<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1208285</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>
<italic>DMC1</italic> stabilizes crossovers at high and low temperatures during wheat meiosis</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Draeger</surname>
<given-names>Tracie N.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2249376"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Rey</surname>
<given-names>Mar&#xed;a-Dolores</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/214755"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hayta</surname>
<given-names>Sadiye</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/549427"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Smedley</surname>
<given-names>Mark</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/549421"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Martin</surname>
<given-names>Azahara C.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/541413"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Moore</surname>
<given-names>Graham</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/537148"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>John Innes Centre, Norwich Research Park</institution>, <addr-line>Norwich</addr-line>, <country>United Kingdom</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Agroforestry and Plant Biochemistry, Proteomics and Systems Biology, Department of Biochemistry and Molecular Biology, University of C&#xf3;rdoba</institution>, <addr-line>C&#xf3;rdoba</addr-line>, <country>Spain</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Plant Genetic Improvement, Institute for Sustainable Agriculture, Spanish National Research Council (CSIC)</institution>, <addr-line>C&#xf3;rdoba</addr-line>, <country>Spain</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Chung-Ju Rachel Wang, Academia Sinica, Taiwan</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Fangpu Han, Chinese Academy of Sciences (CAS), China; Pierre Sourdille, INRAE Clermont-Auvergne-Rh&#xf4;ne-Alpes, France; Olivier Da Ines, Universit&#xe9; Clermont Auvergne, France</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Tracie N. Draeger, <email xlink:href="mailto:tracie.draeger@jic.ac.uk">tracie.draeger@jic.ac.uk</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>08</day>
<month>08</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1208285</elocation-id>
<history>
<date date-type="received">
<day>18</day>
<month>04</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>17</day>
<month>07</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Draeger, Rey, Hayta, Smedley, Martin and Moore</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Draeger, Rey, Hayta, Smedley, Martin and Moore</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Effective chromosome synapsis and crossover formation during meiosis are essential for fertility, especially in grain crops such as wheat. These processes function most efficiently in wheat at temperatures between 17-23 &#xb0;C, although the genetic mechanisms for such temperature dependence are unknown. In a previously identified mutant of the hexaploid wheat reference variety &#x2018;Chinese Spring&#x2019; lacking the long arm of chromosome 5D, exposure to low temperatures during meiosis resulted in asynapsis and crossover failure. In a second mutant (<italic>ttmei1</italic>), containing a 4 Mb deletion in chromosome 5DL, exposure to 13 &#xb0;C led to similarly high levels of asynapsis and univalence. Moreover, exposure to 30 &#xb0;C led to a significant, but less extreme effect on crossovers. Previously, we proposed that, of 41 genes deleted in this 4 Mb region, the major meiotic gene <italic>TaDMC1-D1</italic> was the most likely candidate for preservation of synapsis and crossovers at low (and possibly high) temperatures. In the current study, using RNA-guided Cas9, we developed a new Chinese Spring CRISPR mutant, containing a 39 bp deletion in the 5D copy of <italic>DMC1</italic>, representing the first reported CRISPR-Cas9 targeted mutagenesis in Chinese Spring, and the first CRISPR mutant for <italic>DMC1</italic> in wheat. In controlled environment experiments, wild-type Chinese Spring, CRISPR <italic>dmc1-D1</italic> and backcrossed <italic>ttmei1</italic> mutants were exposed to either high or low temperatures during the temperature-sensitive period from premeiotic interphase to early meiosis I. After 6-7 days at 13 &#xb0;C, crossovers decreased by over 95% in the <italic>dmc1-D1</italic> mutants, when compared with wild-type plants grown under the same conditions. After 24 hours at 30 &#xb0;C, <italic>dmc1-D1</italic> mutants exhibited a reduced number of crossovers and increased univalence, although these differences were less marked than at 13 &#xb0;C. Similar results were obtained for <italic>ttmei1</italic> mutants, although their scores were more variable, possibly reflecting higher levels of background mutation. These experiments confirm our previous hypothesis that <italic>DMC1-D1</italic> is responsible for preservation of normal crossover formation at low and, to a certain extent, high temperatures. Given that reductions in crossovers have significant effects on grain yield, these results have important implications for wheat breeding, particularly in the face of climate change.</p>
</abstract>
<kwd-group>
<kwd>hexaploid wheat</kwd>
<kwd>
<italic>DMC1</italic>
</kwd>
<kwd>
<italic>LTP1</italic>
</kwd>
<kwd>meiosis</kwd>
<kwd>crossover</kwd>
<kwd>high temperature</kwd>
<kwd>low temperature</kwd>
<kwd>CRISPR</kwd>
</kwd-group>
<counts>
<fig-count count="2"/>
<table-count count="3"/>
<equation-count count="0"/>
<ref-count count="75"/>
<page-count count="13"/>
<word-count count="8767"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Plant Cell Biology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Like many plants, wheat (<italic>Triticum aestivum</italic> L) is highly sensitive to temperatures that fall outside the range typically experienced during a growing season. The optimum temperature range for wheat growth over an entire season is generally considered to be around 17-23 &#xb0;C, with temperatures above or below this range significantly reducing grain yield (<xref ref-type="bibr" rid="B51">Porter and Gawith, 1999</xref>). The extent to which temperature stresses affect yield is dependent on developmental stage, with reproductive stages more sensitive to high temperatures than vegetative growth stages (<xref ref-type="bibr" rid="B28">Fischer and Maurer, 1976</xref>). Even quite short periods of high temperature (20-24 hours at 30 &#xb0;C) during meiosis can reduce grain number (<xref ref-type="bibr" rid="B58">Saini and Aspinall, 1982</xref>; <xref ref-type="bibr" rid="B23">Draeger and Moore, 2017</xref>). Meiosis has also been identified as the stage most sensitive to low temperature stress (<xref ref-type="bibr" rid="B67">Thakur et&#xa0;al., 2010</xref>), with reductions in grain yield occurring when low temperatures coincide with the &#x2018;booting&#x2019; stage, which broadly corresponds to meiosis (<xref ref-type="bibr" rid="B36">Ji et&#xa0;al., 2017</xref>). Bread wheat is an allohexaploid (2n = 6x = 42), made up of three related (homeologous) sub-genomes (A, B and D). During wheat meiosis, chromosome behaviour is tightly controlled by the <italic>TaZIP4-B2 (Ph1)</italic> gene, which promotes synapsis and crossover between homologous chromosomes (homologs), rather than between homeologous chromosomes (homeologs) from related genomes (<xref ref-type="bibr" rid="B56">Riley and Chapman, 1958</xref>; <xref ref-type="bibr" rid="B59">Sears and Okamoto, 1958</xref>; <xref ref-type="bibr" rid="B44">Mart&#xed;n et&#xa0;al., 2014</xref> and <xref ref-type="bibr" rid="B43">Mart&#xed;n et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B53">Rey et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B24">Draeger et&#xa0;al., 2023</xref>). This allows the three genomes to behave as separate diploids during meiosis, thus maintaining genome stability and fertility.</p>
<p>Meiosis is a highly dynamic process during which parental chromosomes pair and recombine. It is essential for gamete formation in sexually reproducing organisms. During early meiosis, the parental chromosomes align alongside each other as pairs, enabling a proteinaceous structure, the synaptonemal complex (SC), to assemble between them, linking the chromosomes along their entire lengths in a process called synapsis (<xref ref-type="bibr" rid="B48">Page and Hawley, 2004</xref>). The SC is thought to provide the structural framework for meiotic recombination to take place. Recombination initiates by programmed double-strand breaks (DSBs) in the DNA. A small minority of these are repaired as crossovers, forming physical connections between each chromosome pair, enabling genetic information to be reciprocally exchanged, and potentially creating new advantageous allelic combinations. These physical connections can be seen cytologically as chiasmata.</p>
<p>Assembly of the SC completes at pachytene, and by diplotene crossovers are fully formed. The SC then disassembles, leaving homologs connected only by their chiasmata. At metaphase I, the homolog pairs align on the equatorial plate, and the chiasmata connecting the chromosomes can be seen using light microscopy. At this stage, in hexaploid wheat, the chromosomes of each parent are normally bound together as 21 bivalent pairs, most forming as ring bivalents with two chiasmata linking them, one in each arm, usually towards the distal ends. Occasionally, the homologs are bound together by chiasmata in one arm only, forming a rod bivalent. In wheat, on average, there are around 2.3 crossovers per homolog pair (<xref ref-type="bibr" rid="B45">Miller and Reader, 1985</xref>). At least one crossover (the &#x2018;obligate&#x2019; crossover) must form between each bivalent pair to ensure accurate chromosome segregation and balanced gametes in daughter cells (<xref ref-type="bibr" rid="B75">Zickler and Kleckner, 1999</xref>; <xref ref-type="bibr" rid="B37">Jones and Franklin, 2006</xref>), which is vital for maintaining genome stability and fertility.</p>
<p>Assembly of the SC is a highly temperature-sensitive process (<xref ref-type="bibr" rid="B8">Bilgir et&#xa0;al., 2013</xref>). Both high and low temperatures can lead to disruption of synapsis, resulting in unpaired univalent chromosomes that segregate randomly or are lost completely (reviewed in <xref ref-type="bibr" rid="B11">Bomblies et&#xa0;al., 2015</xref> and <xref ref-type="bibr" rid="B46">Morgan et&#xa0;al., 2017</xref>). Relatively small changes in temperature can alter the frequency and distribution of crossovers (<xref ref-type="bibr" rid="B26">Elliott, 1955</xref>; <xref ref-type="bibr" rid="B21">Dowrick, 1957</xref>; <xref ref-type="bibr" rid="B3">Bayliss and Riley, 1972a</xref>; <xref ref-type="bibr" rid="B34">Higgins et&#xa0;al., 2012</xref>). In wheat, high and low temperatures have been found to generally decrease chiasma frequency. In the wheat cultivar &#x2018;Chinese Spring&#x2019;, this temperature sensitivity is under the genetic control of a major gene located on chromosome 5D (<xref ref-type="bibr" rid="B55">Riley, 1966</xref>). In Chinese Spring plants lacking chromosome 5D, numbers of chiasmata progressively decrease as the temperature falls below the optimum range (<xref ref-type="bibr" rid="B55">Riley, 1966</xref>; <xref ref-type="bibr" rid="B3">Bayliss and Riley, 1972a</xref>). Chiasma frequency is greatly reduced at 15 &#xb0;C, and pronounced chromosome pairing failure occurs at 12 &#xb0;C, resulting in complete male sterility (<xref ref-type="bibr" rid="B55">Riley, 1966</xref>; <xref ref-type="bibr" rid="B33">Hayter and Riley, 1967</xref>). This reduction in chiasma frequency is due to failure of chromosome synapsis at zygotene, although the temperature-sensitive phase is earlier, during premeiotic interphase, prior to DNA synthesis (<xref ref-type="bibr" rid="B4">Bayliss and Riley, 1972b</xref>).</p>
<p>These studies led to the proposal that there must be a gene on chromosome 5D that stabilizes chromosome &#x2018;pairing&#x2019; (synapsis) at low temperatures. This putative gene, named <italic>low-temperature pairing</italic> (<italic>Ltp</italic>) (<xref ref-type="bibr" rid="B33">Hayter and Riley, 1967</xref>), was further defined to the long arm of chromosome 5D (<xref ref-type="bibr" rid="B32">Hayter, 1969</xref>) and later renamed <italic>Ltp1</italic> (<xref ref-type="bibr" rid="B52">Queiroz et&#xa0;al., 1991</xref>). In plants lacking chromosome 5D, chiasma frequency also appears to decrease progressively at temperatures of ~30&#xb0;C and above (<xref ref-type="bibr" rid="B3">Bayliss and Riley, 1972a</xref>), suggesting that chromosome 5D may also be associated with tolerance to high temperatures. However, this suggestion was based on the scoring of a few cells only, because high temperature treatments for 3 days made the chromosomes too sticky for accurate scoring.</p>
<p>More recently, we used wheat (Chinese Spring) lines with terminal deletions of 5DL to delimit the <italic>Ltp1</italic> locus to the proximal half of chromosome 5DL (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>). KASP markers specific to 5DL, that mapped within this delimited region, were used to screen ~2500 gamma-irradiated deletion lines, from which 16 plants were identified with 5DL deletions. Mapping and candidate gene identification were facilitated by resources including the Chinese Spring IWGSC RefSeq v1.0 genome assembly (<xref ref-type="bibr" rid="B35">International Wheat Genome Sequencing Consortium (IWGSC), 2018</xref>), the Wheat 820&#xa0;K Axiom<sup>&#xae;</sup> Breeders&#x2019; Array probe set (<xref ref-type="bibr" rid="B71">Winfield et&#xa0;al., 2015</xref>) and the Ensembl Plants database (<xref ref-type="bibr" rid="B10">Bolser et&#xa0;al., 2016</xref>). The 16 mutant plants were then exposed to low temperature (13&#xb0;C) for 7 days, during a period lasting from premeiotic interphase to early meiosis I. From this, we identified a deletion mutant with meiotic chromosomes exhibiting extremely high levels of asynapsis and chromosome univalence after the low temperature treatment. This was very similar to the phenotype previously described for <italic>Ltp1</italic> when the whole of chromosome 5D was absent. Exposure of this same <italic>ltp1-like</italic> deletion mutant to 30&#xb0;C for 24 hours during the same developmental period, also led to a reduced number of crossovers and increased univalence, although the effect was less pronounced than that observed following exposure to 13 &#xb0;C. However, as the deletion had a clear effect on chromosome pairing at 30 &#xb0;C as well as at 13 &#xb0;C, we renamed the mutant line <italic>temperature tolerant meiosis 1 (ttmei1</italic>), to reflect its reduced tolerance to high temperature in addition to its loss of the low temperature pairing gene <italic>Ltp1</italic>.</p>
