regeneration of <italic>Paris polyphylla</italic> Sm. via thin cell layer culture and enhancement of steroidal saponins in mini- rhizome cultures using elicitors</article-title>. <source>Plant Growth Regul.</source> <volume>75</volume>, <fpage>341</fpage>&#x2013;<lpage>353</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10725-014-9957-1</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reddy</surname> <given-names>B. S.</given-names>
</name>
<name>
<surname>Karmakar</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Dey</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Optimization of callus induction and callus multiplication in rice (Oryza sativa L.) landraces</article-title>. <source>Res. Plant Biol.</source> <volume>3</volume> (<issue>5</issue>), <fpage>41</fpage>&#x2013;<lpage>44</lpage>.</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ribas</surname> <given-names>A. F.</given-names>
</name>
<name>
<surname>Dechamp</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Champion</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Bertrand</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Combes</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Verdeil</surname> <given-names>J. L.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Agrobacterium-mediated genetic transformation of <italic>Coffea arabica</italic> (L.) is greatly enhanced by using established embryogenic callus cultures</article-title>. <source>BMC Plant Biol.</source> <volume>11</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>15</lpage>.</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rout</surname> <given-names>G. R.</given-names>
</name>
<name>
<surname>Mohapatra</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Jain</surname> <given-names>S. M.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Tissue culture of ornamental pot plant: A critical review on present scenario and future prospects</article-title>. <source>Biotechnol. Adv.</source> <volume>24</volume> (<issue>6</issue>), <fpage>531</fpage>&#x2013;<lpage>560</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bioteChadv.2006.05.001</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Crop improvement in the era of climate change</article-title>. <source>IK Int. Publish</source>.</citation>
</ref>
<ref id="B56">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Choudhury</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Hasanuzzaman</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Srivastava</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <source>Sustainable agriculture in the era of climate change</source>. <fpage>978</fpage>&#x2013;<lpage>973</lpage>. Available at: <uri xlink:href="https://link.springer.com/book/10.1007/978-3-030-45669-6">https://link.springer.com/book/10.1007/978-3-030-45669-6</uri>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Das</surname> <given-names>S. P.</given-names>
</name>
<name>
<surname>Gupta</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Parihar</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Chandrasekhar</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Sarker</surname> <given-names>U.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Multi-omics pipeline and omics-integration approach to decipher plant&#x2019;s abiotic stress tolerance responses</article-title>. <source>Genes</source> <volume>14</volume> (<issue>6</issue>), <fpage>1281</fpage>.</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Gawwad</surname> <given-names>M. R. A.</given-names>
</name>
<name>
<surname>Banerjee</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Bishnu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tah</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Status, trends and prospects of organic farming in India: a review</article-title>. <source>J. Plant Biol. Res.</source> <volume>2</volume>, <fpage>38</fpage>&#x2013;<lpage>48</lpage>.</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Mamgain</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ray</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tah</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Effect of gibberellic acid, kinetin and indole 3-acetic acid on seed germination performance of <italic>Dianthus caryophyllus</italic> (Carnation)</article-title>. <source>Agric. Conspec. Sci.</source> <volume>77</volume> (<issue>3</issue>), <fpage>157</fpage>&#x2013;<lpage>160</lpage>.</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Tah</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Germination behaviors in M2 generation of Dianthus after chemical mutagenesis</article-title>. <source>Intern. J. Adv. Sci. Tech. Res.</source> <volume>2</volume> (<issue>1</issue>), <fpage>448</fpage>&#x2013;<lpage>454</lpage>.</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roychowdhury</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Tah</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Mutagenesis&#x2014;A potential approach for crop improvement</article-title>. <source>Crop improvement: New approaches modern techniques</source>, <fpage>149</fpage>&#x2013;<lpage>187</lpage>. doi: <pub-id pub-id-type="doi">10.1007/978-1-4614-7028-1_4</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saini</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Jaiwal</surname> <given-names>P. K.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>
<italic>Agrobacterium tumefaciens</italic>-mediated transformation of blackgram: an assessment of factors influencing the efficiency of uidA gene transfer</article-title>. <source>Biol. Plant</source> <volume>51</volume> (<issue>1</issue>), <fpage>69</fpage>&#x2013;<lpage>74</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s10535-007-0014-z</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sales</surname> <given-names>E. K.</given-names>
