<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1203089</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Effect of temperature on betacyanins synthesis and the transcriptome of <italic>Suaeda salsa</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Min</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1734966"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>He</surname>
<given-names>Peimin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/794508"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Zitao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2330806"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Jinlin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1556298"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Hongtao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2289780"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ma</surname>
<given-names>Shaozu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2282679"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shen</surname>
<given-names>Yifei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2281857"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Bin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2281674"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>School of Marine Ecology and Environment, Shanghai Ocean University</institution>, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Engineering Research Center for Water Environment Ecology in Shanghai</institution>, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University</institution>, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Guan Bo, Ludong University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Lei Wang, Chinese Academy of Sciences (CAS), China; Jie Song, Shandong Normal University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Peimin He, <email xlink:href="mailto:pmhe@shou.edu.cn">pmhe@shou.edu.cn</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>26</day>
<month>06</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1203089</elocation-id>
<history>
<date date-type="received">
<day>10</day>
<month>04</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>02</day>
<month>06</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Li, He, Zhao, Liu, Liu, Ma, Shen and Li</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Li, He, Zhao, Liu, Liu, Ma, Shen and Li</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>
<italic>Suaeda salsa</italic> (Linn.) Pall. is an important tourist resource and ecological restoration species in coastal wetlands. Environmental factors such as low temperature, darkness, phytohormone, salt stress and seawater flflooding, and light can induce betalain synthesis in <italic>S. salsa</italic>, which plays an important role in plant adaptation to abiotic stress processes and in shaping the beautiful &#x201c;red beach&#x201d; landscape.</p>
</sec>
<sec>
<title>Methods</title>
<p>In this study, Illumina sequencing was used to profifile the transcriptome sequence (RNA-Seq) of <italic>S. salsa</italic> leaves at different temperatures (5&#xb0; C, 10&#xb0;C, 15&#xb0;C, 20&#xb0;C, 25&#xb0;C, and 30&#xb0;C) and to validate differentially expressed genes (DEGs) indicated by real-time PCR (RT-qPCR).</p>
</sec>
<sec>
<title>Results</title>
<p>The betacyanin content was highest in <italic>S. salsa</italic> leaves at 15&#xb0;C. Transcription group data showed that compared to the control group (15&#xb0;C), the &#x201c;betacyanin biosynthesis pathway&#x201d; was signifificantly enriched in the fifive different temperature groups. KEGG analysis showed that the DEGs were mainly involved in pathways of phenylpropanoid biosynthesis, carbon fifixation in photosynthetic organisms, flflavonoid biosynthesis, and betacyanin biosynthesis. Among the key enzymes involved in biosynthesis of betacyanin, genes for tyrosinase, CYP76AD1 and 4,5-DOPA dioxygenase were signifificantly upregulated and most abundantly expressed at 15&#xb0;C. It is possible that the gene for betacyanin synthesis from <italic>S. salsa</italic> is primarily regulated by the MYB1R1 and MYB1 transcription factor. Four DEGs were randomly selected for quantitative PCR analysis, and DEG expression was generally consistent with the RNA-Seq data, verifying the validity of the transcriptome sequencing data.</p>
</sec>
<sec>
<title>Discussion</title>
<p>Relative to other temperatures, 15&#xb0;C was optimum for <italic>S. salsa</italic> betacyanin synthesis, and this provides a theoretical reference for coastal wetland ecological remediation, reveals mechanisms of <italic>S. salsa</italic> discoloration, and further mines its potential application for landscape vegetation.</p>
</sec>
</abstract>
<kwd-group>
<kwd>
<italic>Suaeda salsa</italic>
</kwd>
<kwd>transcriptome</kwd>
<kwd>betacyanins</kwd>
<kwd>temperature</kwd>
<kwd>coastal wetlands</kwd>
</kwd-group>
<counts>
<fig-count count="10"/>
<table-count count="5"/>
<equation-count count="0"/>
<ref-count count="48"/>
<page-count count="15"/>
<word-count count="5996"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Functional Plant Ecology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>In recent years, under the influence of various factors such as global climate anomalies, intensified human activities, and sea level rise, the area of global coastal wetlands has decreased sharply, and the ecological environment and wetland animal and plant diversity have been damaged to varying degrees (<xref ref-type="bibr" rid="B44">Zhang, 2022</xref>). Since the 1950s, the total area of coastal wetlands in China has decreased by more than 50%, including a 59% reduction in the area of salt marsh vegetation (<xref ref-type="bibr" rid="B43">Yang et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B13">Gu et&#xa0;al., 2018</xref>). There have been many studies on ecological restoration measures for <italic>Suaeda salsa</italic> (Linn.) Pall. communities in degraded saline lands (<xref ref-type="bibr" rid="B34">Sui et&#xa0;al., 2013</xref>), but the mechanism responsible for betacyanin change remains unclear (<xref ref-type="bibr" rid="B18">Jia et&#xa0;al., 2018</xref>).</p>
<p>
<italic>Suaeda salsa</italic> is an annual halophytic herb, belonging to the Amaranthaceae, Caryophyllaceae (<xref ref-type="bibr" rid="B22">Liu et&#xa0;al., 2022</xref>). Planting <italic>S. salsa</italic> can effectively reduce soil salinity and play an important role in wetland purification and ecological restoration of saline and alkaline lands (<xref ref-type="bibr" rid="B4">Cong et&#xa0;al., 2013</xref>). <italic>Suaeda salsa</italic> contains betacyanins, which are very important natural plant pigments with high antioxidant and antibacterial activities (<xref ref-type="bibr" rid="B12">Gengatharan et&#xa0;al., 2015</xref>), and are widely used in food processing, medicine, pharmacy, and other fields (<xref ref-type="bibr" rid="B25">Ninfali et&#xa0;al., 2017</xref>). Due to the presence of betacyanins, <italic>S. salsa</italic> plants are bright red. In the deep autumn, large areas of <italic>S. salsa</italic> form a &#x201c;red beach,&#x201d; which is of great ornamental value in intertidal mudflat areas. However, there have been few studies on the landscape ecology of betacyanins, particularly at the molecular level. Therefore, exploring the synthesis and regulation mechanism of betacyanins in <italic>S. salsa</italic> can provide theoretical reference for further exploring its potential application value as landscape vegetation.</p>
<p>Previous studies showed three main pathways for the betacyanin synthesis from <italic>S. salsa</italic>: betalain and cyclo-DOPA react to form betanin, glycosylated cycloDOPA, and the tyrosine-betaxanthinc pathways. Among them, the betalain and cyclo-DOPA react to form betanin pathway has been most studied (<xref ref-type="bibr" rid="B18">Jia et&#xa0;al., 2018</xref>). Tyrosinase, 4,5-DOPA-extradiol-dioxygenase (DOD), 5-O-glucosyl transferase (5GT) and CYP76AD1 encoding a novel cytochrome P450 are the four key enzymes in betacyanin biosynthesis, with their activities positively correlated with <italic>S. salsa</italic> betacyanin content (<xref ref-type="bibr" rid="B10">Gandia and Garcia, 2019</xref>). Research on betacyanin biosynthesis and regulation has mainly focused on the aldosine-cycloDOPA pathway and the three key enzymes mentioned above.</p>
<p>Light, temperature, and salinity are the most critical factors affecting betacyanin biosynthesis. It has not yet been possible to regulate cultivation of all-red <italic>S. salsa</italic> plants throughout their life cycle under laboratory conditions. Darkness, high salt, and low temperature are beneficial to betacyanin accumulation in <italic>S. salsa</italic>. Dark treatment during seed germination is important for triggering betacyanin accumulation in <italic>S. salsa</italic> (<xref ref-type="bibr" rid="B11">Gandia-Herrero et&#xa0;al., 2005</xref>). At the same time, tyrosinase activity can only be detected in <italic>S. salsa</italic> cultivated in darkness (<xref ref-type="bibr" rid="B40">Wang, 2009</xref>). <xref ref-type="bibr" rid="B47">Zheng et&#xa0;al. (2015)</xref> studied the effect of different light qualities on betacyanin synthesis of <italic>Amaranthus tricolor</italic> L., and showed that blue light was more favorable than red and green light. Soil salinity has a significant impact on composition of pigments in <italic>S. salsa</italic> leaves, and there is a positive correlation between soil Na<sup>+</sup> content and betacyanin content in <italic>S. salsa</italic> leaves (<xref ref-type="bibr" rid="B47">Zheng et&#xa0;al., 2015</xref>). However, single-factor salt treatment is not conducive to betacyanin accumulation in <italic>S. salsa</italic>, and there is a significant negative correlation between salt concentration and betacyanin content (<xref ref-type="bibr" rid="B21">Li et&#xa0;al., 2018</xref>). Combined salt and nitrogen treatment can significantly increase <italic>S. salsa</italic> betacyanin content (<xref ref-type="bibr" rid="B46">Zhao et&#xa0;al., 2020</xref>).</p>
<p>Temperature has a significant impact on betacyanin stability, and high temperature can inhibit the betacyanin synthesis in <italic>A. tricolor</italic> and <italic>Beta vulgaris</italic> L.; low temperature is not conducive to betacyanin degradation (<xref ref-type="bibr" rid="B8">Elliott, 1979</xref>; <xref ref-type="bibr" rid="B5">Cui, 2020</xref>; <xref ref-type="bibr" rid="B32">Sokolova et&#xa0;al., 2022</xref>). <xref ref-type="bibr" rid="B28">Ruan (2008)</xref> cloned the promoter <italic>Ss DODA</italic> of the gene for 4,5-DOPA dioxygenase from the <italic>S. salsa</italic> genome using TAIL-PCR technology, and showed that this promoter contained a low-temperature response element (LTR; CCGAAA). Further studies showed that low temperature is beneficial for upregulation of the gene for 4,5-DOPA dioxygenase in <italic>S. salsa</italic>, and promotes betacyanin biosynthesis in <italic>S. salsa</italic> (<xref ref-type="bibr" rid="B41">Wang, 2011</xref>). The mechanism of the effect of different temperatures on betacyanin synthesis and metabolism in <italic>S. salsa</italic> needs further study.</p>