<p>Using KASP genotyping, we then mapped the <italic>ttmei1</italic> deletion to a 4 Mb region of chromosome 5DL. Of the 41 genes deleted in this region, 18 were expressed during meiosis, of which 12 were high confidence genes. Of these, the strongest candidate for the observed effects on meiosis was the D-genome homeolog of the meiotic recombination gene <italic>DMC1</italic> (<italic>TaDMC1-D1</italic>), which had a ten-fold higher expression level in meiotic tissues compared with non-meiotic. For the remaining 17 genes expressed during meiosis, expression was proportionally higher in non-meiotic tissues, and none had any previously known meiotic function. Moreover, <italic>TaDMC1-D1</italic> was expressed most highly during early prophase I, which in wheat coincides with the &#x2018;telomere bouquet&#x2019; stage, when synapsis is initiated (<xref ref-type="bibr" rid="B43">Mart&#xed;n et&#xa0;al., 2017</xref>). Consistent with this, in the <italic>ttmei1</italic> mutant, synapsis was abnormal after exposure to 13 &#xb0;C and did not complete. Therefore, we proposed that <italic>DMC1-D1</italic> was probably responsible for the <italic>Ltp1/ttmei1</italic> phenotype. DMC1 (Disrupted Meiotic cDNA 1) is a recombinase that plays a central role in meiotic recombination, performing homology search, strand invasion and strand exchange during repair of meiotic DSBs (<xref ref-type="bibr" rid="B9">Bishop et&#xa0;al., 1992</xref>). The process of strand invasion is fundamentally dynamic, which makes it vulnerable to disruption by temperature stress.</p>
<p>In the current study, we have developed a CRISPR <italic>dmc1-D1</italic> mutant in the hexaploid wheat variety Chinese Spring. Until recently, very few wheat genotypes have been transformable, but the development of a GRF-GIF chimeric protein (<xref ref-type="bibr" rid="B17">Debernardi et&#xa0;al., 2020</xref>) has addressed this issue, and this technology, combined with our efficient transformation system (<xref ref-type="bibr" rid="B31">Hayta et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B30">Hayta et&#xa0;al., 2021</xref>), has allowed us to generate the first CRISPR mutants in Chinese Spring. Chinese Spring is used as the hexaploid wheat reference genome by most wheat researchers, as it has a fully annotated sequenced genome (<xref ref-type="bibr" rid="B35">International Wheat Genome Sequencing Consortium (IWGSC), 2018</xref>), with all data integrated into the Ensembl Plants database (<xref ref-type="bibr" rid="B10">Bolser et&#xa0;al., 2016</xref>). Thus, the successful transformation of Chinese Spring is a major step forward. We have also backcrossed <italic>ttmei1</italic> mutants with wild-type Chinese Spring plants, to reduce background mutations. We have exposed the <italic>ttmei1</italic> and CRISPR <italic>dmc1-D1</italic> mutants to high (30 &#xb0;C) and low (13 &#xb0;C) temperatures during the sensitive period of premeiosis to meiosis I, to determine whether the D-genome copy of <italic>DMC1</italic> has a stabilizing effect on chromosome synapsis and crossover in wheat.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Plant materials</title>
<p>Mutants for <italic>DMC1-D1</italic> (TraesCS5D02G141200) and <italic>TTMEI1</italic> were derived from the hexaploid wheat cultivar &#x2018;Chinese Spring&#x2019; (<italic>Triticum aestivum</italic> L., 2n = 6x = 42; AABBDD), which was also used as a wild-type control. The CRISPR <italic>Tadmc1-D1</italic> mutant was developed within the Crop Transformation Facility (BRACT) at the John Innes Centre, using RNA-guided Cas9. The <italic>Tattmei1</italic> deletion mutant was generated previously by gamma irradiation (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>). <italic>Tattmei1</italic> has a 4 Mb interstitial deletion on chromosome 5DL, with 41 genes deleted, including <italic>TaDMC1-D1.</italic> For the current study, <italic>ttmei1</italic> M<sub>2</sub> plants were backcrossed twice with Chinese Spring to produce Bc<sub>2</sub>F<sub>2</sub> plants with fewer background mutations.</p>
</sec>
<sec id="s2_2">
<title>Production of <italic>Tadmc1-D1</italic> CRISPR mutants using RNA-guided Cas9</title>
<sec id="s2_2_1">
<title>Plasmid assembly</title>
<p>The genomic DNA sequences of the Chinese Spring <italic>TaDMC1</italic> homeologs were aligned using the software Geneious Prime, version 2020.2.4 (Biomatters). Two guide RNAs, TaDMC1-D Guide1: 5&#x2019;-GCTCATGGAGGCCGACCGGG-3&#x2019; and TaDMC1-D Guide2: 5&#x2019;-CAAGCAGCTCATCAAGCGTT-3&#x2019;, were designed to target the D genome copy of <italic>TaDMC1</italic>, and were cloned into a binary vector. Only the D-genome copy of <italic>DMC1</italic> contained the PAM sequences utilised by the guide RNAs. Additionally, the guide RNA2 target sequence was D-genome specific, differing from the A- and B-genome sequences by 12 nucleotides. <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;1</bold>
</xref> shows an alignment of all three wheat <italic>DMC1</italic> sequences, including positions of the guide RNAs and the D-genome specific PAM sequences.</p>
<p>The binary vector was prepared for wheat transformation using standard Golden Gate MoClo assembly (<xref ref-type="bibr" rid="B70">Werner et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B61">Smedley et&#xa0;al., 2021</xref>). Construct assembly incorporated GRF4-GIF1 technology (<xref ref-type="bibr" rid="B17">Debernardi et&#xa0;al., 2020</xref>). The guide RNAs were cloned between the TaU6 promoter and the guide scaffold for <italic>Streptococcus pyogenes</italic> Cas9 in the Level 1 acceptor plasmids pL1P3-TaU6 (Addgene #165599) and pL1P4-TaU6 (Addgene #165600), as described in <xref ref-type="bibr" rid="B61">Smedley et&#xa0;al. (2021)</xref>. These level 1 plasmids were sequenced, before proceeding to the Level 2 assembly. Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (<xref ref-type="bibr" rid="B61">Smedley et&#xa0;al., 2021</xref>). The Level 1 plasmids pL1P1OsActinP:<italic>hpt</italic>-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP : Cas9:NosT (Addgene #165424), pL1P5ZmUbiP : GRF-GIF : NosT (Addgene #198046) and guide cassettes were assembled into pGGG-M, along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D, and was sequenced to ensure authenticity before transferring to <italic>Agrobacterium</italic>.</p>
</sec>
<sec id="s2_2_2">
<title>Agrobacterium transformation of Chinese Spring</title>
<p>The hypervirulent <italic>Agrobacterium tumefaciens</italic> strain AGL1 (<xref ref-type="bibr" rid="B40">Lazo et&#xa0;al., 1991</xref>) was used for the wheat transformation experiments. The pGGG-TaDMC1-D vector was electroporated into <italic>A. tumefaciens</italic> AGL1 competent cells and standard <italic>Agrobacterium</italic> inoculums prepared, as described previously (<xref ref-type="bibr" rid="B30">Hayta et&#xa0;al., 2021</xref>). Wheat transformation was performed with 10 mg L<sup>&#x2013;1</sup> hygromycin used for selection. Transgenesis was confirmed and transgene copy number analysis performed using Taqman qPCR and probe (<xref ref-type="bibr" rid="B31">Hayta et&#xa0;al., 2019</xref>). Values obtained were used to calculate transgene copy number, according to published methods (<xref ref-type="bibr" rid="B42">Livak and Schmittgen, 2001</xref>).</p>
</sec>
<sec id="s2_2_3">
<title>Screening for gene edits</title>
<p>Six T<sub>0</sub> lines were chosen for analysis, and 12 plants per T<sub>1</sub> line grown and analysed. A further 32 plants (T<sub>2</sub>) from one T<sub>1</sub> edited plant were analysed for the presence of gene edits. Two sets of primers were designed to amplify the two target regions within the <italic>TaDMC1-D1</italic> CDS. For amplicon 1 (TaDMC1-D Guide1 target area), primers were TaDMC1-D F1 5&#x2032;-GAGCGTGGGCTTGGTGTTAC-3&#x2032; and TaDMC1-D R1 5&#x2032;-GAGGCGGAAGCACCCGGG-3&#x2032;. For Amplicon 2 (TaDMC1-D Guide2 target area), TaDMC1-D F2 5&#x2032;-TGCGATAGAATCTTCTGAAGTTTGTGTA-3&#x2032; and TaDMC1-D R2 5&#x2032;-TCAATCCCT CCTTCAAATTACGC-3&#x2032; were used. PCR amplification was performed using GoTaq<sup>&#xae;</sup> Master Mix (Promega, M7122), with the following conditions: 3&#xa0;min 94 &#xb0;C, 40 cycles of 30 s at 94 &#xb0;C, 15 s at 58 &#xb0;C, 1&#xa0;min at 72 &#xb0;C and 5&#xa0;min at 72 &#xb0;C. Amplicons were Sanger sequenced directly (using their respective forward primers) by the Molecular Genetics Platform at the John Innes Centre. A and B homeologs of <italic>DMC1</italic> were sequenced to ensure that no off-target editing had occurred in these copies.</p>
</sec>
<sec id="s2_2_4">
<title>KASP genotyping of <italic>ttmei1</italic> mutants</title>
<p>Wild-type Chinese Spring and <italic>ttmei1</italic> mutant plants were grown to the 2-3 leaf stage, and DNA extracted from leaf material, as in <xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref> (adapted from <xref ref-type="bibr" rid="B49">Pallotta et&#xa0;al., 2003</xref>). Final DNA template concentrations were between 15-30 ng. KASP genotyping was performed using 5D chromosome-specific KASP primers with homeologous SNPs at the 3&#x2032; end, previously selected from the Wheat Breeders&#x2019; 820&#xa0;K Axiom<sup>&#xae;</sup> array (<xref ref-type="bibr" rid="B71">Winfield et&#xa0;al., 2015</xref>), available at <ext-link ext-link-type="uri" xlink:href="http://www.cerealsdb.uk.net">www.cerealsdb.uk.net</ext-link>,  and aligned with the Chinese Spring reference sequence assembly, IWGSC RefSeq v1.0, (<xref ref-type="bibr" rid="B35">International Wheat Genome Sequencing Consortium (IWGSC), 2018</xref>). Two KASP primers were used to identify the <italic>ttmei1</italic> deletion region: BA00822801, based on a marker mapping proximal to <italic>DMC1-D1</italic>, and BA00750321, mapping distal to <italic>DMC1-D1</italic>. Primer sequences are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. The allele-specific forward primers and common reverse primers were synthesized by Merck <ext-link ext-link-type="uri" xlink:href="https://www.merckgroup.com/">https://www.merckgroup.com/</ext-link>. Allele-specific primers were synthesized with standard FAM or VIC compatible tails at their 5&#x2019; ends (see <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers for KASP genotyping of <italic>ttmei1</italic> (<italic>Tadmc1-D1</italic>) mutants.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Primer name</th>
<th valign="top" align="left">Sequence (5&#x2019;-3&#x2019;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">BA00822801-allele-1</td>
<td valign="top" align="left">tacctcctGttgggtgttcC</td>
</tr>
<tr>
<td valign="top" align="left">BA00822801-allele-2</td>
<td valign="top" align="left">tacctcctGttgggtgttcT</td>
</tr>
<tr>
<td valign="top" align="left">BA00822801-common</td>
<td valign="top" align="left">ggctaaggtcttatgatgagtcaT</td>
</tr>
<tr>
<td valign="top" align="left">BA00750321-allele-1</td>
<td valign="top" align="left">actgcaccgttactctgttC</td>
</tr>
<tr>
<td valign="top" align="left">BA00750321-allele-2</td>
<td valign="top" align="left">actgcaccgttactctgttT</td>
</tr>
<tr>
<td valign="top" align="left">BA00750321-common</td>
<td valign="top" align="left">catagaggttgcccaatttcttT</td>
</tr>
<tr>
<td valign="top" align="left">FAM tail</td>
<td valign="top" align="left">GAAGGTGACCAAGTTCATGCT</td>
</tr>
<tr>
<td valign="top" align="left">VIC tail</td>
<td valign="top" align="left">GAAGGTCGGAGTCAACGGATT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_2_5">
<title>KASP reaction and PCR conditions</title>
<p>The KASP reaction and its components were as recommended by LGC Genomics Ltd and described at <ext-link ext-link-type="uri" xlink:href="https://www.biosearchtech.com/support/education/kasp-genotyping-reagents/how-does-kasp-work">https://www.biosearchtech.com/support/education/kasp-genotyping-reagents/how-does-kasp-work</ext-link>.</p>
<p>Assays were set up as 5 &#x3bc;l reactions in a 384-well format, and included 2.5 &#x3bc;l genomic DNA template (15-30 ng of DNA), 2.5 &#x3bc;l of KASP 2x Master Mix (LGC Genomics) and 0.07 &#x3bc;l primer mix. Primer mix consisted of 12 &#x3bc;l of each tailed primer (100 &#x3bc;M), 30 &#x3bc;l common primer (100 &#x3bc;M) and 46 &#x3bc;l dH<sub>2</sub>O. PCR amplification was performed using the following programme: Hotstart at 94&#xb0;C for 15&#xa0;min, followed by ten touchdown cycles (94&#xb0;C for 20 s; touchdown from 65-57&#xb0;C for 1&#xa0;min, decreasing by 0.8&#xb0;C per cycle), followed by 30 cycles of amplification (94&#xb0;C for 20 s; 57&#xb0;C for 1&#xa0;min). Fluorescent signals from PCR products were read in a PHERAstar microplate reader (BMG LABTECH Ltd.). If tight genotyping clusters were not obtained, additional rounds of amplification were performed. Genotyping data was analysed using KlusterCaller software (LGC Genomics).</p>
</sec>
<sec id="s2_2_6">
<title>Analysis of <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants at meiotic metaphase I</title>
<p>CRISPR <italic>dmc1-D1</italic> and <italic>ttmei1</italic> (Bc<sub>2</sub>F<sub>2</sub>) mutants and Chinese Spring control plants were initially grown in pots in a controlled environment room at 20&#xb0;C day and 15&#xb0;C night, with a 16-hour photoperiod and 70% humidity, until development of the main shoot or tiller to be sampled had progressed to Zadoks growth stage 39 (<xref ref-type="bibr" rid="B74">Zadoks et&#xa0;al., 1974</xref>; <xref ref-type="bibr" rid="B68">Tottman, 1987</xref>), when the flag leaf ligule was just visible and meiocytes were deemed to be at premeiotic interphase. At this stage, the immature spikes enclosed within the leaf sheaths were between 3.5-6.5&#xa0;cm in length (average 4.8&#xa0;cm). Plants were then transferred to growth cabinets under continuous light and exposed to a low temperature (13&#xb0;C) for 6-7 days (with 70% humidity) or a high temperature (30&#xb0;C) for 24&#xa0;h (75% humidity). For the high temperature experiments, treatments were initiated at a similar time of day, between 11.00 and 11.30 am, with the plant pots placed in trays of water to prevent dehydration.</p>
<p>Immediately following treatment, to identify anthers with metaphase I meiocytes, one anther from each floret was stained with acetocarmine and squashed to extrude the meiocytes, which were then examined using a DM2000 light microscope (Leica Microsystems). As the three anthers within a floret are synchronized in meiotic development, when metaphase I chromosomes were identified in one anther, the two remaining anthers from the same floret were prepared for cytological analysis by Feulgen staining with Schiff&#x2019;s reagent, as described by <xref ref-type="bibr" rid="B22">Draeger et&#xa0;al. (2020)</xref>. Anthers were sampled from three plants of each genotype, and images of metaphase I chromosomes captured using a DM2000 microscope equipped with a DFC450 camera and controlled by LAS v4.4 system software (Leica Microsystems). Images were captured in up to 8 different focal planes to aid scoring.</p>