</name>
<name>
<surname>Butardo</surname> <given-names>N. G.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Molecular analysis of somaclonal variation in tissue culture derived bananas using MSAP and SSR markers</article-title>. <source>Int. J. Biotechnol. Bioeng.</source> <volume>8</volume> (<issue>6</issue>), <fpage>615</fpage>&#x2013;<lpage>622</lpage>.</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sarwar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zia</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Rehman</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Fatima</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Sial</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Chaudhary</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>
<italic>In vitro</italic> direct regeneration in mint from different explants on half strength MS medium</article-title>. <source>Afr. J. Biotechnol.</source> <volume>8</volume> (<issue>18</issue>), <fpage>4667</fpage>&#x2013;<lpage>4671</lpage>.</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schwede</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Kopp</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Guex</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Peitsch</surname> <given-names>M. C.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>SWISS-MODEL: an automated protein homology-modeling server</article-title>. <source>Nucleic Acids Res.</source> <volume>31</volume> (<issue>13</issue>), <fpage>3381</fpage>&#x2013;<lpage>3385</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkg520</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Singh</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Kashyap</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>In silico identification and characterization of 1- aminocyclopropane-1-carboxylate deaminase from <italic>Phytophthora sojae</italic>
</article-title>. <source>J. Mol. Model.</source> <volume>18</volume>, <fpage>4101</fpage>&#x2013;<lpage>4111</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.indcrop.2011.12.005</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Singh</surname> <given-names>M. K.</given-names>
</name>
<name>
<surname>Chandel</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Hallan</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Ram</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Zaidi</surname> <given-names>A. A.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Occurrence of peanut stripe virus on patchouli and raising of virus-free patchouli plants by meristem tip culture</article-title>. <source>J. Plant Dis. Prot.</source> <volume>116</volume> (<issue>1</issue>), <fpage>2</fpage>&#x2013;<lpage>6</lpage>.</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Singh</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Khan</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rahman</surname> <given-names>L. U.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Establishment of an efficient Agrobacterium-mediated genetic transformation system in <italic>Pelargonium graveolens</italic>: an important aromatic plant</article-title>. <source>Plant Cell Tissue Organ Cult.</source> <volume>129</volume>, <fpage>35</fpage>&#x2013;<lpage>44</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-016-1153-8</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Singh</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Pandey</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Dubey</surname> <given-names>B. K.</given-names>
</name>
<name>
<surname>Raj</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Barnawal</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Chandran</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Salt and drought stress tolerance with increased biomass in transgenic <italic>Pelargonium graveolens</italic> through heterologous expression of ACC deaminase gene from <italic>Achromobacter xylosoxidans</italic>
</article-title>. <source>Plant Cell Tissue Organ Cult.</source> <volume>147</volume> (<issue>2</issue>), <fpage>297</fpage>&#x2013;<lpage>311</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-021-02124-0</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Singh</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Rai</surname> <given-names>M. K.</given-names>
</name>
<name>
<surname>Sahoo</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>An improved and efficient micropropagation of <italic>Eclipta alba</italic> through transverse thin cell layer culture and assessment of clonal fidelity using RAPD analysis</article-title>. <source>Ind. Crops Prod.</source> <volume>37</volume> (<issue>1</issue>), <fpage>328</fpage>&#x2013;<lpage>333</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.indcrop.2011.12.005</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soltys-Kalina</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Plich</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Strzelczyk-&#x17b;yta</surname> <given-names>D.</given-names>
</name>
<name>
<surname>&#x15a;liwka</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Marczewski</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>The effect of drought stress on the leaf relative water content and tuber yield of a half-sib family of &#x2018;Katahdin&#x2019;-derived potato cultivars</article-title>. <source>Breed. Sci.</source> <volume>66</volume> (<issue>2</issue>), <fpage>328</fpage>&#x2013;<lpage>331</lpage>. doi: <pub-id pub-id-type="doi">10.1270/jsbbs.66.328</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stachel</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Messens</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Van Montagu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zambryski</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>1985</year>). <article-title>Identification of the signal molecules produced by wounded plant cells that activate T-DNA transfer in agrobacterium tumefaciens</article-title>. <source>Nature.</source> <volume>318</volume>, <fpage>624</fpage>&#x2013;<lpage>629</lpage>.</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Steinmacher</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Krohn</surname> <given-names>N. G.</given-names>