<p>This study employed transcriptome technology to explore the molecular response mechanism of <italic>S. salsa</italic> betacyanin synthesis to external temperature (using a temperature gradient of 5&#xb0;C, 10&#xb0;C, 15&#xb0;C, 20&#xb0;C, 25&#xb0;C, and 30&#xb0;C), and to reveal the optimal temperature for synthesis. The purpose is to provide a theoretical basis for in-depth discussion of the coloration mechanism of <italic>S. salsa</italic>, and to provide a reference for restoration of the <italic>S. salsa</italic> community in coastal wetlands of northern China and to add a touch of &#x201c;red beach.&#x201d;</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Plant sample</title>
<p>The <italic>S. salsa</italic> seeds used in this experiment were purchased from Suqian City, Jiangsu Province in December 2021. In January 2022, full <italic>S. salsa</italic> black seeds were selected and sterilized with 1% potassium permanganate solution for 20&#xa0;min, followed by repeated rinsing with sterile water. After soaking for 24&#xa0;h, they were sown in a flowerpot with holes at the bottom, cultured under conditions of diurnal temperature of 25/20&#xb0;C (light intensity 600 &#x3bc;mol m<sup>&#x2212;2</sup> s<sup>&#x2212;1</sup>, 14-/10-h light/dark cycle), and irrigated daily with half-strength Hoagland nutrient solution containing 100 mmol&#xb7;l<sup>&#x2212;1</sup> NaCl. When the sixth pair of leaves of <italic>S. salsa</italic> grew steadily, seedlings with good and consistent growth condition were selected and placed in a light incubator at 5&#xb0;C, 10&#xb0;C, 15&#xb0;C, 20&#xb0;C, 25&#xb0;C, and 30&#xb0;C for a 4-day culture experiment, with three parallel sets for each temperature gradient. After culture, the same part of leaves of three parallel plants in each temperature group were combined into one sample, and quickly rinsed with ultra-pure water to remove surface sludge. Excess water was absorbed with filter paper, and the leaves were cut into 0.5&#xa0;cm &#xd7; 0.5&#xa0;cm pieces, placed in a 1.5-ml enzyme-free centrifuge tube, quickly frozen in liquid nitrogen, and stored in a refrigerator at &#x2212;80&#xb0;C for subsequent analysis.</p>
</sec>
<sec id="s2_2">
<title>Determination of betacyanin content</title>
<p>Determination of betacyanin content of <italic>S. salsa</italic> was based on the method of <xref ref-type="bibr" rid="B20">Li (2021)</xref>, with appropriate improvements. Leaves (0.2&#xa0;g) were taken from the same part of different treatments and ground under liquid nitrogen, then extracted with 20&#xa0;ml of methanol for 30&#xa0;min, and centrifuged at 4&#xb0;C and 11,000 g for 10&#xa0;min. The supernatant was discarded and the residue was extracted three times with methanol. The precipitate was extracted with 20&#xa0;ml of pure water for 30&#xa0;min, centrifuged at 4&#xb0;C and 16000&#xa0;g for 10&#xa0;min, and the supernatant was taken. This operation was repeated three times until the betacyanins were completely extracted. Finally, the collected pure water extract was brought to a constant volume. The absorbance value at 538 nm was measured using an ultraviolet spectrophotometer, and the relative betacyanin content was expressed using OD538. Statistical calculations and analysis of variance were performed using Excel 2019 for the data.</p>
</sec>
<sec id="s2_3">
<title>Library preparation and illumina hiseq X ten sequencing</title>
<p>Total RNA in <italic>S. salsa</italic> leaves was extracted from the six temperature gradient groups. The RNA library preparation and transcriptome sequencing were completed by Shanghai Majorbio Bio-Pharm Technology Co., Ltd (<ext-link ext-link-type="uri" xlink:href="http://www.majorbio.com">www.majorbio.com</ext-link>). The samples were divided into six groups: Ss5, Ss10, Ss15, Ss20, Ss25, and Ss30 for 5&#xb0;C, 10&#xb0;C, 15&#xb0;C, 20&#xb0;C, 25&#xb0;C, and 30&#xb0;C, respectively. Based on the Illumina Novaseq 6000 sequencing platform, a library was constructed using the Illumina TruseqTM RNA sample prep kit. A Nanodrop2000 was used to determine the concentration and purity of the extracted RNA, agarose gel electrophoresis was used to detect the integrity of RNA, and an Agilent 2100 was used to determine the RIN value. Oligo dT was used to enrich mRNA, under the action of reverse transcriptase, with six-base random primers added to invert the segmented mRNA into cDNA, then connected to the adapter, and finally sequenced on the Illumina platform, to compare the sequencing data and assembly results. Differential gene expression analysis was performed using DEseq2. In order to understand the molecular function of differentially expressed genes (DEGs) or the metabolic pathways and biological processes involved, GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genome) enrichment analysis were conducted (<xref ref-type="bibr" rid="B19">Khorramdelazad et&#xa0;al., 2018</xref>).</p>
</sec>
<sec id="s2_4">
<title>Quantitative real-time-PCR verification</title>
<p>To verify the transcriptome sequencing analysis results, four DEGs (two upregulated and two downregulated) were randomly selected from two differential groups, Ss15vsSs20 (i.e. Ss15 vs. Ss20) and Ss15vsSs25, for qRT-PCR detection. <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref> shows the primers designed for five genes. Referring to the method of <xref ref-type="bibr" rid="B26">Nolan et&#xa0;al. (2006)</xref>, RNA was extracted and the actin gene family <italic>ActinF</italic> was selected as the internal reference gene. The cDNA was synthesized by reverse transcription using HiScript Q RT SuperMix for qPCR (+gDNA wiper), ChamQ SYBR Color qPCR Master Mix (2X) was selected as the quantitative PCR reagent, and RT-qPCR analysis was performed using an ABI7300 type fluorescence quantitative PCR instrument (Applied Biosystems, USA), in accordance with the manufacturer&#x2019;s instructions. The 2<sup>&#x2212;&#x394;&#x394;CT</sup> method was used for experimental data analysis.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The primer sequences used for qRT-PCR.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Gene id</th>
<th valign="middle" align="center">Sequence (5&#x2032;-3&#x2032;)</th>
<th valign="middle" align="center">Product size (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">TRINITY_DN24971_c0_g1</td>
<td valign="middle" align="left">F:AGCAGGCAGTCAAGGAGTA<break/>R:AAGAAGCCTAACCAAGCAA</td>
<td valign="middle" align="left">252</td>
</tr>
<tr>
<td valign="middle" align="left">TRINITY_DN1758_c0_g1</td>
<td valign="middle" align="left">F:GAGCCTGAACCAGTAAGAA<break/>R:GAATAATAAGCCCATAACCT</td>
<td valign="middle" align="left">268</td>
</tr>
<tr>
<td valign="middle" align="left">TRINITY_DN14253_c0_g1</td>
<td valign="middle" align="left">F:GTTCGTCGGATCTCACTT<break/>R:GTTCCCACCACATTTGTC</td>
<td valign="middle" align="left">255</td>
</tr>
<tr>
<td valign="middle" align="left">TRINITY_DN4658_c0_g1</td>
<td valign="middle" align="left">F:TAGGACAGTTGCCAAAGGA<break/>R:CACCACCACAATCATCAGC</td>
<td valign="middle" align="left">189</td>
</tr>
<tr>
<td valign="middle" align="left">Actin F</td>
<td valign="middle" align="left">F:GCTCTACCCCATGCAATCCT<break/>R:TGCTCTTGGCAGTCTCTGATT</td>
<td valign="middle" align="left">190</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_5">
<title>Phylogenetic tree construction</title>
<p>Using the NCBI BLAST network server, protein sequences were identified and amino acid sequences of the same family in the same or different species were found and retrieved from GenBank. Phylogenetic trees for analysis of TYRs, UGTs, CYP450s, DODAs were generated using MEGA11 software (<xref ref-type="bibr" rid="B36">Tamura et&#xa0;al., 2021</xref>). Node support was assessed using a bootstrap procedure based on 1000 replicates.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Temperature and betacyanin content</title>
<p>Temperature had a significant impact on <italic>S. salsa</italic> betacyanin biosynthesis (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). At 15&#xb0;C, the relative content of betacyanin in <italic>S. salsa</italic> leaves was the highest (absorbance value 0.1283), followed by 5&#xb0;C (0.086) and 10&#xb0;C (0.078). As temperature rose above 15&#xb0;C, the betacyanin content decreased significantly (<italic>P</italic> &lt; 0.05) in the following order: 20&#xb0;C (absorbance value 0.053) &gt; 25&#xb0;C (0.049) &gt; 30&#xb0;C (0.046).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Differences in betacyanin content in <italic>S. salsa</italic> leaves under different temperature conditions. Lowercase letters indicate differences between groups under different temperature treatment conditions (<italic>P</italic> &lt; 0.05). The error bars show std error.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>Transcriptome sequencing analysis</title>
<p>To further explore the differences in gene expression in <italic>S. salsa</italic> leaves under different temperature conditions, transcriptome sequencing was performed on leaves at the same location from the six temperature groups. After RNA extraction and library construction, transcriptome sequencing was performed based on the Illumina platform. Transcriptome analysis of six samples was completed, and a total of 41.51Gb of clean data were obtained. Clean data of each sample exceeded 6.46 Gb, and the base percentage of Q30 was above 94.21% (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Trinity was used to reassemble all sample clean data from scratch, and to optimize and evaluate the assembly results. The number of unigenes assembled was 56,156, the number of transcripts was 93,108, and the average length of N50 was 1695 bp (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>). The clean reads of each sample were compared with the reference sequence obtained by Trinity assembly to obtain the mapping results for each sample. The analysis and comparison rates for the six samples were in the range of 81.84&#x2013;84.87% (<xref ref-type="table" rid="T4">
<bold>Table&#xa0;4</bold>
</xref>). The above results indicate that the transcriptome data obtained in this experiment were reliable and met the requirements for subsequent quantitative analysis of gene expression.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Sequencing data statistics. Raw reads and raw bases represent the total number of entries and total data volume of the original sequencing data, respectively.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Sample</th>