<p>For each plant, a minimum of 30 meiocytes were blind scored from digital images. This involved counting the following different meiotic chromosome configurations in each meiocyte: unpaired univalents (0 chiasmata), rod bivalents (1-2 chiasmata), ring bivalents (2-3 chiasmata), trivalents (2&#x2013;3 chiasmata), tetravalents (3 chiasmata) and pentavalents (4 chiasmata). Previous studies have suggested that &#x2018;double&#x2019; chiasmata may sometimes occur in these chromosome configurations (<xref ref-type="bibr" rid="B29">Gennaro et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B25">Dreissig et&#xa0;al., 2017</xref>). For example, in some bivalents it is difficult or impossible to distinguish whether one (single) chiasma or two (double) chiasmata are present in the same arm, and in such cases, the number of chiasmata can be interpreted according to the shape of the bivalent at metaphase I, as described in <xref ref-type="bibr" rid="B63">Sybenga, 1975</xref>. However, such interpretations can be subjective, so chiasma frequency per meiocyte was calculated separately using two different methods (as in <xref ref-type="bibr" rid="B54">Rey et&#xa0;al., 2018</xref>), with single chiasmata scores representing the minimum number of chiasmata per cell and double chiasmata scores representing the maximum. <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref> shows examples of the scored structures.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Representative images of Feulgen-stained metaphase I chromosomes from meiocytes of wild-type Chinese Spring, CRISPR <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutant plants treated at different temperatures. <bold>(A)</bold> wild type, <bold>(B)</bold> CRISPR <italic>dmc1-D1</italic> and <bold>(C)</bold> <italic>ttmei1</italic> at normal temperatures; <bold>(D)</bold> wild type, <bold>(E)</bold> CRISPR <italic>dmc1-D1</italic> and <bold>(F)</bold> <italic>ttmei1</italic> after 24&#xa0;h at 30&#xb0;C; <bold>(G)</bold> wild type, <bold>(H)</bold> CRISPR <italic>dmc1-D1</italic> and <bold>(I)</bold> <italic>ttmei1</italic> after 6-7 days at 13 &#xb0;C. Examples of univalent chromosomes (univ), rod bivalents (rod), ring bivalents (ring), single chiasma (X) and possible double chiasmata (XX) are indicated with arrows; note complete univalence in CRISPR <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants after treatment at 13 &#xb0;C. Scale bar, 10 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1208285-g001.tif"/>
</fig>
<p>Statistical analyses were performed using STATISTIX 10.0 software (Analytical Software, Tallahassee, FL, USA). All treatments were analysed by the Kruskal&#x2013;Wallis test (nonparametric one-way analysis of variance). Means were separated using Dunn&#x2019;s test with a probability level of 0.05. Statistical analysis was carried out between genotypes (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), and between temperatures (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>). A column chart (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>), showing the effects of the temperature treatments, was plotted using Microsoft Excel (2016).</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Effects of genotype on meiotic metaphase I chromosomes of wild-type Chinese Spring, CRISPR <italic>Tadmc1-D1</italic> and <italic>ttmei1</italic> mutant plants after treatment at 20&#xb0;C, 13&#xb0;C and 30&#xb0;C.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center">Genotype</th>
<th valign="top" align="center">Temp.<break/>(&#xb0;C)</th>
<th valign="top" align="center">Univalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Bivalent (Rod)<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Bivalent (Ring)<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Trivalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Tetravalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Pentavalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Single chiasmata<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Double chiasmata<break/>Mean &#xb1; SE<break/>(range)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="3" align="center">
<bold>20&#xb0;C day, 15&#xb0;C night</bold>
</td>
<td valign="middle" align="left">
<bold>CS</bold>
<break/>
<bold>wild type</bold>
</td>
<td valign="middle" align="center">0.17 &#xb1; 0.12b (0-2)</td>
<td valign="middle" align="center">1.18 &#xb1; 0.19b<break/>(0-4)</td>
<td valign="middle" align="center">19.73 &#xb1; 0.21a<break/>(16-21)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">40.66 &#xb1; 0.28a<break/>(36-42)</td>
<td valign="middle" align="center">43.65 &#xb1; 0.32a<break/>(38-47)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>CRISPR <italic>dmc1-D1</italic>
</bold>
</td>
<td valign="middle" align="center">4.25 &#xb1; 0.34a<break/>(0-20)</td>
<td valign="middle" align="center">6.22 &#xb1; 0.24a<break/>(1-15)</td>
<td valign="middle" align="center">12.66 &#xb1; 0.35b<break/>(3-20)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">31.53 &#xb1; 0.49b<break/>(14-41)</td>
<td valign="middle" align="center">34.16 &#xb1; 0.50b<break/>(15-44)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>
<italic>ttmei1</italic> Bc<sub>2</sub>F<sub>2</sub>
</bold>
</td>
<td valign="middle" align="center">3.89 &#xb1; 0.29a<break/>(0-12)</td>
<td valign="middle" align="center">6.66 &#xb1; 0.19a<break/>(1-12)</td>
<td valign="middle" align="center">12.38 &#xb1; 0.25b<break/>(5-18)</td>
<td valign="middle" align="center">0.02 &#xb1; 0.01<break/>(0-1)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">31.44 &#xb1; 0.36b<break/>(22-39)</td>
<td valign="middle" align="center">33.24 &#xb1; 0.40b<break/>(24-41)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>p-value</bold>
</td>
<td valign="middle" align="left"/>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">
<bold>13&#xb0;C,</bold>
<break/>
<bold>6-7 days</bold>
</td>
<td valign="middle" align="left">
<bold>CS</bold>
<break/>
<bold>wild type</bold>
</td>
<td valign="middle" align="center">0.24 &#xb1; 0.10b<break/>(0-4)</td>
<td valign="middle" align="center">1.16 &#xb1; 0.25c<break/>(0-7)</td>
<td valign="middle" align="center">19.74 &#xb1; 0.26a<break/>(13-21)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">40.65 &#xb1; 0.28a<break/>(33-42)</td>
<td valign="middle" align="center">43.62 &#xb1; 0.38a<break/>(37-48)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>CRISPR <italic>dmc1-D1</italic>
</bold>
</td>
<td valign="middle" align="center">38.82 &#xb1; 0.19a<break/>(34-42)</td>
<td valign="middle" align="center">1.57 &#xb1; 0.09b<break/>(0-4)</td>
<td valign="middle" align="center">0.02 &#xb1; 0.01b<break/>(0-1)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">1.61 &#xb1; 0.10b<break/>(0-4)</td>
<td valign="middle" align="center">1.82 &#xb1; 0.11b<break/>(0-6)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>
<italic>ttmei1</italic> Bc<sub>2</sub>F<sub>2</sub>
</bold>
</td>
<td valign="middle" align="center">37.37 &#xb1; 0.32a<break/>(24-42)</td>
<td valign="middle" align="center">2.19 &#xb1; 0.15a<break/>(0-8)</td>
<td valign="middle" align="center">0.12 &#xb1; 0.03b<break/>(0-2)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">2.44 &#xb1; 0.17b<break/>(0-10)</td>
<td valign="middle" align="center">2.59 &#xb1; 0.19b<break/>(0-11)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>p-value</bold>
</td>
<td valign="middle" align="left"/>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">
<bold>30&#xb0;C,</bold>
<break/>
<bold>24 hours</bold>
</td>
<td valign="middle" align="left">
<bold>CS</bold>
<break/>
<bold>wild type</bold>
</td>
<td valign="middle" align="center">0.21 &#xb1; 0.11c<break/>(0-4)</td>
<td valign="middle" align="center">2.00 &#xb1; 0.25b<break/>(0-5)</td>
<td valign="middle" align="center">18.90 &#xb1; 0.26a<break/>(16-21)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">39.79 &#xb1; 0.29a<break/>(35-42)</td>
<td valign="middle" align="center">42.44 &#xb1; 0.34a<break/>(37-46)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>CRISPR <italic>dmc1-D1</italic>
</bold>
</td>
<td valign="middle" align="center">10.86 &#xb1; 0.52b<break/>(0-26)</td>
<td valign="middle" align="center">8.12 &#xb1; 0.20a<break/>(2-13)</td>
<td valign="middle" align="center">7.43 &#xb1; 0.27b<break/>(1-17)</td>
<td valign="middle" align="center">0.02 &#xb1; 0.01b<break/>(0-1)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">23.01 &#xb1; 0.49b<break/>(10-37)</td>
<td valign="middle" align="center">25.50 &#xb1; 0.52b<break/>(11-40)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>
<italic>ttmei1</italic> Bc<sub>2</sub>F<sub>2</sub>
</bold>
</td>
<td valign="middle" align="center">20.67 &#xb1; 0.47a<break/>(4-36)</td>
<td valign="middle" align="center">7.77 &#xb1; 0.17a<break/>(3-16)</td>
<td valign="middle" align="center">2.75 &#xb1; 0.15c<break/>(0-12)</td>
<td valign="middle" align="center">0.07 &#xb1; 0.02a<break/>(0-2)</td>
<td valign="middle" align="center">0.01 &#xb1; 0.01<break/>(0-1)</td>
<td valign="middle" align="center">0.01 &#xb1; 0.01<break/>(0-1)</td>
<td valign="middle" align="center">13.47 &#xb1; 0.35c<break/>(3-29)</td>
<td valign="middle" align="center">14.54 &#xb1; 0.37c<break/>(3-32)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>p-value</bold>
</td>
<td valign="middle" align="left"/>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>0.0057</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="fnT2_1">
<p>The mean numbers of univalents, rod and ring bivalents, trivalents, tetravalents and pentavalents per meiocyte were scored along with single and double chiasma frequency. Standard error (SE) values are shown. P values are indicated in bold type. P values &lt; 0.05 indicate significant differences; lower case letters a-c indicate where the significant differences lie. For scores with the same letter, the difference between the means is not statistically significant. If the scores have different letters, they are significantly different. Ranges (in brackets) represent the minimum and maximum number of chromosomes with a particular configuration.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Effects of three different temperature treatments on meiotic metaphase I chromosomes of wild-type Chinese Spring, CRISPR <italic>Tadmc1-D1</italic> and <italic>ttmei1</italic> mutant plants.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Genotype</th>
<th valign="top" align="center">Temp.<break/>(&#xb0;C)</th>
<th valign="top" align="center">Univalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Bivalent (Rod)<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Bivalent (Ring)<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Trivalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Tetravalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Pentavalent<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Single chiasmata<break/>Mean &#xb1; SE<break/>(range)</th>
<th valign="top" align="center">Double chiasmata<break/>Mean &#xb1; SE<break/>(range)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="3" align="left">
<bold>CS</bold>
<break/>
<bold>wild type</bold>
</td>
<td valign="middle" align="center">
<bold>20&#xb0;C day, 15&#xb0;C night</bold>
</td>
<td valign="middle" align="center">0.17 &#xb1; 0.12<break/>(0-2)</td>
<td valign="middle" align="center">1.18 &#xb1; 0.19b<break/>(0-4)</td>
<td valign="middle" align="center">19.73 &#xb1; 0.21a<break/>(16-21)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">40.66 &#xb1; 0.24a<break/>(36-42)</td>
<td valign="middle" align="center">43.65 &#xb1; 0.32a<break/>(38-47)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>13&#xb0;C,</bold>
<break/>
<bold>6-7 days</bold>
</td>
<td valign="middle" align="center">0.24 &#xb1; 0.10<break/>(0-4)</td>
<td valign="middle" align="center">1.16 &#xb1; 0.25b<break/>(0-7)</td>
<td valign="middle" align="center">19.74 &#xb1; 0.26a<break/>(13-21)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">40.65 &#xb1; 0.28a<break/>(33-42)</td>
<td valign="middle" align="center">43.62 &#xb1; 0.38a<break/>(37-48)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>30&#xb0;C,</bold>
<break/>
<bold>24 hours</bold>
</td>
<td valign="middle" align="center">0.21 &#xb1; 0.11<break/>(0-4)</td>
<td valign="middle" align="center">2.00 &#xb1; 0.25a<break/>(0-5)</td>
<td valign="middle" align="center">18.90 &#xb1; 0.26b<break/>(16-21)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">39.79 &#xb1; 0.29b<break/>(35-42)</td>
<td valign="middle" align="center">42.44 &#xb1; 0.34b<break/>(37-46)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>p-value</bold>
</td>
<td valign="middle" align="left"/>
<td valign="middle" align="center">
<bold>0.9964</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="left">
<bold>CRISPR <italic>dmc1-D1</italic>
</bold>
</td>
<td valign="middle" align="center">
<bold>20&#xb0;C day, 15&#xb0;C night</bold>
</td>
<td valign="middle" align="center">4.25 &#xb1; 0.34c<break/>(0-20)</td>
<td valign="middle" align="center">6.22 &#xb1; 0.24b<break/>(1-15)</td>
<td valign="middle" align="center">12.66 &#xb1; 0.35a<break/>(3-20)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">31.53 &#xb1; 0.49a<break/>(14-41)</td>
<td valign="middle" align="center">34.16 &#xb1; 0.50a<break/>(15-44)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>13&#xb0;C,</bold>
<break/>
<bold>6-7 days</bold>
</td>
<td valign="middle" align="center">38.82 &#xb1; 0.19a<break/>(34-42)</td>
<td valign="middle" align="center">1.57 &#xb1; 0.09c<break/>(0-4)</td>
<td valign="middle" align="center">0.02 &#xb1; 0.01c<break/>(0-1)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">1.61 &#xb1; 0.10c<break/>(0-4)</td>
<td valign="middle" align="center">1.82 &#xb1; 0.11c<break/>(0-6)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>30&#xb0;C,</bold>
<break/>
<bold>24 hours</bold>
</td>
<td valign="middle" align="center">10.86 &#xb1; 0.52b<break/>(0-26)</td>
<td valign="middle" align="center">8.12 &#xb1; 0.20a<break/>(2-13)</td>
<td valign="middle" align="center">7.43 &#xb1; 0.27b<break/>(1-17)</td>
<td valign="middle" align="center">0.02 &#xb1; 0.01<break/>(0-1)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">23.01 &#xb1; 0.49b<break/>(10-37)</td>
<td valign="middle" align="center">25.50 &#xb1; 0.52b<break/>(11-40)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>p-value</bold>
</td>
<td valign="middle" align="left"/>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="left">
<bold>
<italic>ttmei1</italic> Bc<sub>2</sub>F<sub>2</sub>
</bold>
</td>
<td valign="middle" align="center">
<bold>20&#xb0;C day, 15&#xb0;C night</bold>
</td>
<td valign="middle" align="center">3.89 &#xb1; 0.29c<break/>(0-12)</td>
<td valign="middle" align="center">6.66 &#xb1; 0.19b<break/>(1-12)</td>
<td valign="middle" align="center">12.38 &#xb1; 0.25a<break/>(5-18)</td>
<td valign="middle" align="center">0.02 &#xb1; 0.01<break/>(0-1)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">31.44 &#xb1; 0.36a<break/>(22-39)</td>
<td valign="middle" align="center">33.24 &#xb1; 0.40a<break/>(24-41)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>13&#xb0;C,</bold>
<break/>
<bold>6-7 days</bold>
</td>
<td valign="middle" align="center">37.37 &#xb1; 0.32a<break/>(24-42)</td>
<td valign="middle" align="center">2.19 &#xb1; 0.15c<break/>(0-8)</td>
<td valign="middle" align="center">0.12 &#xb1; 0.03c<break/>(0-2)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">0.00 &#xb1; 0.00<break/>(0-0)</td>
<td valign="middle" align="center">2.44 &#xb1; 0.17c<break/>(0-10)</td>
<td valign="middle" align="center">2.59 &#xb1; 0.19c<break/>(0-11)</td>