</name>
<name>
<surname>Dantas</surname> <given-names>A. C. M.</given-names>
</name>
<name>
<surname>Stefenon</surname> <given-names>V. M.</given-names>
</name>
<name>
<surname>Clement</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Guerra</surname> <given-names>M. P.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Somatic embryogenesis in peach palm using the thin cell layer technique: induction, morpho-histological aspects and AFLP analysis of somaclonal variation</article-title>. <source>Ann. Bot.</source> <volume>100</volume> (<issue>4</issue>), <fpage>699</fpage>&#x2013;<lpage>709</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/aob/mcm153</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Subramanyam</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Rajesh</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Jaganath</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Vasuki</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Theboral</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Elayaraja</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>Assessment of factors influencing the Agrobacterium-mediated in planta seed transformation of brinjal (<italic>Solanum melongena</italic> L.)</article-title>. <source>Appl. Biochem. Biotechnol.</source> <volume>171</volume>, <fpage>450</fpage>&#x2013;<lpage>468</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-005-1039-7</pub-id>
</citation>
</ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sugimura</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kadotani</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Ueda</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Shima</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Kitajima</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Furusawa</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Transgenic patchouli plants produced by agrobacterium-mediated transformation</article-title>. <source>Plant Cell Tissue Organ Cult.</source> <volume>82</volume> (<issue>3</issue>), <fpage>251</fpage>&#x2013;<lpage>257</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-005-1039-7</pub-id>
</citation>
</ref>
<ref id="B76">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suhesti</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Susilowati</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sirait</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Haryudin</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Hadipoentyanti</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Improvement of drought tolerance of patchouli through gamma irradiation and in <italic>vitro</italic> selection. In IOP Conf. Ser</article-title>. <source>Earth Environ. Sci.</source> <volume>974</volume> (<issue>1</issue>), <elocation-id>12061</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1088/1755-1315/974/1/012061</pub-id>
</citation>
</ref>
<ref id="B77">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Qiao</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>Adventitious bud regeneration from leaf explants of <italic>Platanus occidentalis</italic> L. and genetic stability assessment</article-title>. <source>Acta Physiol. Plant</source> <volume>31</volume> (<issue>1</issue>), <fpage>33</fpage>&#x2013;<lpage>41</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11738-008-0196-9</pub-id>
</citation>
</ref>
<ref id="B78">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suresh</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Athreya</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Lobo</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Chandramohan</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sabat</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Structure analysis and molecular simulation study of ACC deaminase mutants from pseudomonas sp., an endophyte in reducing abiotic stress in plants</article-title>. <source>Int. J. Agric. Environ. Biotechnol.</source> <volume>15</volume> (<issue>3</issue>), <fpage>773</fpage>&#x2013;<lpage>780</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.30954/0974-1712.03.2022.15</pub-id>
</citation>
</ref>
<ref id="B79">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Swamy</surname> <given-names>M. K.</given-names>
</name>
<name>
<surname>Sinniah</surname> <given-names>U. R.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Patchouli (<italic>Pogostemon cablin</italic> Benth.): botany, agrotechnology and biotechnological aspects</article-title>. <source>Ind. Crops Prod.</source> <volume>87</volume>, <fpage>161</fpage>&#x2013;<lpage>176</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.indcrop.2016.04.032</pub-id>
</citation>
</ref>
<ref id="B80">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Swarna</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ravindhran</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>
<italic>In vitro</italic> organogenesis from leaf and transverse thin cell layer derived callus cultures of <italic>Talinum triangulare</italic> (Jacq.) Wild</article-title>. <source>Plant Growth Regul.</source> <volume>70</volume>, <fpage>79</fpage>&#x2013;<lpage>87</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10725-012-9780-5</pub-id>