<th valign="middle" align="center">Raw reads</th>
<th valign="middle" align="center">Raw bases</th>
<th valign="middle" align="center">Clean reads</th>
<th valign="middle" align="center">Clean bases</th>
<th valign="middle" align="center">Error rate(%)</th>
<th valign="middle" align="center">Q20<break/>(%)</th>
<th valign="middle" align="center">Q30<break/>(%)</th>
<th valign="middle" align="center">GC content(%)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">SS30</td>
<td valign="middle" align="center">45453016</td>
<td valign="middle" align="center">6863405416</td>
<td valign="middle" align="center">43912098</td>
<td valign="middle" align="center">6460833761</td>
<td valign="middle" align="center">0.0246</td>
<td valign="middle" align="center">98.12</td>
<td valign="middle" align="center">94.56</td>
<td valign="middle" align="center">43.29</td>
</tr>
<tr>
<td valign="middle" align="left">SS25</td>
<td valign="middle" align="center">45773734</td>
<td valign="middle" align="center">6911833834</td>
<td valign="middle" align="center">44109872</td>
<td valign="middle" align="center">6502311618</td>
<td valign="middle" align="center">0.025</td>
<td valign="middle" align="center">97.98</td>
<td valign="middle" align="center">94.21</td>
<td valign="middle" align="center">42.21</td>
</tr>
<tr>
<td valign="middle" align="left">SS20</td>
<td valign="middle" align="center">49617062</td>
<td valign="middle" align="center">7492176362</td>
<td valign="middle" align="center">48291196</td>
<td valign="middle" align="center">7066224480</td>
<td valign="middle" align="center">0.0243</td>
<td valign="middle" align="center">98.26</td>
<td valign="middle" align="center">94.89</td>
<td valign="middle" align="center">43.55</td>
</tr>
<tr>
<td valign="middle" align="left">SS15</td>
<td valign="middle" align="center">52026972</td>
<td valign="middle" align="center">7856072772</td>
<td valign="middle" align="center">50591722</td>
<td valign="middle" align="center">7225661138</td>
<td valign="middle" align="center">0.0241</td>
<td valign="middle" align="center">98.32</td>
<td valign="middle" align="center">95.07</td>
<td valign="middle" align="center">43.69</td>
</tr>
<tr>
<td valign="middle" align="left">SS10</td>
<td valign="middle" align="center">48275408</td>
<td valign="middle" align="center">7289586608</td>
<td valign="middle" align="center">47062338</td>
<td valign="middle" align="center">6927938593</td>
<td valign="middle" align="center">0.0247</td>
<td valign="middle" align="center">98.13</td>
<td valign="middle" align="center">94.47</td>
<td valign="middle" align="center">43.89</td>
</tr>
<tr>
<td valign="middle" align="left">SS5</td>
<td valign="middle" align="center">50912970</td>
<td valign="middle" align="center">7687858470</td>
<td valign="middle" align="center">50140758</td>
<td valign="middle" align="center">7322461426</td>
<td valign="middle" align="center">0.0241</td>
<td valign="middle" align="center">98.38</td>
<td valign="middle" align="center">95.01</td>
<td valign="middle" align="center">43.7</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Result of the <italic>de novo</italic> transcriptome assembly performed with Trinity.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Type</th>
<th valign="middle" align="center">Unigene</th>
<th valign="middle" align="center">Transcript</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">Total number</td>
<td valign="middle" align="center">56156</td>
<td valign="middle" align="center">93108</td>
</tr>
<tr>
<td valign="middle" align="center">Total base</td>
<td valign="middle" align="center">49676887</td>
<td valign="middle" align="center">94984784</td>
</tr>
<tr>
<td valign="middle" align="center">Largest length (bp)</td>
<td valign="middle" align="center">14516</td>
<td valign="middle" align="center">14516</td>
</tr>
<tr>
<td valign="middle" align="center">Smallest length (bp)</td>
<td valign="middle" align="center">201</td>
<td valign="middle" align="center">201</td>
</tr>
<tr>
<td valign="middle" align="center">Average length (bp)</td>
<td valign="middle" align="center">884.62</td>
<td valign="middle" align="center">1020.16</td>
</tr>
<tr>
<td valign="middle" align="center">N50 length (bp)</td>
<td valign="middle" align="center">1695</td>
<td valign="middle" align="center">1728</td>
</tr>
<tr>
<td valign="middle" align="center">E90N50 length (bp)</td>
<td valign="middle" align="center">2496</td>
<td valign="middle" align="center">2204</td>
</tr>
<tr>
<td valign="middle" align="center">Fragment mapped percent(%)</td>
<td valign="middle" align="center">71.886</td>
<td valign="middle" align="center">85.743</td>
</tr>
<tr>
<td valign="middle" align="center">GC percent (%)</td>
<td valign="middle" align="center">38.92</td>
<td valign="middle" align="center">38.93</td>
</tr>
<tr>
<td valign="middle" align="center">TransRate score</td>
<td valign="middle" align="center">0.29625</td>
<td valign="middle" align="center">0.35641</td>
</tr>
<tr>
<td valign="middle" align="center">BUSCO score</td>
<td valign="middle" align="center">C:74.0%[S:72.8%;D:1.2%]</td>
<td valign="middle" align="center">C:86.8%[S:52.6%;D:34.2%]</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T4" position="float">
<label>Table&#xa0;4</label>
<caption>
<p>Comparison of sequencing data and assembly results.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Sample</th>
<th valign="middle" align="center">Clean reads</th>
<th valign="middle" align="center">Mapped reads</th>
<th valign="middle" align="center">Mapped ratio</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">SS30</td>
<td valign="middle" align="center">21956049</td>
<td valign="middle" align="center">18034784</td>
<td valign="middle" align="center">82.14%</td>
</tr>
<tr>
<td valign="middle" align="center">SS25</td>
<td valign="middle" align="center">22054936</td>
<td valign="middle" align="center">18601353</td>
<td valign="middle" align="center">84.34%</td>
</tr>
<tr>
<td valign="middle" align="center">SS20</td>
<td valign="middle" align="center">24145598</td>
<td valign="middle" align="center">19759816</td>
<td valign="middle" align="center">81.84%</td>
</tr>
<tr>
<td valign="middle" align="center">SS15</td>
<td valign="middle" align="center">25295861</td>
<td valign="middle" align="center">21005473</td>
<td valign="middle" align="center">83.04%</td>
</tr>
<tr>
<td valign="middle" align="center">SS10</td>
<td valign="middle" align="center">23531169</td>
<td valign="middle" align="center">19839561</td>
<td valign="middle" align="center">84.31%</td>
</tr>
<tr>
<td valign="middle" align="center">SS5</td>
<td valign="middle" align="center">25070379</td>
<td valign="middle" align="center">21277521</td>
<td valign="middle" align="center">84.87%</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_3">
<title>DEG analysis</title>
<p>Based on the expression matrix, inter-sample Venn analysis was performed to obtain co-expression and specific expression genes between samples (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). There were 463 co-expressed genes in the six samples, with 1311, 1378, 1330, 1370, 1234, and 1319 genes specifically expressed in the Ss30, Ss25, Ss20, Ss15, Ss10, and Ss5 samples, respectively.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Differentially expressed gene (DEG) analysis. <bold>(A)</bold> Venn diagram of comparison of DEGs. <bold>(B)</bold> DEGs in Ss15vsSs30, Ss15vsSs25, Ss15vsSs20, Ss15vsSs10, and Ss15vsSs5. <bold>(C)</bold> Number of up-regulated and down-regulated genes in five different groups.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g002.tif"/>
</fig>
<p>Sample Ss15 was used as the control group, and samples Ss30, SS25, SS15, SS10, and SS5 as the experimental groups. Quantitative analysis of gene expression level was conducted using expression quantitative software RSEM, with the quantitative indicator being FPKM. The FPKM values of the six samples ranged within 0&#x2013;25,495.38, with an average value of 15.19. The DEGseq software was used for inter-group differential expression analysis, with the parameters set as <italic>P</italic>-adjust &lt; 0.01 and |log<sub>2</sub>FC| &#x2265; 2.&#xa0;A total of 903 DEGs were found in the five differential analysis groups (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). Compared with the control group (15&#xb0;C), there were 5812 DEGs at 30&#xb0;C, including 1721 upregulated and 4091 downregulated; 7762 DEGs at 25&#xb0;C, with 2456 upregulated and 5306 downregulated; 3094 DEGs at 20&#xb0;C, including 1463 upregulated and 2441 downregulated; 5492 DEGs at 10&#xb0;C, including 1620 upregulated and 3872 downregulated; and 4677 DEGs at 5&#xb0;C, including 1861 upregulated and 2816 downregulated (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>).</p>
</sec>
<sec id="s3_4">
<title>qRT-PCR verification</title>
<p>In order to verify the accuracy of RNA-seq detection, using Ss15 as a control group, four DEGs (two upregulated and two downregulated) were randomly selected from the two differential groups of Ss15vsSs20 and Ss15vsSs25 for qRT-PCR (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). Using RNA-seq and qRT-PCR as the abscissa and ordinate coordinates, respectively, the results were linearly regressed to fit the eight relative expression data of the four genes, with R<sup>2&#xa0;=&#xa0;</sup>0.8721 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>), indicating that the expression patterns of the four genes were basically consistent with the RNA-seq results, further illustrating the reliability of transcriptome data.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Expression of four differentially expressed genes (DEGs) in the transcriptome, verified by qRT-PCR. Fold changes are shown to verify the RNA-seq results. A <bold>(A)</bold> Genes used for validation from left to right: TRINITY_DN24971_c0_g1, TRINITY_DN1758_c0_g1, TRINITY_DN14253_c0_g1, and TRINITY_DN4658_c0_g1. <bold>(B)</bold> Linear regression fitting of RNA-seq and qRT-PCR DEGs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g003.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>GO enrichment analysis of DEGs</title>