</tr>
<tr>
<td valign="middle" align="center">
<bold>30&#xb0;C,</bold>
<break/>
<bold>24 hours</bold>
</td>
<td valign="middle" align="center">20.67 &#xb1; 0.47b<break/>(4-36)</td>
<td valign="middle" align="center">7.77 &#xb1; 0.17a<break/>(3-16)</td>
<td valign="middle" align="center">2.75 &#xb1; 0.15b<break/>(0-12)</td>
<td valign="middle" align="center">0.07 &#xb1; 0.02<break/>(0-2)</td>
<td valign="middle" align="center">0.01 &#xb1; 0.01<break/>(0-1)</td>
<td valign="middle" align="center">0.01 &#xb1; 0.01<break/>(0-1)</td>
<td valign="middle" align="center">13.47 &#xb1; 0.35b<break/>(3-29)</td>
<td valign="middle" align="center">14.54 &#xb1; 0.37b<break/>(3-32)</td>
</tr>
<tr>
<td valign="middle" align="left">
<bold>p-value</bold>
</td>
<td valign="middle" align="left"/>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>-</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
<td valign="middle" align="center">
<bold>&lt; 0.0001</bold>
</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>The mean numbers of univalents, rod and ring bivalents, trivalents, tetravalents and pentavalents per meiocyte were scored along with single and double chiasma frequency. Standard error (SE) values are shown. P values are indicated in bold type. P values &lt; 0.05 indicate significant differences; lower case letters a-c indicate where the significant differences lie. For scores with the same letter, the difference between the means is not statistically significant. If the scores have different letters, they are significantly different. Ranges (in brackets) represent the minimum and maximum number of chromosomes with a particular configuration.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Column chart showing the effects of three different temperature treatments (20&#xb0;C, 13&#xb0;C and 30&#xb0;C) on meiotic metaphase I chromosomes of three hexaploid wheat genotypes: Chinese Spring wild type (CS WT) plants, CRISPR <italic>dmc1-D1</italic> mutants and <italic>ttmei1</italic> mutants. The mean numbers of univalent chromosomes, rod bivalents and ring bivalents per meiocyte are shown, along with mean numbers of single chiasmata per meiocyte. Numbers of multivalent chromosomes and double chiasmata are not shown. Note reduced chiasma frequencies in <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants at 30&#xb0;C, and almost total univalence at 13&#xb0;C.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1208285-g002.tif"/>
</fig>
</sec>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>CRISPR <italic>Tadmc1-D1</italic> mutants</title>
<p>From each of 6 selected T<sub>0</sub> lines, 12 T<sub>1</sub> lines were analysed for edits in the <italic>TaDMC1-D1</italic> target region. Sanger sequencing revealed that none of these lines had a homozygous edit, but one T<sub>1</sub> plant had a heterozygous edit in the target region. The edited T<sub>1</sub> plant was self-fertilized, and 32 T<sub>2</sub> progeny plants were sequenced. In 9 of the T<sub>2</sub> generation plants, sequencing revealed a 39 bp homozygous deletion within the <italic>DMC1-D1</italic> target region. Examples of the T<sub>2</sub> sequence chromatograms are shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure&#xa0;2</bold>
</xref>. The sequences of the <italic>DMC1-A1</italic> and <italic>DMC1-B1</italic> copies were also analysed, and this confirmed that there were no off-target edits in these copies. The 9 T<sub>2</sub> plants were used in the temperature treatment experiments: 3 plants were treated at 13&#xb0;C for 6-7 days; 3 were treated at 30&#xb0;C for 24&#xa0;h; and 3 control plants remained under normal conditions of 20&#xb0;C day, 15&#xb0;C night.</p>
</sec>
<sec id="s3_2">
<title>Slight reduction in chiasma frequency in <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants at normal temperatures</title>
<p>Meiotic metaphase I chromosomes were blind scored in 3 plants of each genotype at each of 13&#xb0;C, 30&#xb0;C and normal temperatures. A minimum of 30 meiocytes were scored for each plant (at least 100 meiocytes per genotype). At normal temperatures, wild-type plants contained ~20 ring bivalents and a single rod bivalent per meiocyte as usual, with univalents occurring only occasionally (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>; <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Mean numbers of single and double chiasmata were ~41 and ~44 respectively. However, under the same temperature conditions, in the <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants, univalents (~4) and rod bivalents (6-7) occurred significantly more frequently than in the wild-type plants, whereas ring bivalents (12-13), single chiasmata (31-32) and double chiasmata (33-34) were significantly fewer than in the wild type (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, C</bold>
</xref>; <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Chiasma/crossover frequency was thus reduced by 22-24% compared to the wild type. No multivalent chromosomes were observed at normal temperatures in either wild-type or <italic>dmc1-D1</italic> meiocytes. In one <italic>ttmei1</italic> mutant plant, two trivalents were observed, but this was not significantly different to the wild-type or <italic>dmc1-D1</italic> scores.</p>
</sec>
<sec id="s3_3">
<title>Further reduction in chiasma frequency at 30&#xb0;C in <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants</title>
<p>After 24 hours at 30&#xb0;C, in wild type plants, mean numbers of univalents per meiocyte remained the same as at normal temperatures (&lt; 1), whereas numbers of rod bivalents increased from around one to around two, ring bivalents decreased from ~20 to ~19, and single and double chiasmata were correspondingly reduced, which were all significant differences, albeit small (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A, D</bold>
</xref>; <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). In the <italic>dmc1-D1</italic> mutants, numbers of univalents and rod bivalents increased from ~4 and ~6 respectively at normal temperatures to ~11 and ~8 respectively after treatment at 30&#xb0;C; numbers of ring bivalents decreased from ~13 to ~7, single chiasmata numbers decreased from ~32 to ~23 (a reduction of ~27%) and double chiasmata from ~34 to ~26 (a reduction of ~25%), which were all significant differences (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, E</bold>
</xref>; <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). In <italic>ttmei1</italic> mutants, numbers of univalents and rod bivalents also increased at 30&#xb0;C, from ~4 to ~21 and from ~7 to ~8 respectively; ring bivalents decreased from 13 to ~3, single chiasmata dropped from ~31 to ~14 (a reduction of ~57%) and double chiasmata from ~33 to ~15 (a reduction of ~56%) (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1C, F</bold>
</xref>; <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Again, all differences were significant. Although numbers of rod bivalents were similar in both mutants at 30&#xb0;C, differences between numbers of univalents, ring bivalents and chiasmata at normal temperatures and at 30&#xb0;C were larger in <italic>ttmei1</italic> mutants than in <italic>dmc1-D1</italic> mutants. At 30&#xb0;C, a small but significant number of trivalents were observed in <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants, but not in wild-type plants. Most of the trivalents were observed in a single <italic>ttmei1</italic> plant. A single tetravalent and two pentavalents were observed in the same <italic>ttmei1</italic> mutant, but this was not a significant difference. No tetravalents or pentavalents were observed in any other plants.</p>
</sec>
<sec id="s3_4">
<title>Crossover failure at 13&#xb0;C in <italic>dmc-D1</italic> and <italic>ttmei1</italic> mutants</title>
<p>After 6-7 days treatment at 13&#xb0;C, in wild-type plants, numbers of univalents, rod and ring bivalents and chiasmata per meiocyte were similar those seen at normal temperatures (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1A, C</bold>
</xref>; <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). However, in the <italic>dmc1-D1</italic> mutants, after treatment at 13&#xb0;C, there was a dramatic increase in the number of univalents from ~4 to ~39; ring bivalent numbers decreased from ~13 to almost none (&lt; 1), rod bivalents decreased from ~6 to ~2 and chiasma frequency decreased dramatically from ~32 (single chiasmata) and ~34 (double chiasmata) to only ~2. Almost all observed chromosomes (~39 out of 42) were univalents (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>; <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Scores for <italic>ttmei1</italic> mutants were similar to those for <italic>dmc1-D1</italic> mutants: 37 out of 42 chromosomes were univalents, there were almost no ring bivalents (&lt; 1), around two rod bivalents and an average of only 2-3 chiasmata per meiocyte (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1I</bold>
</xref>; <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). This means that, at 13 &#xb0;C, crossover was reduced by ~96% in <italic>dmc1-D1</italic> mutants and by ~94% in <italic>ttmei1</italic> mutants, compared to levels seen in wild-type plants at the same temperature. Furthermore, in <italic>dmc1-D1</italic> mutants, exposing plants to 13 &#xb0;C for 6-7 days reduced crossover by ~95% compared to levels observed at normal temperatures. In <italic>ttmei1</italic> mutants, the reduction in crossover was 92%. No multivalent chromosomes were observed in any plants at 13&#xb0;C.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<sec id="s4_1">
<title>Development of CRISPR <italic>dmc1</italic> mutants in wheat</title>
<p>Using RNA-guided Cas9, we have developed new CRISPR mutants containing a 39 bp deletion in the 5D copy of the <italic>DMC1</italic> gene in the hexaploid wheat reference variety Chinese Spring. Until recently, wheat transformation has remained genotype dependent, therefore limiting the potential use of genomic tools such as CRISPR-Cas technologies. However, recent development and deployment of the morphological gene fusion GRF-GIF (<xref ref-type="bibr" rid="B17">Debernardi et&#xa0;al., 2020</xref>), coupled with our efficient and robust transformation system (<xref ref-type="bibr" rid="B31">Hayta et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B30">Hayta et&#xa0;al., 2021</xref>), has reduced genotype dependence in wheat and enabled us to report this first CRISPR-Cas9 targeted mutagenesis in Chinese Spring. These CRISPR <italic>dmc1-D1</italic> mutants, along with backcrossed <italic>ttmei1</italic> mutants (containing a 4 Mb deletion of <italic>DMC1-D1)</italic>, were used to determine whether meiosis is stabilized by <italic>DMC1-D1</italic> at high and/or low temperatures.</p>
</sec>
<sec id="s4_2">
<title>Reduction in crossover in <italic>dmc1-D1</italic> mutants at normal temperatures</title>
<p>In wild type plants grown at normal temperatures, chromosomes aligned on the equatorial plate as normal, pairing as bivalents, mostly rings, but with the occasional rod bivalent (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). However, in the <italic>ttmei1</italic> and CRISPR <italic>dmc1-D1</italic> mutants there were significantly more univalents and rod bivalents, and significantly fewer ring bivalents and chiasmata (<xref ref-type="fig" rid="f1">
<bold>Figures&#xa0;1B, C</bold>
</xref>; <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>; <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>), with a reduction in chiasma (and therefore crossover) frequency of 22-24%. Two multivalents were observed in one <italic>ttmei1</italic> mutant, but none in the other <italic>ttmei1</italic> mutants or in any of the <italic>dmc1-D1</italic> mutants, so the deletion of <italic>DMC1-D1</italic> does not seem linked to the occurrence of multivalents.</p>
<p>Clearly, disruption of <italic>DMC1-D1</italic> has a significant effect on meiosis, but this effect is not severe at normal temperatures, probably due to gene redundancy. There are two other homeologs of the <italic>DMC1</italic> gene in hexaploid wheat: <italic>TaDMC1-A1</italic> (TraesCS5A02G133000) on chromosome 5A and <italic>TaDMC1-B1</italic> (TraesCS5B02G131900) on 5B. All three copies are expressed in wheat (<xref ref-type="bibr" rid="B19">Devisetty et&#xa0;al., 2010</xref>). As described in <xref ref-type="bibr" rid="B22">Draeger et&#xa0;al. (2020)</xref>, the A- and D-genome copies of <italic>TaDMC1</italic> are highly conserved when each gene copy is compared to that of its ancestral homeolog, suggesting that these copies are functional. The B-genome copy shows relatively lower conservation, primarily due to a substantial insertion of 294 bp within intron 7. However, this study also showed that, in Chinese Spring, homeologs of the <italic>DMC1</italic> gene on chromosomes 5A and 5B are present and expressed, and although the expression level of <italic>DMC1-B1</italic> is lower than in <italic>DMC1-D1</italic>, it is higher than in <italic>DMC1-A1</italic>, which suggests that the B-genome copy may also be functional. Furthermore, when grown under normal temperature conditions, <italic>dmc1</italic> mutants in Arabidopsis, rice and barley show mostly univalents at meiotic metaphase I (<xref ref-type="bibr" rid="B15">Couteau et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B69">Wang et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B14">Colas et&#xa0;al., 2019</xref>). This indicates that the presence of a functional <italic>DMC1</italic> gene is crucial for crossover formation. Since our <italic>dmc1-D1</italic> mutants show only a slight reduction in crossovers at normal temperatures, this implies that at least one of the other <italic>DMC1</italic> copies retains its functionality. However, the fact that our <italic>dmc1-D1</italic> mutants have some meiotic defects at normal temperatures suggests that redundancy with the other <italic>DMC1</italic> homeologs is only partial.</p>
</sec>
<sec id="s4_3">
<title>Crossover is reduced by 95% in <italic>dmc1-D1</italic> mutants at 13 &#xb0;C, and synapsis does not complete</title>
<p>In the current study, Chinese Spring wild-type plants and <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants were exposed to a low temperature treatment of 13 &#xb0;C for 6-7 days during premeiotic interphase to early meiosis I. Exposure to the low temperature had no significant effect on metaphase I chromosomes in the wild type plants (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>, <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>), but in the CRISPR <italic>dmc1-D1</italic> mutants, almost all chromosomes observed were univalents (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1H</bold>
</xref>), and crossover decreased by over 95% compared to that seen in the wild-type plants (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>, <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Similar results were obtained for the <italic>ttmei1</italic> mutants (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1I</bold>