</citation>
</ref>
<ref id="B81">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tahir</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Riniarti</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Ersan</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Kusuma</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Genetic and leaf characteristic diversity on 10 mutant progenies of patchouli (<italic>Pogostemon cablin</italic>) provide insights to selection strategies</article-title>. <source>AGRIVITA J. Agric. Sci.</source> <volume>41</volume> (<issue>1</issue>), <fpage>139</fpage>&#x2013;<lpage>148</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.17503/agrivita.v41i1.1908</pub-id>
</citation>
</ref>
<ref id="B82">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tripathi</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Rai</surname> <given-names>K. K.</given-names>
</name>
<name>
<surname>Rai</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Rai</surname> <given-names>S. P.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>An improved thin cell layer culture system for efficient clonal propagation and in <italic>vitro</italic> withanolide production in a medicinal plant <italic>Withania coagulans</italic> Dunal</article-title>. <source>Ind. Crops Prod.</source> <volume>119</volume>, <fpage>172</fpage>&#x2013;<lpage>182</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.indcrop.2018.04.012</pub-id>
</citation>
</ref>
<ref id="B83">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tripathy</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Oelm&#xfc;ller</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Reactive oxygen species generation and signalling in plants</article-title>. <source>Plant Signal. Behav.</source> <volume>7</volume> (<issue>12</issue>), <fpage>1621</fpage>&#x2013;<lpage>1633</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4161/psb.22455</pub-id>
</citation>
</ref>
<ref id="B84">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van</surname> <given-names>M. T. T.</given-names>
</name>
</person-group> (<year>1973</year>). <article-title>
<italic>In vitro</italic> control of <italic>de novo</italic> flower, bud, root, and callus differentiation from excised epidermal tissues</article-title>. <source>Nature</source> <volume>246</volume> (<issue>5427</issue>), <fpage>44</fpage>&#x2013;<lpage>45</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/246044a0</pub-id>
</citation>
</ref>
<ref id="B85">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vijesh</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Isloor</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Telkar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Arulmoli</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Fun</surname> <given-names>H. K.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Molecular docking studies of some new imidazole derivatives for antimicrobial properties</article-title>. <source>Arab. J. Chem.</source> <volume>6</volume> (<issue>2</issue>), <fpage>197</fpage>&#x2013;<lpage>204</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.arabjc.2011.10.007</pub-id>
</citation>
</ref>
<ref id="B86">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Mai</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>A practical random mutagenesis system for <italic>Ralstonia solanacearum</italic> strains causing bacterial wilt of <italic>Pogostemon cablin</italic> using Tn5 transposon</article-title>. <source>World J. Microbiol. Biotechnol.</source> <volume>35</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>8</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11274-018-2581-x</pub-id>
</citation>
</ref>
<ref id="B87">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamasaki</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Dillenburg</surname> <given-names>L. R.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Measurements of leaf relative water content in <italic>Araucaria angustifolia</italic>
</article-title>. <source>Rev. Bras. Fisiol. Veg.</source> <volume>11</volume> (<issue>2</issue>), <fpage>69</fpage>&#x2013;<lpage>75</lpage>.</citation>
</ref>
<ref id="B88">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Lei</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Effects of drought stress and water recovery on physiological responses and gene expression in maize seedlings</article-title>. <source>BMC Plant Biol.</source> <volume>18</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>16</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12870-018-1281-x</pub-id>
</citation>
</ref>
<ref id="B89">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>F. S.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z. Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W. J.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>High- frequency shoot regeneration through transverse thin cell layer culture in <italic>Dendrobium candidum</italic> Wall Ex Lindl</article-title>. <source>Plant Cell Tissue Organ Cult.</source> <volume>90</volume>, <fpage>131</fpage>&#x2013;<lpage>139</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-006-9181-4</pub-id>
</citation>
</ref>
<ref id="B90">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y. F.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y. J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>New patchoulol type sesquiterpenoids from <italic>pogostemon cablin</italic>
</article-title>. <source>Helv. Chim. Acta</source> <volume>94</volume> (<issue>2</issue>), <fpage>218</fpage>&#x2013;<lpage>223</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hlca.201000151</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>