<p>To further predict the function of DEGs, GO functional enrichment was used to analyze the DEGs in five groups: Ss15vsSs30, Ss15vsSs25, Ss15vsSs20, Ss15vsSs10, and Ss15vsSs5. The DEGs of the five differential comparison groups were basically annotated to the same GO category (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). Among the biological process categories, the three most representative GO categories were &#x201c;defense response (GO:0006952),&#x201d; &#x201c;carbohydrate metabolic process (GO:0005975),&#x201d; and &#x201c;transport activity.&#x201d; The category of molecular function mainly included &#x201c;oxidoreductase activity,&#x201d; &#x201c;endopeptidase regulator activity (GO:0061135),&#x201d; and &#x201c;peptidase inhibitor activity (GO:0030414).&#x201d; The classification of cell groups was mainly &#x201c;cell part,&#x201d; &#x201c;membrane part,&#x201d; and &#x201c;organelle&#x201d; (<italic>P</italic> &lt; 0.05).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Gene ontology (GO) annotation analysis of DEGs in pairwise comparisons between the control (SS15) and other temperature treatments: <bold>(A)</bold> SS15vsSS30, <bold>(B)</bold> SS15vsSS25, <bold>(C)</bold> SS15vsSS20, <bold>(D)</bold> SS15vsSS10, and <bold>(E)</bold> SS15vsSS5. First circle: enriched classification, with a coordinate scale for the number of genes outside the circle. Different colors represent different classifications. Second circle: the number of the classification in the background gene and the Q or P value. The more genes, the longer the bars. The smaller the value, the redder the color. Third circle: bar graph of the proportion of up&#x2013;down genes, deep purple represents an upregulated gene proportion, light purple represents the proportion of downregulated genes, and specific values are displayed below. Fourth circle: RichFactor values for each category (the number of foreground genes divided by the number of background genes in this classification), and each small grid of the background guides represents 0.1.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g004.tif"/>
</fig>
<p>
<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref> shows that Ss15vsSs20 significantly enriched the top 25 GO terms in three major categories: molecular function, cell composition, and biological process. With Q-value &#x2264; 0.05 as the screening condition, a total of 63 GO items were extremely significant enriched. In the biological process category, DEGs in the &#x201c;purine nucleoside triphosphate biosynthetic process (GO:0009145),&#x201d; &#x201c;purine ribonucleoside triphosphate biosynthetic process (GO:0009206),&#x201d; &#x201c;energy coupled proton transport, down electrochemical gradient (GO:0015985),&#x201d; &#x201c;defense response (GO:0006952)&#x201d;and other GOs terms were significantly enriched, and these terms enriched more down-regulation genes than up-regulation genes. In the cell composition category, our results showed that &#x201c;cytosolic small ribosomal subunit (GO:0022627),&#x201d; &#x201c;ribosomal subunit (GO:0044391),&#x201d; &#x201c;apoplast (GO:0048046),&#x201d; &#x201c;extracellular region (GO:0005576),&#x201d; were significantly enriched. In the molecular function, DEGs in the &#x201c;endopeptidase inhibitor activity (GO:0004866),&#x201d; &#x201c;peptidase inhibitor activity (GO:0030414)&#x201d;&#x201c;endopeptidase regulator activity (GO:0061135),&#x201d; &#x201c;oxidoreductase activity (GO:0016491),&#x201d; &#x201c;monooxygenase activity (GO:0004497) were significantly enriched (<xref ref-type="supplementary-material" rid="ST1">
<bold>Table S1</bold>
</xref>).</p>
</sec>
<sec id="s3_6">
<title>Biosynthetic pathway enrichment analysis</title>
<p>The DEG expression involved in biological pathways can be studied using KEGG to provide a developmental pathway network. Twenty KEGG pathways with the highest enrichment (TOP20) were selected from the five differential groups: Ss15vsSs30, Ss15vsSs25, Ss15vsSs20, Ss15vsSs10, and Ss15vsSs5 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>). The betacyanin biosynthesis pathway was significantly enriched in the five groups, among which it was significantly enriched to TOP20 in three groups (Ss15vsSs30, Ss15vsSs20, and Ss15vsSs10), with the most significant enrichment in Ss15vsSs20. The other two differential groups were enriched to the 21st (Ss15vsSs5) and 38th positions (Ss15vsSs25), consistent with the change trend of the betacyanin content results. The other significantly enriched pathways were successively &#x201c;phenylpropane biosynthesis,&#x201d; &#x201c;carbon fixation in photosynthetic organisms,&#x201d; &#x201c;dicarboxylic acid metabolism,&#x201d; &#x201c;photosynthesis antenna protein,&#x201d; &#x201c;fructose and mannose metabolism,&#x201d; &#x201c;amino sugar and nucleotide sugar metabolism,&#x201d; &#x201c;ribosome,&#x201d; and &#x201c;flavonoid biosynthesis.&#x201d;</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of DEGs in pairwise comparisons between the control (Ss15) and other temperature treatments: <bold>(A)</bold> Ss15vsSs30, <bold>(B)</bold> SS15vsSS25, <bold>(C)</bold> Ss15vsSs20, <bold>(D)</bold> Ss15vsSs10, and <bold>(E)</bold> Ss15vsSs5.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g005.tif"/>
</fig>
<p>To identify the function of DEGs enriched in the &#x201c;biosynthesis of betanin&#x201d; pathway, software Goatools was used to annotate the genes in this gene set (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>). The results showed that the functional DEGs enriched in this pathway were mainly those for tyrosinase and 4,5-DOPA dioxygenase (predicted: tyrosine decarboxylase 1, 4,5-DOPA dioxygenase extradiol, tyrosinase-like protein orsC, and tyrosine/DOPA decarbox).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>KEGG senior network chart of phenylpropanoid, flavonoid, and betalain biosyntheses.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g006.tif"/>
</fig>
<p>Among them, predicted: tyrosine decarboxylase 1 was annotated in <italic>Beta</italic> vulgaris subsp. Vulgaris (Gene ID: TRINITY_DN25136_c1_g2), 4,5-DOPA dioxygenase extradiol was annotated in <italic>S. salsa</italic> (Gene ID: TRINITY_DN12121_c0_g1), tyrosinase like protein orsC was annotated in <italic>Quercus</italic> suber (Gene ID: TRINITY_DN36005_c0_g1), tyrosine/DOPA decarboxylase 1-like was annotated in <italic>Chenopodium</italic> quinoa Willd (Gene ID: TRINITY_DN47998_c0_g1).</p>
<p>Compare the sequences obtained from the experiment with those in the NCBI database, and the phylogenetic analysis results showed reliability 4,5-DOPA dioxygenase extradiol, predicted: tyrosine decarboxylase 1 and tyrosine/DOPA decarboxylase 1-like were 100 (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). However, the reliability of tyrosinase like protein orsC was below 70. The results showed that 4,5-DOPA dioxygenase extradiol, predicted: tyrosine decarboxylase 1 and tyrosine/DOPA decarboxylase 1-like are involved in the regulation of betacyanin biosynthesis in <italic>S. salsa.</italic>
</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Phylogenetic analysis of betalain biosynthetic pathway DEGs. <bold>(A)</bold> Predicted: tyrosine decarboxylase 1, Transcript ID: TRINITY_DN25136_c1_g2. <bold>(B)</bold> 4,5-DOPA dioxygenase extradiol, Transcript ID: TRINITY_DN12121_c0_g1. <bold>(C)</bold> tyrosine/DOPA decarboxylase 1-like, Transcript ID: TRINITY_DN47998_c0_g1. <bold>(D)</bold> tyrosinase like protein orsC, Transcript ID : TRINITY_DN36005_c0_g1.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g007.tif"/>
</fig>
</sec>
<sec id="s3_7">
<title>Expression of key genes in the betacyanin biosynthesis pathway</title>
<p>The results of KEGG enrichment analysis showed that the DEGs were significantly enriched in the &#x201c;biosynthesis of betalain&#x201d; pathway. Further analysis was conducted on the difference groups in the Ss20vsSs15 samples. At 20&#xb0;C, there were 1463 upregulated and 2441 downregulated DEGs compared to 15&#xb0;C (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Among them, the genes for TYR, Cyp450s, UGTs and DOPA, the&#xa0;key enzymes in the betacyanin synthesis pathway of <italic>S. salsa</italic>, were significantly downregulated, and their expression levels were&#xa0;highest at 15&#xb0;C. Expression of the gene for 5-O-glucosyltransferase was significantly upregulated at 10&#xb0;C and significantly higher than for the other five temperature groups (<italic>P</italic> &lt; 0.001, |log<sub>2</sub>FC| &#x2265; 1) (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8B</bold>
</xref>, <xref ref-type="fig" rid="f9">
<bold>9</bold>
</xref>). At the same, phylogenetic analysis in cyclo-DOPA 5-O-glucosyltransferase and cytochrome P450 76AD1-like protein results showed that which indeed for the betanin biosynthetic pathway (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10</bold>
</xref>). Thus, 15&#xb0;C was conducive to betalain accumulation in <italic>S. salsa</italic> compared to the other five temperatures.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>
<bold>(A)</bold> Distribution and abundance distribution of up- and downregulated proteins of <italic>S. salsa</italic> in Ss15 vs Ss20. Red and blue indicate up- and downregulated differential proteins, respectively, and gray indicates no significant difference in protein. <bold>(B)</bold> Expression of four key enzyme genes, <italic>TYR</italic>, <italic>DODA</italic>, <italic>UGTs</italic>, and <italic>Cyp450</italic>s under different temperature conditions.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g008.tif"/>
</fig>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Betacyanin biosynthesis pathway. Red indicates upregulation of genes; blue indicates spontaneous reactions and genes without significant changes (<italic>P &lt;</italic> 0.05). Solid lines indicate reactions involving key enzymes process. The dotted line represents the spontaneous reaction process.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g009.tif"/>
</fig>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>Phylogenetic analysis of Cyp450s and UGTs. <bold>(A)</bold> cyclo-DOPA 5-O-glucosyltransferase, Transcript ID: TRINITY_DN24208_c0_g1. <bold>(B)</bold> cytochrome P450 76AD1-like protein, Transcript ID: TRINITY_DN2265_c0_g1.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1203089-g010.tif"/>
</fig>
</sec>
<sec id="s3_8">
<title>Key transcription factors regulating betanin synthesis</title>
<p>To further explore the regulatory mechanism of temperature on the synthesis of betanin from <italic>S. salsa</italic>, combined with the results of betacyanin content determination and KEGG enrichment analysis, the TFs of the Ss15vsSs20 differential comparison groups were further analyzed. A total of 597 genes were assigned to 33 TF families in Ss15vsSs20, and the top 20 TF families with significant differential expression were selected (<xref ref-type="table" rid="T5">
<bold>Table&#xa0;5</bold>
</xref>). Compared with the 20&#xb0;C, a total of 83 TFs were significantly upregulated and 25 TFs were significantly downregulated at 15&#xb0;C (<italic>P</italic> &lt; 0.001, BH= 2). Among the upregulated TF families, AP2/ERF had the highest number of upregulated genes (15), followed by C2C2 (12) and bHLH (10). At the same time, the number of downregulated genes in the MYB family was the highest (four), followed by MADS (three).</p>
<table-wrap id="T5" position="float">
<label>Table&#xa0;5</label>
<caption>