</xref>). In the <italic>dmc1-D1</italic> mutants, exposure to the low temperature reduced crossover by ~95% compared to that observed at normal temperatures, and in the <italic>ttmei1</italic> mutants crossover was reduced by 92%. The low chiasma frequencies and high numbers of univalent chromosomes observed in the <italic>dmc1-D1</italic> and <italic>ttmei1</italic> mutants at low temperatures were similar to those observed when the whole of chromosome 5D is deleted in Chinese Spring (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>).</p>
<p>This high number of univalent chromosomes suggests a major problem with crossover formation. Consistent with this, previously we showed that <italic>ttmei1</italic> mutants exhibit significant abnormalities of synapsis at low temperatures (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>): after exposure to a low temperature of 13 &#xb0;C, in both wild type and <italic>ttmei1</italic> mutant meiocytes, synapsis initiates normally at one pole of the nucleus at early zygotene, but in the mutant, synapsis does not complete at pachytene. These experiments confirm our previous hypothesis that, in wheat, <italic>DMC1-D1</italic> is responsible for the preservation of normal synapsis and crossover at lower temperatures, and is therefore equivalent to the <italic>Ltp1</italic> locus first described by <xref ref-type="bibr" rid="B33">Hayter and Riley (1967)</xref>, providing an answer to a question that has existed for over 55 years.</p>
<p>Most reported SC failures involve high temperatures, but, as in wheat, low-temperature failures have also been reported in <italic>Hyacinthus orientalis</italic> and two species of <italic>Solanum</italic> (<xref ref-type="bibr" rid="B26">Elliott, 1955</xref>; <xref ref-type="bibr" rid="B38">Karihaloo, 1991</xref>). Moreover, in the ectothermic Japanese red-bellied newt, <italic>Cynops pyrrhogaster</italic>, low temperatures during meiosis also give rise to univalent chromosomes, indicating failure of chromosome pairing due to asynapsis, and leading to abnormal spermatozoa production (<xref ref-type="bibr" rid="B72">Yazawa et&#xa0;al., 2003</xref>). <italic>DMC1</italic> expression in <italic>C. pyrrhogaster</italic> also decreases under the same low-temperature conditions (8&#xb0;C or 12&#xb0;C), suggesting its low level of expression may contribute to the temperature-dependent abnormalities seen in spermatogenesis. This study supports our suggestion that <italic>DMC1</italic> is involved in the maintenance of normal chromosome synapsis at low temperatures.</p>
</sec>
<sec id="s4_4">
<title>Reduction in crossover in <italic>dmc1-D1</italic> mutants at high temperatures</title>
<p>In the current study, exposure of <italic>dmc1-D1</italic> mutants to a high temperature of 30 &#xb0;C for just 24 hours during premeiotic interphase to meiosis I, resulted in a reduced number of crossovers and increased univalence, though to a lesser extent than that seen after a low temperature treatment of 13 &#xb0;C. Similar results were obtained for <italic>ttmei1</italic> mutants, although there was more variation between scores for individual plants. Previously, high variation between chiasma frequency scores was also observed in the original <italic>ttmei1</italic> mutant plants (prior to backcrossing), following treatment at 30 &#xb0;C for 24 hours (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>). It was suggested that this variation could be linked to a high level of background mutations due to gamma irradiation. In the current study, backcrossing these mutants with Chinese Spring for two generations (Bc<sub>2</sub>F<sub>2</sub>), should have substantially reduced the large numbers of undesirable background mutations, but variation between scores was still high, suggesting that this variation is less likely to be due to background mutations.</p>
<p>High variation between scores for different plants may have occurred if the heat applied reached the meiocytes at slightly different developmental stages or for longer or shorter durations. When Chinese Spring plants are grown at 20 &#xb0;C under continuous light, meiosis is estimated to take around 24 hours to complete (<xref ref-type="bibr" rid="B5">Bennett et&#xa0;al., 1971</xref>; <xref ref-type="bibr" rid="B6">Bennett et&#xa0;al., 1973</xref>), although at higher temperatures (25 &#xb0;C), meiosis is accelerated and completes in around 18 hours (<xref ref-type="bibr" rid="B7">Bennett et&#xa0;al., 1972</xref>). Although assigning meiosis to specific growth stages by assessing the external morphology of a plant is unreliable (<xref ref-type="bibr" rid="B2">Barber et&#xa0;al., 2015</xref>), in the current study, the 24-hour high temperature treatments should have been of sufficient duration to coincide with the temperature-sensitive period from premeiotic interphase to early meiosis I (as described in <xref ref-type="bibr" rid="B4">Bayliss and Riley, 1972b</xref>, and <xref ref-type="bibr" rid="B23">Draeger and Moore, 2017</xref>). Other studies have suggested that it might be difficult to deliver a heat stress treatment to cells such as meiocytes at a specific time, because within an anther they are surrounded by many different cell layers, such as the tapetum layer and the epidermis, which are able to buffer the high temperatures. However, in <italic>Arabidopsis thaliana</italic>, tracking the deposition of stress granules which form at elevated temperatures has demonstrated that the ambient temperature reaches the meiocytes in less than 15 minutes (<xref ref-type="bibr" rid="B18">De Jaeger-Braet et&#xa0;al., 2022</xref>). Even so, since the structures in wheat are much larger, it is still possible that a change in temperature may take longer to reach different meiocytes, due to their varying level of insulation according to the location of their anther within a spike.</p>
</sec>
<sec id="s4_5">
<title>The role of <italic>DMC1</italic> in meiosis</title>
<p>
<italic>TaDMC1-D1</italic> expression is at its highest during early meiotic prophase I (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>), which in wheat, is when synapsis initiates at the &#x2018;telomere bouquet&#x2019; stage (<xref ref-type="bibr" rid="B43">Mart&#xed;n et&#xa0;al., 2017</xref>). DMC1 has a central role in synapsis and homologous recombination. It is a meiosis-specific protein, structurally similar to the bacterial strand-exchange recombinase, RecA (<xref ref-type="bibr" rid="B9">Bishop et&#xa0;al., 1992</xref>). Homologous recombination is initiated by programmed DNA DSBs at leptotene, which results in single-stranded DNA &#x2018;overhangs&#x2019; at the break sites. DMC1 and RAD51 (another RecA homolog) form helical nucleoprotein filaments by polymerizing on the single-stranded overhangs. These filaments perform homology searches and carry out strand invasion and strand exchange between homologous chromosomes (<xref ref-type="bibr" rid="B47">Neale and Keeney, 2006</xref>; reviewed in <xref ref-type="bibr" rid="B12">Brown and Bishop, 2015</xref>, and in <xref ref-type="bibr" rid="B27">Emmenecker et&#xa0;al., 2022</xref>). Repair of these interhomolog invasion events results in crossovers or non-crossovers, although only a small minority of DSBs are repaired as crossovers (reviewed in <xref ref-type="bibr" rid="B39">Lambing et&#xa0;al., 2017</xref>). RAD51 has a role in both somatic and meiotic repair, and is essential for maintaining chromosomal integrity in mitotic cells. DMC1 is the main catalytically active strand-exchange protein during meiosis, but it is also thought to suppress RAD51-mediated recombination in plant meiosis (<xref ref-type="bibr" rid="B16">Da Ines et&#xa0;al., 2022</xref>).</p>
<p>
<italic>DMC1</italic> homologs are found in a wide variety of organisms. In yeast (<italic>Saccharomyces cerevisiae</italic>) and mice, <italic>DMC1</italic> deficiency results in defective meiotic recombination and chromosome synapsis, with cells arresting in prophase, leading to sterility (<xref ref-type="bibr" rid="B9">Bishop et&#xa0;al., 1992</xref>; <xref ref-type="bibr" rid="B50">Pittman et&#xa0;al., 1998</xref>; <xref ref-type="bibr" rid="B73">Yoshida et&#xa0;al., 1998</xref>; <xref ref-type="bibr" rid="B1">Bannister et&#xa0;al., 2007</xref>). Similarly, in wheat <italic>Tadmc1-D1</italic> (<italic>ttmei1</italic>) mutants, synapsis does not complete, and meiosis appears to arrest before pachytene in late prophase, although this was after a treatment at 13&#xb0;C (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>), whereas the phenotypes observed in yeast and mice were at ambient temperatures. Disruption of <italic>DMC1</italic> also leads to sterility in most diploid plant species. <italic>Arabidopsis thaliana</italic> has a single copy of the <italic>DMC1</italic> gene, and synapsis is disrupted in <italic>Atdmc1</italic> mutants, which also show high levels of univalence, and drastically reduced fertility (<xref ref-type="bibr" rid="B15">Couteau et&#xa0;al., 1999</xref>). Rice (<italic>Oryza sativa</italic>) has two <italic>DMC1</italic> homologs, <italic>OsDMC1A</italic> and <italic>OsDMC1B</italic> (<xref ref-type="bibr" rid="B20">Ding et&#xa0;al., 2001</xref>; <xref ref-type="bibr" rid="B69">Wang et&#xa0;al., 2016</xref>). A mutation in either one of these homologs does not lead to serious chromosome pairing defects, but in <italic>Osdmc1a Osdmc1b</italic> double mutants, synapsis is abnormal, crossover is greatly reduced, and there are high numbers of univalent chromosomes at metaphase I, leading to complete sterility (<xref ref-type="bibr" rid="B69">Wang et&#xa0;al., 2016</xref>). Barley (<italic>Hordeum vulgare</italic>) has a single <italic>DMC1</italic> homolog, <italic>HvDMC1</italic>, and mutations in this gene lead to abnormal synapsis, multiple univalents and chromosome mis-segregation (<xref ref-type="bibr" rid="B14">Colas et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B64">Szurman-Zubrzycka et&#xa0;al., 2019</xref>). As in yeast and mice, disruption of the barley orthologue of <italic>DMC1</italic> at ambient temperatures leads to a phenotype similar to that of <italic>Tadmc1</italic> at low temperatures.</p>
</sec>
<sec id="s4_6">
<title>The contribution of <italic>DMC1</italic> homeologs to temperature tolerance</title>
<p>Based on our findings, it appears that <italic>TaDMC1</italic>-<italic>D1</italic> in Chinese Spring, provides low temperature tolerance, and possibly high temperature tolerance. However, the underlying mechanism behind this phenomenon remains unclear. One possible explanation could be a transcription-related effect, where a low-level of <italic>DMC1</italic> is sufficient under normal temperature conditions. However, when plants experience thermal stress, an increased level of <italic>DMC1</italic> becomes necessary, and this requirement is fulfilled by the D-genome copy. Maintaining the proper dosage of meiotic proteins is crucial, as emerging evidence suggests that even &#x201c;heterozygous mutants&#x201d; can exhibit minor meiotic defects (<xref ref-type="bibr" rid="B62">Su et&#xa0;al., 2017</xref>). Previously, we found differences in gene expression levels between the three <italic>DMC1</italic> homeologs in meiotic anthers, with <italic>DMC1-D1</italic> having the highest meiotic gene expression levels and <italic>DMC1-A1</italic> the lowest (<xref ref-type="bibr" rid="B22">Draeger et&#xa0;al., 2020</xref>). It is not yet known how the 5A and 5B copies contribute to meiosis, but these differences in gene expression could be related to differences in the abilities of these three genes to stabilize the genome at low temperatures.</p>
<p>Tetraploid wheat (AABB) has only two copies of <italic>DMC1</italic> (<xref ref-type="bibr" rid="B66">Tang et&#xa0;al., 2017</xref>), but synapsis at 12&#xb0;C is normal, despite the absence of chromosome 5D (<xref ref-type="bibr" rid="B57">Riley et&#xa0;al., 1966</xref>). This is probably due to the presence of a dominant <italic>Ltp</italic> allele on chromosome 5A, with a similar chromosome stabilizing activity to that of chromosome 5D in hexaploid wheat (<xref ref-type="bibr" rid="B33">Hayter and Riley, 1967</xref>). Interestingly, some other varieties and subspecies of wheat differ from Chinese Spring, in that the gene responsible for stabilizing chromosome pairing at low temperatures is located on chromosome 5A rather than 5D (<xref ref-type="bibr" rid="B13">Chapman and Miller, 1981</xref>). Future research will require development of <italic>dmc1-A1</italic> and <italic>dmc1-B1</italic> mutants, along with double and triple mutants in different hexaploid and tetraploid wheat varieties, to determine how each of the <italic>DMC1</italic> homeologs contributes to stabilizing synapsis and crossover at high and low temperatures. This could be achieved using CRISPR/Cas9, which, in addition to its high specificity, can be used to simultaneously target multiple copies of a gene, a technology that has already enabled the production of loss-of-function triple wheat mutants (<xref ref-type="bibr" rid="B65">Taagen et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B41">Li et&#xa0;al., 2021</xref>). Recently, another genome editing system, transcription activator-like effector nucleases (TALENs), has been used to disrupt all six <italic>CmDMC1</italic> loci in the hexaploid flower, <italic>Chrysanthemum morifolium</italic> (<xref ref-type="bibr" rid="B60">Shinoyama et&#xa0;al., 2020</xref>).</p>
</sec>
<sec id="s4_7">
<title>Dosage effects of <italic>TaDMC1</italic> alleles at low temperatures</title>
<p>Different dosages of the <italic>TaDMC1</italic> alleles can affect the stability of synapsis and crossover at low temperatures. In Chinese Spring plants lacking <italic>DMC1-D1</italic>, the chromosome 5A and 5B homeologs <italic>DMC1-A1</italic> and <italic>DMC1-B1</italic>, are unable to compensate for the lack of <italic>DMC1-D1</italic>, and cannot stabilize synapsis and crossover at low temperatures. In a previous study, even when chromosome 5B was present as a double dose in Chinese Spring plants, it was still unable to compensate for the lack of 5D, but when chromosome 5A was present as a double dose, chromosome synapsis at 12&#xb0;C was normal (<xref ref-type="bibr" rid="B57">Riley et&#xa0;al., 1966</xref>). Since <italic>TaDMC1</italic>-<italic>A1</italic> has the lowest meiotic gene expression of the three <italic>DMC1</italic> homeologs in Chinese Spring, this suggests that when <italic>DMC1</italic>-<italic>A1</italic> is present as a double dose, an increase in its expression compensates for the loss of <italic>DMC1-D1</italic> to preserve low temperature tolerance. This supports our suggestion that <italic>DMC1-A1</italic> is functional and shows the importance of gene expression in stabilizing synapsis and crossover at low temperatures. Since the <italic>Tadmc1-D1</italic> mutation makes wheat less tolerant to low and high temperatures, it is possible that overexpression of <italic>TaDMC1-D1</italic> might make wheat more tolerant to variations in temperature above and below the normal range. This would be a useful addition to the array of tools being developed to combat the effects of climate change on wheat crop production.</p>
</sec>
<sec id="s4_8">
<title>Future studies</title>
<p>Climate change is likely to have a negative effect on meiosis, and therefore on wheat fertility and ultimately crop yields, so screening of germplasm collections to identify heat-tolerant genotypes is a high priority for future crop improvement. Moving forward, it will be important to determine the relative meiotic temperature tolerance of plants carrying these specific <italic>TaDMC1</italic> alleles growing under natural conditions. To further our understanding of the mechanisms by which DMC1 could be involved in stabilizing crossovers under temperature stress, it would be very informative to carry out future experiments involving transcription analysis and immunolocalization of DMC1 under normal conditions and after cold and heat stress.</p>
<p>For example, if the transcription levels of the <italic>DMC1-A1</italic> and/or <italic>DMC1-B1</italic> copies decreases under temperature stress in the <italic>dmc1-D1</italic> mutant, it is likely that DMC1 foci would also be reduced, suggesting a direct transcription-related effect. However, if transcription of the A and B copies remains unchanged between normal and stress conditions, but the number of DMC1 foci decreases, this could indicate a defect in nucleoprotein filament formation, associated with the stressful environment. These results should be compared or evaluated in relation to the expression levels of <italic>DMC1-D1</italic> and the number of DMC1 foci in Chinese Spring. Such analyses can provide us with a better understanding of the dynamics and dosage effect of the different <italic>TaDMC1</italic> copies, and serve as a starting point for investigating the molecular mechanisms underlying DMC1&#x2019;s role in stabilizing crossovers during episodes of temperature stress.</p>
</sec>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI Biosample database (<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/biosample">http://www.ncbi.nlm.nih.gov/biosample</ext-link>) under accession number PRJNA975063.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>TD grew and maintained the plants, made the crosses, carried out the KASP genotyping, sampled anthers and collected metaphase I images for scoring the phenotype, produced the corresponding figure and wrote the manuscript. M-DR scored chromosome crossover, performed the statistical analysis and produced the column chart. SH and MS developed the CRISPR <italic>Tadmc1-D1</italic> mutant in &#x2018;Chinese Spring&#x2019; using RNA-guided Cas9 and produced the supplementary figures; GM provided the concept, and with AM, provided thoughts and guidance, and revised and edited the manuscript. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the UK Biological and Biotechnology Research Council (BBSRC) through a grant as part of the &#x2018;Designing Future Wheat&#x2019; (DFW) Institute Strategic Programme (BB/P016855/1) and response mode grant (BB/R0077233/1). MD-R thanks the contract &#x201c;Ayudas Juan de la Cierva-Formaci&#xf3;n (FJCI-2016-28296)&#x201d; of the Spanish Ministry of Science, Innovation and Universities.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We thank the following John Innes Centre staff members: Martha Clarke of the Crop Transformation facility for her excellent technical support in the development of the CRISPR <italic>dmc1-D1</italic> mutant; Saleha Bakht, Molecular Genetics Platform Manager for sequencing services; the Germplasm Resource Unit for providing seed and the Horticultural Services Department for plant maintenance. We also acknowledge The International Atomic Energy Agency, Vienna for gamma irradiation of Chinese Spring seed to produce the original <italic>ttmei1</italic> mutant.</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2023.1208285/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2023.1208285/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Presentation_1.zip" id="SM1" mimetype="application/zip"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bannister</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>Pezza</surname> <given-names>R. J.</given-names>
</name>
<name>
<surname>Donaldson</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>de Rooij</surname> <given-names>D. G.</given-names>
</name>
<name>
<surname>Schimenti</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Camerini-Otero</surname> <given-names>R. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>A dominant, recombination-defective allele of <italic>Dmc1</italic> causing male-specific sterility</article-title>. <source>PloS Biol.</source> <volume>5</volume>, <elocation-id>e105</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pbio.0050105</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barber</surname> <given-names>H. M.</given-names>
</name>
<name>
<surname>Carney</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Alghabari</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Gooding</surname> <given-names>M. J.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Decimal growth stages for precision wheat production in changing environments</article-title>? <source>Ann. Appl. Biol.</source> <volume>166</volume>, <fpage>355</fpage>&#x2013;<lpage>371</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/aab.12207</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bayliss</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Riley</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1972</year>a). <article-title>An analysis of temperature-dependent asynapsis in <italic>Triticum aestivum</italic>
</article-title>. <source>Genet. Res.</source> <volume>20</volume> (<issue>2</issue>), <fpage>193</fpage>&#x2013;<lpage>200</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S0016672300013707</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bayliss</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Riley</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1972</year>b). <article-title>Evidence of premeiotic control of chromosome pairing in <italic>Triticum aestivum</italic>
</article-title>. <source>Genet. Res.</source> <volume>20</volume> (<issue>2</issue>), <fpage>201</fpage>&#x2013;<lpage>212</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1017/S0016672300013719</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bennett</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Chapman</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Riley</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1971</year>). <article-title>The duration of meiosis in pollen mother cells of wheat, rye and Triticale</article-title>. <source>Proc. R. Soc Lond. B.</source> <volume>178</volume>, <fpage>259</fpage>&#x2013;<lpage>275</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rspb.1971.0065</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bennett</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Rao</surname> <given-names>M. K.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Bayliss</surname> <given-names>M. W.</given-names>
</name>
</person-group> (<year>1973</year>). <article-title>The duration of meiosis in pollen mother cells of wheat, rye and Triticale</article-title>. <source>Phil. Trans. R. Soc B.</source> <volume>266</volume>, <fpage>39</fpage>&#x2013;<lpage>81</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rspb.1971.0065</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bennett</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Kemble</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1972</year>). <article-title>The effect of temperature on meiosis and pollen development in wheat and rye</article-title>. <source>Can. J. Genet. Cytol.</source> <volume>14</volume> (<issue>3</issue>), <fpage>615</fpage>&#x2013;<lpage>624</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1139/g72-076</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bilgir</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Dombecki</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>P. F.</given-names>
</name>
<name>
<surname>Villeneuve</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Nabeshima</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Assembly of the synaptonemal complex is a highly temperature-sensitive process that is supported by PGL-1 during <italic>Caenorhabditis elegans</italic> meiosis</article-title>. <source>G3-Genes Genom. Genet.</source> <volume>3</volume>, <fpage>585</fpage>&#x2013;<lpage>595</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1534/g3.112.005165</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bishop</surname> <given-names>D. K.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Kleckner</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>
<italic>DMC1</italic>: a meiosis-specific yeast homolog of E. coli <italic>recA</italic> required for recombination, synaptonemal complex formation, and cell cycle progression</article-title>. <source>Cell</source> <volume>69</volume>, <fpage>439</fpage>&#x2013;<lpage>456</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0092-8674(92)90446-J</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Bolser</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Staines</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Pritchard</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Kersey</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2016</year>). &#x201c;<article-title>Ensembl plants: integrating tools for visualizing, mining, and analyzing plant genomics data</article-title>,&#x201d; in  Ed. <person-group person-group-type="editor">
<name>
<surname>Edwards</surname> <given-names>D.</given-names>
</name>
</person-group> <source>Plant Bioinformatics. Methods Mol. Biol.</source>, vol. <volume>vol 1374</volume>. (<publisher-loc>New York, NY</publisher-loc>: <publisher-name>Humana Press</publisher-name>). doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-4939-3167-5_6</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bomblies</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Higgins</surname> <given-names>J. D.</given-names>
</name>
<name>
<surname>Yant</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Meiosis evolves: adaptation to external and internal environments</article-title>. <source>New Phytol.</source> <volume>208</volume>, <fpage>306</fpage>&#x2013;<lpage>323</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/nph.13499</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brown</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Bishop</surname> <given-names>D. K.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>DNA strand exchange and RecA homologs in meiosis</article-title>. <source>Cold Spring Harb. Perspect. Biol.</source> <volume>7</volume>, <elocation-id>a016659</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/cshperspect.a016659</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chapman</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>T. E.</given-names>
</name>
</person-group> (<year>1981</year>). <article-title>The location of a gene affecting meiotic chromosome pairing at low temperature in <italic>Triticum aestivum</italic>
</article-title>. <source>Z. Pflanzenz&#xfc;chtg</source> <volume>86</volume>, <fpage>50</fpage>&#x2013;<lpage>55</lpage>.</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Colas</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Barakate</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Macaulay</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Schreiber</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Stephens</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Vivera</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>
<italic>desynaptic5 carries</italic> a spontaneous semi-dominant mutation affecting <italic>Disrupted Meiotic cDNA 1</italic> in barley</article-title>. <source>J. Exp. Bot.</source> <volume>70</volume>, <fpage>2683</fpage>&#x2013;<lpage>2698</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jxb/erz080</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Couteau</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Belzile</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Horlow</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Grandjean</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Vezon</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Doutriaux</surname> <given-names>M.-P.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Random Chromosome Segregation without Meiotic Arrest in Both Male and Female Meiocytes of a <italic>dmc1</italic> Mutant of Arabidopsis</article-title>. <source>Plant Cell.</source> <volume>11</volume> (<issue>9</issue>), <fpage>1623</fpage>&#x2013;<lpage>1634</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1105/tpc.11.9.1623</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Da Ines</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Bazile</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gallego</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>White</surname> <given-names>C. I.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>DMC1 attenuates RAD51-mediated recombination in Arabidopsis</article-title>. <source>PloS Genet.</source> <volume>18</volume> (<issue>8</issue>), <elocation-id>e1010322</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pgen.1010322</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Debernardi</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Tricoli</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Ercoli</surname> <given-names>M. F.</given-names>
</name>
<name>
<surname>Hayta</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ronald</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Palatnik</surname> <given-names>J. F.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>A GRF&#x2013;GIF chimeric protein improves the regeneration efficiency of transgenic plants</article-title>. <source>Nat. Biotechnol.</source> <volume>38</volume>, <fpage>1274</fpage>&#x2013;<lpage>1279</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41587-020-0703-0</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>De Jaeger-Braet</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Krause</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Buchholz</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Schnittger</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Heat stress reveals a specialized variant of the pachytene checkpoint in meiosis of <italic>Arabidopsis thaliana</italic>
</article-title>. <source>Plant Cell</source> <volume>34</volume>, <fpage>433</fpage>&#x2013;<lpage>454</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/plcell/koab257</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Devisetty</surname> <given-names>U. K.</given-names>
</name>
<name>