<p>The TF family and their contained dys-regulated gene number.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">TF family</th>
<th valign="middle" align="center">Up gene num</th>
<th valign="middle" align="center">Down gene num.</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">MYB</td>
<td valign="middle" align="center">9</td>
<td valign="middle" align="center">4</td>
</tr>
<tr>
<td valign="middle" align="left">C2C2</td>
<td valign="middle" align="center">12</td>
<td valign="middle" align="center">1</td>
</tr>
<tr>
<td valign="middle" align="left">bHLH</td>
<td valign="middle" align="center">10</td>
<td valign="middle" align="center">1</td>
</tr>
<tr>
<td valign="middle" align="left">AP2/ERF</td>
<td valign="middle" align="center">15</td>
<td valign="middle" align="center">2</td>
</tr>
<tr>
<td valign="middle" align="left">B3_superfamily</td>
<td valign="middle" align="center">3</td>
<td valign="middle" align="center">1</td>
</tr>
<tr>
<td valign="middle" align="left">NAC</td>
<td valign="middle" align="center">5</td>
<td valign="middle" align="center">2</td>
</tr>
<tr>
<td valign="middle" align="left">WRKY</td>
<td valign="middle" align="center">4</td>
<td valign="middle" align="center">2</td>
</tr>
<tr>
<td valign="middle" align="left">bZIP</td>
<td valign="middle" align="center">7</td>
<td valign="middle" align="center">2</td>
</tr>
<tr>
<td valign="middle" align="left">GRAS</td>
<td valign="middle" align="center">1</td>
<td valign="middle" align="center">0</td>
</tr>
<tr>
<td valign="middle" align="left">C3H</td>
<td valign="middle" align="center">1</td>
<td valign="middle" align="center">0</td>
</tr>
<tr>
<td valign="middle" align="left">MADS</td>
<td valign="middle" align="center">2</td>
<td valign="middle" align="center">3</td>
</tr>
<tr>
<td valign="middle" align="left">LBD (AS2/LOB)</td>
<td valign="middle" align="center">4</td>
<td valign="middle" align="center">1</td>
</tr>
<tr>
<td valign="middle" align="left">FAR1</td>
<td valign="middle" align="center">0</td>
<td valign="middle" align="center">2</td>
</tr>
<tr>
<td valign="middle" align="left">SBP</td>
<td valign="middle" align="center">1</td>
<td valign="middle" align="center">2</td>
</tr>
<tr>
<td valign="middle" align="left">GRF</td>
<td valign="middle" align="center">3</td>
<td valign="middle" align="center">0</td>
</tr>
<tr>
<td valign="middle" align="left">TCP</td>
<td valign="middle" align="center">1</td>
<td valign="middle" align="center">0</td>
</tr>
<tr>
<td valign="middle" align="left">C2H2</td>
<td valign="middle" align="center">3</td>
<td valign="middle" align="center">1</td>
</tr>
<tr>
<td valign="middle" align="left">LOB</td>
<td valign="middle" align="center">0</td>
<td valign="middle" align="center">1</td>
</tr>
<tr>
<td valign="middle" align="left">HSF</td>
<td valign="middle" align="center">1</td>
<td valign="middle" align="center">0</td>
</tr>
<tr>
<td valign="middle" align="left">Nin-like</td>
<td valign="middle" align="center">1</td>
<td valign="middle" align="center">0</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Up gene num, Up-regulated gene number; Down gene num, Down-regulated gene number.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>The MYB, C2C2, bHLH, and AP2/ER TFs regulate the synthesis of betanin in <italic>S. salsa</italic>. The 13 DEGs of MYB were positively correlated with betanin synthesis related genes (e.g. <italic>MYB1R1</italic>, <italic>MYB23</italic>, <italic>MYB14-like</italic>, <italic>CgMYB1</italic>, and <italic>MYB46-like</italic>), while the four DEGs of MYB were negatively correlated with betanin synthesis related genes (e.g. <italic>protein RADIALIS</italic>, <italic>MYB62-like</italic>, <italic>MYB306</italic>, and <italic>MYB108 like</italic>). Among the members of the bHLH family, 10 DEGs were positively correlated with genes related to betanin synthesis (e.g. <italic>bHLH90</italic>, <italic>bHLH93</italic>, <italic>bHLH35</italic>, and <italic>bHLH47</italic>), but negatively correlated with one DEG (<italic>UNE10</italic>). Among AP2/ERF family members, 15 DEGs were positively correlated with genes related to betanin synthesis (e.g. <italic>ERF023</italic>, <italic>dehydrogenation-responsive element binding protein</italic>, <italic>ERF043</italic>, and <italic>ERF061</italic>), but negatively correlated with two DEGs (<italic>PTI5</italic> and <italic>ERF098</italic>). Among members of the C2C2 family, 12 DEGs were positively correlated with genes related to betanin synthesis (e.g. <italic>DOF1.4</italic>, <italic>DOF3.4</italic>, <italic>DOF2.1</italic>, and <italic>DOF2.5</italic>), but negatively correlated with one DEG (<italic>DOF1.5</italic>).</p>
<p>Annotate the transcription factors obtained in this study, and the results indicate that MYB1R1 and CgMYB1 have the function of regulating the synthesis of betaine in <italic>Pyrus</italic> spp (FPKM = 6.61) and <italic>Allium</italic> cepa L. respectively (FPKM = 49.84).</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<sec id="s4_1">
<title>Effect of temperature on betacyanin content</title>
<p>Temperature will affect stability of the betacyanins of <italic>Monascus</italic> (<xref ref-type="bibr" rid="B1">Abdollahi et&#xa0;al., 2021</xref>). Low temperature can induce accumulation of anthocyanins in begonia, which has a protective effect against low temperature stress (<xref ref-type="bibr" rid="B7">Dong et&#xa0;al., 2018</xref>). Betacyanins have similar functions to anthocyanins, making plants brightly colored. The accumulation of betacyanins in <italic>S. salsa</italic> leaves has a positive impact on light protection during low temperature stress (<xref ref-type="bibr" rid="B10">Gandia and Garcia, 2019</xref>). Betacyanins are effective antioxidants that can significantly contribute to higher thermal stability and tolerance to heat stress of <italic>A. tricolor</italic> photosystem II (<xref ref-type="bibr" rid="B29">Shu et&#xa0;al., 2009</xref>). High temperature can significantly inhibit betacyanin synthesis in <italic>B. vulgaris</italic>, and this negative impact is exacerbated on the second or third day of treatment (<xref ref-type="bibr" rid="B25">Ninfali et&#xa0;al., 2017</xref>). Lowering temperature is beneficial to betacyanin accumulation in <italic>S. salsa</italic> leaves, possibly related to accelerated chlorophyll decomposition in leaves under low-temperature conditions (<xref ref-type="bibr" rid="B31">Slimen et&#xa0;al., 2017</xref>). In this study, compared to 5&#xb0;C, 10&#xb0;C, 20&#xb0;C, 25&#xb0;C, and 30&#xb0;C, the betacyanin content in <italic>S. salsa</italic> leaves was significantly higher at 15&#xb0;C. Below 15&#xb0;C, the betacyanin content in <italic>S. salsa</italic> leaves gradually increased with decreased temperature, whereas above 15&#xb0;C, it gradually decreased with increased temperature. This indicates that low temperature is beneficial, and high temperature can significantly inhibit betacyanin synthesis in <italic>S. salsa</italic> leaves &#x2013; consistent with the results of <xref ref-type="bibr" rid="B39">Wang (2007)</xref>.</p>
<p>The GO enrichment results showed that the DEGs in Ss15vsSs20 and other four analysis groups were significantly enriched in processes such as &#x201c;defense response,&#x201d; &#x201c;oxidoreductase activity,&#x201d; Meanwhile, compared with other temperature groups, these terms enriched more up-regulation genes than down-regulation genes in 15&#xb0;C. The results indicate that compared to other temperatures, the low temperature of 15&#xb0;C was the most suitable for inducing the accumulation of betacyanins in <italic>S. salsa</italic> leaves. And the biosynthesis of betacyanins may improve the stress resistance of <italic>S. salsa.</italic>
</p>
</sec>
<sec id="s4_2">
<title>Effect of temperature on key enzymes of betacyanin synthesis</title>
<p>Dark and light conditions are important factors that affect tyrosinase activity. Tyrosinase can only be detected in <italic>S. salsa</italic> seedlings cultivated in dark conditions and not light conditions. When <italic>S. salsa</italic> seedlings were transferred from darkness to light conditions, the betacyanin content and tyrosinase activity in leaves decreased (<xref ref-type="bibr" rid="B39">Wang, 2007</xref>). Tyrosinase activity is also affected by light quality. Under blue light conditions, the blue light receptor anthocyanin 2 (CRY2) of <italic>S. salsa</italic> undergoes protein phosphorylation, resulting in decreased tyrosinase activity, and so decreased betacyanin content. Moreover, accumulation and degradation of CRY2 protein during the light&#x2013;dark cycle is an irreversible process (<xref ref-type="bibr" rid="B39">Wang, 2007</xref>). <xref ref-type="bibr" rid="B28">Ruan (2008)</xref> cloned the promoter <italic>Ss DODA</italic> of <italic>DOD</italic> from the <italic>S. salsa</italic> genome and found that the promoter contains an LTR (CCGAAA). It is speculated that low temperature can affect <italic>Ss DODA</italic> expression, thereby regulating betanin metabolism in <italic>S. salsa</italic>. <xref ref-type="bibr" rid="B41">Wang (2011)</xref> further explored the effects of temperature on expression of the <italic>Ss DODA</italic> promoter and the betacyanin content in <italic>S. salsa</italic> seedlings. The expression of <italic>Ss DODA</italic> and the betacyanin content significantly increased after 7 days of low-temperature treatment compared to the control group, but then showed a downward trend after 7 days of culture under normal conditions. This indicates that low temperature can affect expression of <italic>Ss DODA</italic> and betacyanin synthesis in <italic>S. salsa</italic>.</p>
<p>In the early spring and deep autumn when temperatures are low, <italic>S. salsa</italic> plants in coastal wetland are red or purplish red, forming a beautiful and spectacular &#x201c;red beach&#x201d; landscape on the mudflats, attracting many tourists and creating economic benefits for the local eco-tourism industry. In addition, equipped with antioxidant activity, betacyanin has been widely applied in cosmetic, food additive and pharmaceutical (<xref ref-type="bibr" rid="B30">Siow and Wong, 2016</xref>). In this study, tyrosinase was detected under 15&#xb0;C and light conditions, and the genes for tyrosinase (tyrosine/DOPA decarboxylase 1-like and tyrosine decarboxylase 1), CYP76AD1 (cytochrome P450 76AD1-like protein) and 4,5-DOPA dioxygenase (4,5-DOPA dioxygenase extradiol) were significantly upregulated at this temperature, with the highest expression level. At 10&#xb0;C, expression of the gene for 5-O-glucosyltransferase (cyclo-DOPA 5-O-glucosyltransferase) was significantly upregulated. Combined with the betacyanin content results, this further demonstrates that 15&#xb0;C is conducive to increased betacyanin synthesis in <italic>S. salsa</italic>, which is consistent with observations of <italic>S. salsa</italic> under natural conditions. Therefore, it should be possible to conduct regulation experiments with different control factors based on a temperature of 15&#xb0;C, such as single or composite factor stress studies with different light intensities and salinity. At the same time, combining molecular techniques such as gene silencing or knockout, will allow a deeper exploration of the discoloration and regulatory mechanisms of <italic>S. salsa</italic>, and to induce <italic>S. salsa</italic> to accumulate large amounts of betacyanins, with a view to maximizing the reddening time of <italic>S. salsa</italic>, achieving both ecological protection and economic creation.</p>
</sec>
<sec id="s4_3">
<title>Effect of temperature on TFs and other metabolic pathways</title>
<p>Betacyanin accumulation in <italic>S. salsa</italic> is regulated by TFs. The MYB and bHLH TFs play key roles in various biochemical processes and participate in regulation of anthocyanin biosynthesis (<xref ref-type="bibr" rid="B37">Toledo-Ortiz et&#xa0;al., 2003</xref>). The TF HubHLH159 in pitaya promotes betacyanin biosynthesis by activating expression of <italic>HuADH1</italic>, <italic>HuCYP76AD1-1</italic>, and <italic>HuDODA1</italic> (<xref ref-type="bibr" rid="B3">Chen et&#xa0;al., 2023</xref>). In Arabidopsis, <italic>AtbHLH132</italic>, <italic>AtbHLH32</italic>, and <italic>AtbHLH101</italic> of the bHLH family participate in regulation of anthocyanin biosynthesis (<xref ref-type="bibr" rid="B2">Bailey et&#xa0;al., 2003</xref>). In apples, MdbHLH3 has been identified as a key bHLH TF involved in anthocyanin synthesis (<xref ref-type="bibr" rid="B9">Espley et&#xa0;al., 2007</xref>). In this study, 11 DEGs were annotated in the bHLH TF family, and 10 TF genes including <italic>bHLH93</italic> and <italic>bHLH35</italic> were significantly upregulated (<italic>P</italic> &lt; 0.001); 13 DEGs were annotated into the MYB TF family, and nine TF genes including <italic>MYB1R1, MYB1</italic> and <italic>MYB14</italic> were significantly upregulated (<italic>P</italic> &lt; 0.001). Gene <italic>bHLH93</italic> can induce plant defense responses and improve plant resistance to stress (<xref ref-type="bibr" rid="B48">Zhou et&#xa0;al., 2020</xref>); <italic>bHLH35</italic> can regulate rice anther development (<xref ref-type="bibr" rid="B27">Ortolan et&#xa0;al., 2021</xref>). Gene <italic>MYB062</italic> is related to the lignin biosynthesis pathway in flax (<xref ref-type="bibr" rid="B38">Tombuloglu, 2020</xref>). Plant stilbene is a plant antitoxin that accumulates in a few plant species including <italic>Vitis vinifera</italic> in response to biotic and abiotic stresses, and has many beneficial effects on human health (<xref ref-type="bibr" rid="B17">Holl et&#xa0;al., 2013</xref>). <italic>MYB14</italic> can participate in transcriptional regulation of stilbene biosynthesis in <italic>V. vinifera</italic>, specifically activating the promoter of gene <italic>STS</italic>, and promoting accumulation of glycosylated stilbene in plants. In this study, MYB1R1 TF in Ss20vsSs15 was significantly upregulated (<italic>P</italic> &lt; 0.01). BvMYB1 is a typical plant R2R3-MYB containing the R2 and R3 MYB domains and a C-terminal activation domain, which is a good candidate to regulate betalains (<xref ref-type="bibr" rid="B15">Hatlestad et&#xa0;al., 2015</xref>). MYB1R1 is an important regulatory factor involved in plant pigment synthesis. The content of anthocyanins in pears is positively correlated with <italic>MYB1R1</italic> expression (<xref ref-type="bibr" rid="B23">Liu et&#xa0;al., 2019</xref>), which may play an important regulatory role in metabolism of carotenoids and can directly or indirectly regulate carotenoid cleavage dioxygenases (<xref ref-type="bibr" rid="B45">Zhang et&#xa0;al., 2019</xref>). Therefore, <italic>S. salsa</italic> betacyanin synthesis may be mainly regulated by <italic>MYB1R1 and MYB1</italic> TFs, while <italic>MYB14</italic> may play an important role in resistance response to stress in <italic>S. salsa</italic>. The TFs for <italic>MYB062</italic>, <italic>bHLH159</italic>, <italic>bHLH132</italic>, <italic>bHLH32</italic>, <italic>bHLH101</italic>, and <italic>bHLH3</italic> were not detected in this experiment.</p>
<p>Phenylpropane metabolism is one of the most important secondary metabolic pathways in plants. Flavonoid compounds are the most diverse branch pathways of propane metabolism, and play an important role in plant growth, development, and environmental interactions (<xref ref-type="bibr" rid="B6">Dong and Lin, 2021</xref>). Phenylpropane metabolism is influenced by various biological factors and abiotic stresses such as temperature and light, and is regulated by multiple regulatory pathways including MYB. Gene <italic>McMYB4</italic> participates in the abiotic resistance and growth of apples with temperature changes by regulating phenylpropane metabolism and hormone signaling (<xref ref-type="bibr" rid="B14">Hao et&#xa0;al., 2021</xref>). Browning of Nanguo pear peel induced by low temperature is related to phenylpropane metabolism (<xref ref-type="bibr" rid="B35">Sun et&#xa0;al., 2022</xref>), Glycine betaine can enhance the activity of enzymes related to phenylpropane metabolism, thereby improving the cold resistance of peaches (<xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2019</xref>). Tea shoots appear white-green at low temperatures and turn green as temperature increases. <xref ref-type="bibr" rid="B24">Ma et&#xa0;al. (2018)</xref> and others conducted transcriptome analysis to explore the discoloration mechanism of tea shoots. The results showed that the color change of &#x201c;Huabai 1&#x201d; buds was caused by the comprehensive action of the phenylpropanoid biosynthesis pathway and other metabolic pathways, including flavonoid biosynthesis. In this study, the DEGs in Ss20vsSs15 were mainly involved in processes such as &#x201c;phenylpropane metabolism,&#x201d; &#x201c;response to stimulation,&#x201d; &#x201c;biological regulation,&#x201d; and &#x201c;flavonoid biosynthesis.&#x201d; Therefore, we predict that betacyanin accumulation is comprehensively affected by processes such as &#x201c;phenylpropane metabolism&#x201d; and &#x201c;flavonoid biosynthesis,&#x201d; which overall improve the stress resistance and antioxidant level of <italic>S. salsa</italic>. This is basically consistent with the research results of Song et&#xa0;al. Red-violet phenotype of <italic>S. salsa</italic> in the intertidal habitat have higher differential proteins involved in defense, stimulation, and stress response than those green phenotype of <italic>S. salsa</italic> in the supratidal habitat, which promoted the biosynthesis of phenylpropanoids and other secondary metabolites, further increased the medicinal value and resisted environmental stresses ability, but directly reduced the palatability of <italic>S. salsa</italic> (<xref ref-type="bibr" rid="B33">Song et&#xa0;al, 2021</xref>). <italic>S. salsa</italic> is not only one of the best nature-based restoration solution for shoreline stabilization, but also the important biological barrier of coastal wetlands (<xref ref-type="bibr" rid="B16">He et&#xa0;al., 2022</xref>). This provides a theoretical reference for further exploring the discoloration mechanism of <italic>S. salsa.</italic>
</p>
</sec>
</sec>
<sec id="s5" sec-type="conclusion">
<title>Conclusion</title>
<p>In this study, low temperature (15&#xb0;C) promoted betanin accumulation in <italic>S. salsa</italic> leaves by upregulating the expression of key structural genes (for tyrosinase, CYP76AD1 and 4,5-DOPA dioxygenase) and related TFs (<italic>MYB1R1</italic> and <italic>MYB1</italic>) involved in betacyanin synthesis. At the same time, the antioxidant activity and peroxidase expression of <italic>S. salsa</italic> leaves in 15&#xb0;C were upregulated, and the DEGs in Ss20vsSs15 were mainly involved in processes such as &#x201c;phenylpropane metabolism,&#x201d; &#x201c;defense response,&#x201d; &#x201c;oxidoreductase activity,&#x201d; and &#x201c;flavonoid biosynthesis.&#x201d; Therefore, we predict that the synthesis of betacyanin enhances the stress resistance and antioxidant level of <italic>S. salsa.</italic> The research results provide reference for adding a &#x201c;Red Beach&#x201d; and the restoration of <italic>S. salsa</italic> in the coastal wetlands.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are publicly available. This data can be found here: NCBI, accession: PRJNA955095.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>ML: performed the experiments, completed data analysis and wrote the manuscript. PH: conceived the experimental design, and fund support. ZZ: guided to cultivating plant. JL and HL: modified of the manuscript. SM, YS and BL contributed to sample collection. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The funding was supported by the National Science and Technology Major Project of the Ministry of Science and Technology of China (2017YFCO506002), Open Fund of the Key Laboratory of Marine Ecological Monitoring and Restoration Technology of the Ministry of Natural Resources (MEMIRT202003), Shanghai Ocean Bureau Project (Shanghai Ocean Science 2022-03).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2023.1203089/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2023.1203089/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table_1.xls" id="ST1" mimetype="application/vnd.ms-excel"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abdollahi</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Jahadi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ghavami</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Thermal stability of natural pigments produced by monascus purpureus in submerged fermentation</article-title>. <source>Food Sci. Nutr.</source> <volume>9</volume> (<issue>9</issue>), <fpage>4855</fpage>&#x2013;<lpage>4862</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/fsn3.2425</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bailey</surname> <given-names>P. C.</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Toledo-Ortiz</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Quail</surname> <given-names>P. H.</given-names>
</name>
<name>
<surname>Huq</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Heim</surname> <given-names>M. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Update on the basic helix-loop-helix transcription factor gene family in arabidopsis thaliana</article-title>. <source>Plant Cell.</source> <volume>15</volume> (<issue>11</issue>), <fpage>2497</fpage>&#x2013;<lpage>2501</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1105/tpc.151140</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>F. F.</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>C. B.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>J. X.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Identification of HubHLH family and key role of HubHLH159 in betalain biosynthesis by activating the transcription of HuADH1, HuCYP76AD1-1, and HuDODA1 in <italic>pitaya</italic>