<surname>Mayes</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Mayes</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>The <italic>RAD51</italic> and <italic>DMC1</italic> homoeologous genes of bread wheat: cloning, molecular characterization and expression analysis</article-title>. <source>BMC Res. Notes</source> <volume>3</volume>, <elocation-id>245</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1756-0500-3-245</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ding</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Chong</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Isolation and characterization of OsDMC1, the rice homologue of the yeast DMC1 gene essential for meiosis</article-title>. <source>Sex Plant Reprod.</source> <volume>13</volume>, <fpage>285</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s004970100065</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dowrick</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>1957</year>). <article-title>The influence of temperature on meiosis</article-title>. <source>Heredity</source> <volume>11</volume>, <fpage>37</fpage>&#x2013;<lpage>49</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/hdy.1957.4</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Draeger</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Mart&#xed;n</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Alabdullah</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Pendle</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Rey</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Shaw</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>
<italic>Dmc1</italic> is a candidate for temperature tolerance during wheat meiosis</article-title>. <source>Theor. Appl. Genet.</source> <volume>133</volume>, <fpage>809</fpage>&#x2013;<lpage>828</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00122-019-03508-9</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Draeger</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Moore</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Short periods of high temperature during meiosis prevent normal meiotic progression and reduce grain number in hexaploid wheat (<italic>Triticum aestivum</italic> L.)</article-title>. <source>Theor. Appl. Genet.</source> <volume>130</volume>, <fpage>1785</fpage>&#x2013;<lpage>1800</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00122-017-2925-1</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Draeger</surname> <given-names>T. N.</given-names>
</name>
<name>
<surname>Rey</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Mart&#xed;n</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Hayta</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Smedley</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Alabdullah</surname> <given-names>A. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>
<italic>ZIP4</italic> is required for normal progression of synapsis and for over 95% of crossovers in wheat meiosis</article-title>. <source>Front. Plant Sci.</source> <volume>14</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2023.1189998</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dreissig</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Fuchs</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Himmelbach</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mascher</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Houben</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Sequencing of single pollen nuclei reveals meiotic recombination events at megabase resolution and circumvents segregation distortion caused by postmeiotic processes</article-title>. <source>Front. Plant Sci.</source> <volume>8</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2017.01620</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elliott</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1955</year>). <article-title>The effect of temperature on chiasma frequency</article-title>. <source>Heredity</source> <volume>9</volume>, <fpage>385</fpage>&#x2013;<lpage>398</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/hdy.1955.39</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Emmenecker</surname> <given-names>C.</given-names>
</name>
<name>
<surname>M&#xe9;zard</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Repair of DNA double-strand breaks in plant meiosis: role of eukaryotic RecA recombinases and their modulators</article-title>. <source>Plant Reprod.</source> <volume>36</volume>, <fpage>17</fpage>&#x2013;<lpage>41</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00497-022-00443-6</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fischer</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Maurer</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1976</year>). <article-title>Crop temperature modification and yield potential in a dwarf spring wheat</article-title>. <source>Crop Sci.</source> <volume>16</volume>, <fpage>855</fpage>&#x2013;<lpage>859</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2135/cropsci1976.0011183X001600060031x</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gennaro</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Forte</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Panichi</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Lafiandra</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Pagnotta</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>D'Egidio</surname> <given-names>M. G.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Stacking small segments of the 1D chromosome of bread wheat containing major gluten quality genes into durum wheat: transfer strategy and breeding prospects</article-title>. <source>Mol. Breed.</source> <volume>30</volume>, <fpage>149</fpage>&#x2013;<lpage>167</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11032-011-9606-6</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hayta</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Smedley</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Clarke</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Forner</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Harwood</surname> <given-names>W. A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>An efficient <italic>Agrobacterium</italic>-mediated transformation protocol for hexaploid and tetraploid wheat</article-title>. <source>Curr. Protoc.</source> <volume>1</volume>, <elocation-id>e58</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cpz1.58</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hayta</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Smedley</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Demir</surname> <given-names>S. U.</given-names>
</name>
<name>
<surname>Blundell</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Hinchliffe</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Atkinson</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>An efficient and reproducible <italic>Agrobacterium</italic>-mediated transformation method for hexaploid wheat (<italic>Triticum aestivum</italic> L.)</article-title>. <source>Plant Methods</source> <volume>15</volume>, <fpage>121</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13007-019-0503-z</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Hayter</surname> <given-names>A. M.</given-names>
</name>
</person-group> (<year>1969</year>). &#x201c;<article-title>Cytogenetics and cytochemistry of wheat species</article-title>,&#x201d; (<publisher-loc>Cambridge</publisher-loc>: <publisher-name>Cambridge University</publisher-name>). PhD thesis.</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hayter</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Riley</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1967</year>). <article-title>Duplicate Genetic Activities affecting Meiotic Chromosome Pairing at Low Temperatures in <italic>Triticum</italic>
</article-title>. <source>Nature</source> <volume>216</volume>, <fpage>1028</fpage>&#x2013;<lpage>1029</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/2161028a0</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Higgins</surname> <given-names>J. D.</given-names>
</name>
<name>
<surname>Perry</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Barakate</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ramsay</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Waugh</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Halpin</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Spatiotemporal asymmetry of the meiotic program underlies the predominantly distal distribution of meiotic crossovers in barley</article-title>. <source>Plant Cell</source> <volume>24</volume> (<issue>10</issue>), <fpage>4096</fpage>&#x2013;<lpage>4109</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1105/tpc.112.102483</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<collab>International Wheat Genome Sequencing Consortium (IWGSC)</collab>
</person-group> (<year>2018</year>). <article-title>Shifting the limits in wheat research and breeding using a fully annotated reference genome</article-title>. <source>Science</source> <volume>362</volume>, <elocation-id>7191</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.aar7191</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ji</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Xia</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Effects of jointing and booting low temperature stresses on grain yield and yield components in wheat</article-title>. <source>Agric. For. Meteorol.</source> <volume>243</volume>, <fpage>33</fpage>&#x2013;<lpage>42</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.agrformet.2017.04.016</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jones</surname> <given-names>G. H.</given-names>
</name>
<name>
<surname>Franklin</surname> <given-names>F. C. H.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Meiotic crossing-over: Obligation and interference</article-title>. <source>Cell</source> <volume>126</volume>, <fpage>246</fpage>&#x2013;<lpage>248</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cell.2006.07.010</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karihaloo</surname> <given-names>J. L.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Desynapsis due to temperature stress in three species of Solanum L</article-title>. <source>Cytologia</source> <volume>56</volume>, <fpage>603</fpage>&#x2013;<lpage>611</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1508/cytologia.56.603</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lambing</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Franklin</surname> <given-names>F. C. H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C.-J. R.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Understanding and manipulating meiotic recombination in plants</article-title>. <source>Plant Physiol.</source> <volume>173</volume>, <fpage>1530</fpage>&#x2013;<lpage>1542</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.16.01530</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lazo</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Stein</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ludwig</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>A DNA transformation&#x2013;competent <italic>Arabidopsis</italic> genomic library in <italic>Agrobacterium</italic></article-title>. <source>Nat. Biotechnol</source> <volume>9</volume>, <fpage>963</fpage>&#x2013;<lpage>967</lpage> doi: <pub-id pub-id-type="doi">10.1038/nbt1091-963</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Recent advances in CRISPR/Cas9 and applications for wheat functional genomics and breeding</article-title>. <source>aBIOTECH.</source> <volume>2</volume> (<issue>4</issue>), <fpage>375</fpage>&#x2013;<lpage>385</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s42994-021-00042-5</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname> <given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2-&#x394;&#x394;CT method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mart&#xed;n</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Rey</surname> <given-names>M.-D.</given-names>
</name>
<name>
<surname>Shaw</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Moore</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Dual effect of the wheat <italic>Ph1</italic> locus on chromosome synapsis and crossover</article-title>. <source>Chromosoma</source> <volume>126</volume>, <fpage>669</fpage>&#x2013;<lpage>680</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00412-017-0630-0</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mart&#xed;n</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Shaw</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Phillips</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Reader</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Moore</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Licensing MLH1 sites for crossover during meiosis</article-title>. <source>Nat. Commun.</source> <volume>5</volume>, <fpage>4580</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ncomms5580</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miller</surname> <given-names>T. E.</given-names>
</name>
<name>
<surname>Reader</surname> <given-names>S. M.</given-names>
</name>
</person-group> (<year>1985</year>). <article-title>The effect of increased dosage of wheat chromosomes on chromosome pairing and an analysis of the chiasma frequencies of individual wheat bivalents</article-title>. <source>Can. J. Genet. Cytol.</source> <volume>27</volume>, <fpage>421</fpage>&#x2013;<lpage>425</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1139/g85-062</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morgan</surname> <given-names>C. H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Bomblies</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Are the effects of elevated temperature on meiotic recombination and thermotolerance linked via the axis and synaptonemal complex</article-title>? <source>Phil. Trans. R. Soc B.</source> <volume>372</volume>, <fpage>20160470</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1098/rstb.2016.0470</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Neale</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Keeney</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Clarifying the mechanics of DNA strand exchange in meiotic recombination</article-title>. <source>Nature</source> <volume>442</volume>, <fpage>153</fpage>&#x2013;<lpage>158</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature04885</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Page</surname> <given-names>S. L.</given-names>
</name>
<name>
<surname>Hawley</surname> <given-names>R. S.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>The genetics and molecular biology of the synaptonemal complex</article-title>. <source>Ann. Rev. Cell Dev. Biol.</source> <volume>20</volume>, <fpage>525</fpage>&#x2013;<lpage>558</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.cellbio.19.111301.155141</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pallotta</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Warner</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Fox</surname> <given-names>R. L.</given-names>
</name>
<name>