</article-title>. <source>Plant Sci.</source> <volume>328</volume>, <elocation-id>111595</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plantsci.2023.111595</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cong</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Lv</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>H. F.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Gene expression responses in <italic>Suaeda salsa</italic> after cadmium exposure</article-title>. <source>SpringerPlus</source> <volume>2</volume> (<issue>1</issue>), <elocation-id>232</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/2193-1801-2-232</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Cui</surname> <given-names>M. Z.</given-names>
</name>
</person-group> (<year>2020</year>). <source>Biosynthesis of betacyanins in suaeda salsa under the combined stress of low nitrogen, low phosphorus and high salt and its effect on plant salt tolerance</source> (<publisher-loc>Lanzhou (CN</publisher-loc>: <publisher-name>Lan Zhou University</publisher-name>).</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname> <given-names>N. Q.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>H. X.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Contribution of phenylpropanoid metabolism to plant development and plant-environment interactions</article-title>. <source>J. Integr. Plant Biol.</source> <volume>63</volume> (<issue>1</issue>), <fpage>180</fpage>&#x2013;<lpage>209</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jipb.13054</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Qu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Transcriptome analysis of the biosynthesis of anthocyanins in begonia semperflorens under low-temperature and high-light conditions</article-title>. <source>Forests</source> <volume>9</volume> (<issue>2</issue>), <elocation-id>87</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/f9020087</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elliott</surname> <given-names>D. C.</given-names>
</name>
</person-group> (<year>1979</year>). <article-title>Analysis of variability in the amaranthus bioassay for cytokinins-effects of water stress on benzyladenine- and fusicoccin-dependent responses</article-title>. <source>Plant Physiol.</source> <volume>63</volume> (<issue>2</issue>), <fpage>269</fpage>&#x2013;<lpage>273</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.63.2.269</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Espley</surname> <given-names>R. V.</given-names>
</name>
<name>
<surname>Hellens</surname> <given-names>R. P.</given-names>
</name>
<name>
<surname>Putterill</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Stevenson</surname> <given-names>D. E.</given-names>
</name>
<name>
<surname>Kutty-Amma</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Allan</surname> <given-names>A. C.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10</article-title>. <source>Plant J.</source> <volume>49</volume> (<issue>3</issue>), <fpage>414</fpage>&#x2013;<lpage>427</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-313X.2006.02964.x</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gandia</surname> <given-names>H. F.</given-names>
</name>
<name>
<surname>Garcia</surname> <given-names>C. F.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The dawn of betalains</article-title>. <source>New Phytol.</source> <volume>22 7</volume> (<issue>3</issue>), <fpage>664</fpage>&#x2013;<lpage>666</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/nph.16295</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gandia-Herrero</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Escribano</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Garcia-Carmona</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Betaxanthins as substrates for tyrosinase,an approach to the role of tyrosinase in the biosynthetic pathway of betalains</article-title>. <source>Plant Physiol.</source> <volume>138</volume> (<issue>1</issue>), <fpage>421</fpage>&#x2013;<lpage>432</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.104.057992</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gengatharan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Dykes</surname> <given-names>G. A.</given-names>
</name>
<name>
<surname>Choo</surname> <given-names>W. S.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Betalains: natural plant pigments with potential application in functional foods</article-title>. <source>LWT-Food Sci. Technol.</source> <volume>64</volume> (<issue>2</issue>), <fpage>645</fpage>&#x2013;<lpage>649</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.lwt.2015.06.052</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X. J.</given-names>
</name>
<name>
<surname>Christakos</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Agusti</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Duarte</surname> <given-names>C. ,. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Losses of salt marsh in china:trends, threats and management</article-title>. <source>Estuarine Coast. Shelf Sci.</source> <volume>214</volume>, <fpage>98</fpage>&#x2013;<lpage>109</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ecss.2018.09.015</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hao</surname> <given-names>S. X.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Y. F.</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Chao</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhong</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>McMYB4 improves temperature adaptation by regulating phenylpropanoid metabolism and hormone signaling in apple</article-title>. <source>Hortic. Res.</source> <volume>8</volume> (<issue>1</issue>), <fpage>182</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41438-021-00620-0</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hatlestad</surname> <given-names>G. J.</given-names>
</name>
<name>
<surname>Akhavan</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Sunnadeniya</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Elam</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Cargile</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Hembd</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>The beet y locus encodes an anthocyanin MYB-like protein that activates the betalain red pigment pathway</article-title>. <source>Nat. Genet.</source> <volume>47</volume> (<issue>1</issue>), <fpage>92</fpage>&#x2013;<lpage>96</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ng.3163</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>C. F.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>B.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Variation in bacterial community structures and functions as indicators of response to the restoration of <italic>Suaeda salsa</italic>: a case study of the restoration in the beidaihe coastal wetland</article-title>. <source>Front. Microbiol.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2022.783155</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Holl</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Vannozzi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Czemmel</surname> <given-names>S.</given-names>
</name>
<name>
<surname>D'Onofrio</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Walker</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Rausch</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>The R2R3-MYB transcription factors MYB14 and MYB15 regulate stilbene biosynthesis in vitis vinifera</article-title>. <source>Plant Cell.</source> <volume>25</volume> (<issue>10</issue>), <fpage>4135</fpage>&#x2013;<lpage>4149</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1105/tpc.113.117127</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jia</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>G. L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Q. Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Changes of biogenic elements in phragmites australis and suaeda salsa from salt marshes in yellow river delta, China</article-title>. <source>Chin. Geogr. Sci.</source> <volume>28</volume>, <fpage>411</fpage>&#x2013;<lpage>419</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11769-018-0959-1</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khorramdelazad</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Bar</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Whatmore</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Smetham</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Bhaaskaria</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Transcriptome profiling of lentil (Lens culinaris) through the first 24 hours of ascochyta lentis infection reveals key defence response genes</article-title>. <source>BMC Genomics</source> <volume>19</volume> (<issue>1</issue>), <fpage>108</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12864-018-4488-1</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y. B.</given-names>
</name>
</person-group> (<year>2021</year>). <source>Analysis of the accumulation regularity and regulatory genes of betarubin in spinach</source> (<publisher-loc>Shanghai (CN</publisher-loc>: <publisher-name>Shanghai Normal University</publisher-name>).</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y. Z.</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>L. J.</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>X. H.</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>M. Y.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Trade-off between leaf chlorophyll and betacyanins in <italic>Suaeda salsa</italic> in the liaohe estuary wetland in northeast China</article-title>. <source>J. Plant Ecol.</source> <volume>11</volume> (<issue>4</issue>), <fpage>569</fpage>&#x2013;<lpage>575</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jpe/rtx025</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Shao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Otie</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Matsuura</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Irshad</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Cell wall components and extensibility regulate root growth in <italic>Suaeda salsa</italic> and <italic>Spinacia oleracea</italic> under salinity</article-title>. <source>Plants</source> <volume>11</volume> (<issue>7</issue>), <elocation-id>900</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/plants11070900</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>B. Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W. J.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>X. F.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Transcriptomic analysis of bagging-treated &#x2018;Pingguo&#x2019; pear shows that MYB4-like1, MYB4-like2, MYB1R1 and WDR involved in anthocyanin biosynthesis are up-regulated in fruit peels in response to light</article-title>. <source>Sci. Horti.</source> <volume>244</volume>, <fpage>428</fpage>&#x2013;<lpage>434</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.scienta.2018.09.040</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname> <given-names>Q. P.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zou</surname> <given-names>Z. W.</given-names>