<surname>Kuchel</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Jefferies</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Langridge</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Marker assisted wheat breeding in the southern region of Australia</article-title>. <source>Proc. 10th Int. Wheat Genet. Symp.</source> <volume>2</volume>, <fpage>789</fpage>&#x2013;<lpage>791</lpage>.</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pittman</surname> <given-names>D. L.</given-names>
</name>
<name>
<surname>Cobb</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Schimenti</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Wilson</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>Cooper</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Brignull</surname> <given-names>E.</given-names>
</name>
<etal/>
</person-group>. (<year>1998</year>). <article-title>Meiotic prophase arrest with failure of chromosome synapsis in mice deficient for <italic>Dmc1</italic>, a germline-specific RecA homolog</article-title>. <source>Mol. Cell</source> <volume>1</volume>, <fpage>697</fpage>&#x2013;<lpage>705</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1097-2765(00)80069-6</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Porter</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Gawith</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Temperatures and the growth and development of wheat: a review</article-title>. <source>Eur. J. Agron.</source> <volume>10</volume>, <fpage>23</fpage>&#x2013;<lpage>36</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1161-0301(98)00047-1</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Queiroz</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mello-Sampayo</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Viegas</surname> <given-names>W. S.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Identification of low temperature stabilizing genes, controlling chromosome synapsis or recombination, in short arms of chromosomes from the homoeologous group 5 of <italic>Triticum aestivum</italic>
</article-title>. <source>Hereditas.</source> <volume>115</volume>, <fpage>37</fpage>&#x2013;<lpage>41</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1601-5223.1991.tb00344.x</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rey</surname> <given-names>M.-D.</given-names>
</name>
<name>
<surname>Mart&#xed;n</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Higgins</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Swarbreck</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Uauy</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Shaw</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Exploiting the ZIP4 homologue within the wheat <italic>Ph1</italic> locus has identified two lines exhibiting homoeologous crossover in wheat-wild relative hybrids</article-title>. <source>Mol. Breed.</source> <volume>37</volume>, <fpage>95</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11032-017-0700-2</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rey</surname> <given-names>M.-D.</given-names>
</name>
<name>
<surname>Mart&#xed;n</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Smedley</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Hayta</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Harwood</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Shaw</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Magnesium increases homoeologous crossover frequency during meiosis in <italic>ZIP4</italic> (<italic>Ph1</italic> Gene) mutant wheat-wild relative hybrids</article-title>. <source>Front. Plant Sci.</source> <volume>9</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2018.00509</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Riley</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1966</year>). &#x201c;<article-title>Genotype-environmental interaction affecting chiasma frequency in <italic>Triticum aestivum</italic>
</article-title>,&#x201d; in <source>Chromosomes today</source>, vol. <volume>vol 1</volume> . Eds. <person-group person-group-type="editor">
<name>
<surname>Darlington</surname> <given-names>C. D.</given-names>
</name>
<name>
<surname>Lewis</surname> <given-names>K. R.</given-names>
</name>
</person-group> (<publisher-loc>Edinburgh</publisher-loc>: <publisher-name>Oliver &amp; Boyd</publisher-name>), <fpage>57</fpage>&#x2013;<lpage>64</lpage>.</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riley</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Chapman</surname> <given-names>V.</given-names>
</name>
</person-group> (<year>1958</year>). <article-title>Genetic control of the cytologically diploid behaviour of hexaploid wheat</article-title>. <source>Nature</source> <volume>182</volume>, <fpage>713</fpage>&#x2013;<lpage>715</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/182713a0</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riley</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Chapman</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Young</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Bellfield</surname> <given-names>A. M.</given-names>
</name>
</person-group> (<year>1966</year>). <article-title>Control of meiotic chromosome pairing by the chromosomes of homoeologous group 5 of <italic>Triticum aestivum</italic>
</article-title>. <source>Nature</source> <volume>212</volume>, <fpage>1475</fpage>&#x2013;<lpage>1477</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/2121475a0</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saini</surname> <given-names>H. S.</given-names>
</name>
<name>
<surname>Aspinall</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>1982</year>). <article-title>Abnormal sporogenesis in wheat (<italic>Triticum aestivum</italic> L.) induced by short periods of high temperature</article-title>. <source>Ann. Bot.</source> <volume>49</volume> (<issue>6</issue>), <fpage>835</fpage>&#x2013;<lpage>846</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/oxfordjournals.aob.a086310</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sears</surname> <given-names>E. R.</given-names>
</name>
<name>
<surname>Okamoto</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>1958</year>). <article-title>Intergenomic chromosome relationships in hexaploid wheat</article-title>. <source>Proc. 10th Int. Congr. Genet.</source> <volume>2</volume>, <fpage>258</fpage>&#x2013;<lpage>259</lpage>.</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shinoyama</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Ichikawa</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Nishizawa-Yokoi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Skaptsov</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Toki</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Simultaneous TALEN-mediated knockout of chrysanthemum <italic>DMC1</italic> genes confers male and female sterility</article-title>. <source>Sci. Rep.</source> <volume>10</volume>, <fpage>16165</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-020-72356-1</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Smedley</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Hayta</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Clark</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Harwood</surname> <given-names>W. A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>CRISPR-Cas9 based genome editing in wheat</article-title>. <source>Curr. Protoc.</source> <volume>1</volume>, <elocation-id>e65</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cpz1.65</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Su</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Copenhaver</surname> <given-names>G. P.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>
<italic>Arabidopsis</italic> RAD51, RAD51C and XRCC3 proteins form a complex and facilitate RAD51 localization on chromosomes for meiotic recombination</article-title>. <source>PloS Genet.</source> <volume>13</volume> (<issue>5</issue>), <elocation-id>e1006827</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pgen.1006827</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Sybenga</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>1975</year>). <source>Meiotic Configurations</source> (<publisher-loc>Berlin</publisher-loc>: <publisher-name>Springer</publisher-name>). doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-3-642-80960-6</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Szurman-Zubrzycka</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Brygida</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Stolarek-Januszkiewicz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kwa&#x15b;niewska</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Szarejko</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Gruszka</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The dmc1 mutant allows an insight into the DNA double-strand break repair during meiosis in barley (<italic>Hordeum vulgare</italic> L.)</article-title>. <source>Front. Plant Sci.</source> <volume>10</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2019.00761</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taagen</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Bogdanove</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Sorrells</surname> <given-names>M. E.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Counting on crossovers: controlled recombination for plant breeding</article-title>. <source>Trends Plant Sci.</source> <volume>25</volume> <issue>(5)</issue>, <fpage>455</fpage>&#x2013;<lpage>465</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tplants.2019.12.017</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>H. Y.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Diao</surname> <given-names>C. D.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>D. Y.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Phylogenetic analysis of tetraploid wheat based on nuclear DMC1 gene</article-title>. <source>Biochem. Syst. Ecol.</source> <volume>70</volume>, <fpage>239</fpage>&#x2013;<lpage>246</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bse.2016.10.022</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thakur</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Malik</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Berger</surname> <given-names>J. D.</given-names>
</name>
<name>
<surname>Nayyar</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Cold stress effects on reproductive development in grain crops: an overview</article-title>. <source>Environ. Exp. Bot.</source> <volume>67</volume>, <fpage>429</fpage>&#x2013;<lpage>443</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.envexpbot.2009.09.004</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tottman</surname> <given-names>D. R.</given-names>
</name>
</person-group> (<year>1987</year>). <article-title>The decimal code for the growth stages of cereals, with illustrations</article-title>. <source>Ann. Appl. Biol.</source> <volume>110</volume>, <fpage>441</fpage>&#x2013;<lpage>454</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1744-7348.1987.tb03275.x</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Du</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>OsDMC1 is not required for homologous pairing in rice meiosis</article-title>. <source>Plant Physiol.</source> <volume>171</volume>, <fpage>230</fpage>&#x2013;<lpage>241</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.16.00167</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Werner</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Engler</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Weber</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Gruetzner</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Marillonnet</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Fast track assembly of multigene constructs using Golden Gate cloning and the MoClo system</article-title>. <source>Bioeng. Bugs.</source> <volume>3</volume> (<issue>1</issue>), <fpage>38</fpage>&#x2013;<lpage>43</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4161/bbug.3.1.18223</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Winfield</surname> <given-names>M. O.</given-names>
</name>
<name>
<surname>Allen</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Burridge</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Barker</surname> <given-names>G. L. A.</given-names>
</name>
<name>
<surname>Benbow</surname> <given-names>H. R.</given-names>
</name>
<name>
<surname>Wilkinson</surname> <given-names>P. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>High-density SNP genotyping array for hexaploid wheat and its secondary and tertiary gene pool</article-title>. <source>Plant Biotechnol. J.</source> <volume>14</volume>, <fpage>1195</fpage>&#x2013;<lpage>1206</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/pbi.12485</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yazawa</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Nakayama</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Fujimoto</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Matsuda</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Abe</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Kitano</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Abnormal spermatogenesis at low temperatures in the Japanese red-bellied newt, <italic>Cynops pyrrhogaster</italic>: Possible biological significance of the cessation of spermatocytogenesis</article-title>. <source>Mol. Reprod. Dev.</source> <volume>66</volume>, <fpage>60</fpage>&#x2013;<lpage>66</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/mrd.10328</pub-id>
</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yoshida</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Kondoh</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Matsuda</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Habu</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Nishimune</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Morita</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>The mouse <italic>RecA</italic>-like gene <italic>Dmc1</italic> is required for homologous chromosome synapsis during meiosis</article-title>. <source>Mol. Cell</source> <volume>1</volume>, <fpage>707</fpage>&#x2013;<lpage>718</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1097-2765(00)80070-2</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zadoks</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>T. T.</given-names>
</name>
<name>
<surname>Konzak</surname> <given-names>C. F.</given-names>
</name>
</person-group> (<year>1974</year>). <article-title>A decimal code for the growth stages of cereals</article-title>. <source>Weed Res.</source> <volume>14</volume>, <fpage>415</fpage>&#x2013;<lpage>421</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-3180.1974.tb01084.x</pub-id>
</citation>
</ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zickler</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Kleckner</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Meiotic chromosomes: integrating structure and function</article-title>. <source>Ann. Rev. Genet.</source> <volume>33</volume> (<issue>1</issue>), <fpage>603</fpage>&#x2013;<lpage>754</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.genet.33.1.603</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>