</name>
<name>
<surname>Arkorful</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Lv</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Q. Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Transcriptomic analyses identify albino-associated genes of a novel albino tea germplasm 'Huabai 1'</article-title>. <source>Hortic. Res.</source> <volume>5</volume>, <fpage>54</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41438-018-0053-y</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ninfali</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Antonini</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Frati</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Scarpa</surname> <given-names>E. S.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>C-glycosyl flavonoids from <italic>Beta</italic> vulgaris cicla and betalains from <italic>Beta</italic> vulgaris rubra: antioxidant, anticancer and antiinflammatory activities-a review</article-title>. <source>Phytother. Res.</source> <volume>31</volume> (<issue>6</issue>), <fpage>871</fpage>&#x2013;<lpage>884</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/ptr.5819</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nolan</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hands</surname> <given-names>R. E.</given-names>
</name>
<name>
<surname>Bustin</surname> <given-names>S. A.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Quantification of mRNA using real-time RT-PCR</article-title>. <source>Nat. Protoc.</source> <volume>1</volume> (<issue>3</issue>), <fpage>1559</fpage>&#x2013;<lpage>1582</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nprot.2006.236</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ortolan</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Fonini</surname> <given-names>L. S.</given-names>
</name>
<name>
<surname>Pastori</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Mariath</surname> <given-names>J. E. A.</given-names>
</name>
<name>
<surname>Saibo</surname> <given-names>N. J. M.</given-names>
</name>
<name>
<surname>Margis-Pinheiro</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Tightly controlled expression of OsbHLH35 is critical for anther development in rice</article-title>. <source>Plant Sci.</source> <volume>302</volume>, <elocation-id>110716</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plantsci.2020.110716</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Ruan</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2008</year>). <source>Cloning and functional analysis of the gene encoding 4,5-dopa dioxygenase in suaeda salsa l</source> (<publisher-loc>Jinan (CN</publisher-loc>: <publisher-name>Shandong Normal University</publisher-name>).</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Shao</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>H. Y.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>X. Q.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z. F.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>G. Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>Comparison of thermostability of PSII between the chromatic and green leaf cultivars of <italic>Amaranthus tricolor</italic> l</article-title>. <source>Photosynthetica</source> <volume>47</volume>, <fpage>548</fpage>&#x2013;<lpage>558</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11099-009-0080-x</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siow</surname> <given-names>L. F.</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>Y. M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Effect of juice concentration on storage stability, betacyanin degradation kinetics, and sensory acceptance of red-fleshed dragon fruit (<italic>hylocereus polyrhizus</italic>) juice</article-title>. <source>Int. J. Food Prop</source> <volume>20 3)</volume>, <fpage>623</fpage>&#x2013;<lpage>632</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/10942912.2016.1172086</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Slimen</surname> <given-names>I. B.</given-names>
</name>
<name>
<surname>Najar</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Abderrabba</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>). chemical and antioxidant properties of betalains</article-title>. <source>Agric. Food Chem.</source> <volume>65</volume>, <fpage>675</fpage>&#x2013;<lpage>689</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jafc.6b04208</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sokolova</surname> <given-names>D. V.</given-names>
</name>
<name>
<surname>Shvachko</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Mikhailova</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Popov</surname> <given-names>V. S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Betalain content and morphological characteristics of table beet accessions: their interplay with abiotic factors</article-title>. <source>Agronomy</source> <volume>12</volume> (<issue>5</issue>), <elocation-id>1033</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/agronomy12051033</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Growth, stoichiometry, and palatability of <italic>Suaeda salsa</italic> from different habitats are demonstrated by differentially expressed proteins and their enriched pathways</article-title>. <source>Front. Plant Sci.</source> <volume>12</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2021.733882</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sui</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Comparative study on photosynthetic characteristics of two ecotypes of euhalophyte <italic>Suaeda salsa</italic> l. grown under natural saline conditions</article-title>. <source>Adv. Mater. Res.</source> <volume>726-731</volume>, <fpage>4488</fpage>&#x2013;<lpage>4493</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4028/AMR.726-731.4488</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname> <given-names>Y. Y.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Ge</surname> <given-names>W. Y.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>B. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Phenylpropanoid metabolism in relation to peel browning development of cold-stored 'Nanguo' pears</article-title>. <source>Plant Sci.</source> <volume>322</volume>, <elocation-id>111363</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plantsci.2022.111363</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Stecher</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>MEGA11: molecular evolutionary genetics analysis version 11</article-title>. <source>Mol. Biol. Evol.</source> <volume>38</volume> (<issue>7</issue>), <fpage>3022</fpage>&#x2013;<lpage>3027</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/molbev/msab120</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Toledo-Ortiz</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Huq</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Quail</surname> <given-names>P. H.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>The arabidopsis basic/helix-loop-helix transcription factor family</article-title>. <source>Plant Cell.</source> <volume>15</volume> (<issue>8</issue>), <fpage>1749</fpage>&#x2013;<lpage>1770</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1105/tpc.013839</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tombuloglu</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Genome-wide identification and expression analysis of R2R3, 3R- and 4R-MYB transcription factors during lignin biosynthesis in flax (Linum usitatissimum)</article-title>. <source>Genomics</source> <volume>112</volume> (<issue>1</issue>), <fpage>782</fpage>&#x2013;<lpage>795</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygeno.2019.05.017</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>C. Q.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Correlation oftyrosinase activityand betacyanin biosynthesis induced by dark in C3 halophyte <italic>Suaeda salsa</italic> seedlings</article-title>. <source>Plant Sci.</source> <volume>173</volume> (<issue>5</issue>), <fpage>487</fpage>&#x2013;<lpage>494</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plantsci.2007.07.010</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>B. S.</given-names>
</name>
</person-group> (<year>2009</year>). <source>Study on extraction and purification of betacyanin from halophyte suaeda salsa</source> (<publisher-loc>Jinan (CN</publisher-loc>: <publisher-name>Shandong Normal University</publisher-name>).</citation>
</ref>
<ref id="B41">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
</person-group> (<year>2011</year>). <source>Cloning and functional analysis of the SsDODA promoter of suaeda salsa l</source> (<publisher-loc>Jinan (CN</publisher-loc>: <publisher-name>Shandong Normal University</publisher-name>).</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Shan</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Ling</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Shao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Glycine betaine reduces chilling injury in peach fruit by enhancing phenolic and sugar metabolisms</article-title>. <source>Food Chem.</source> <volume>272</volume>, <fpage>530</fpage>&#x2013;<lpage>538</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2018.08.085</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>Z. F.</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>B. S.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>G. H.</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X. W.</given-names>
</name>
<etal/>
</person-group>. (<year>2006</year>). <article-title>Hydro-ecological processes, water-environmental effects and integrated control of ecological security for wetlands in Huang-Huai-Hai region of China</article-title>. <source>Adv. Earth Sci.</source> <volume>21</volume> (<issue>11</issue>), <fpage>1119</fpage>&#x2013;<lpage>1126</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.11867/j.issn.1001-8166.2006.11.1119</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>M. L.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Research advancement on degradation mechanism and ecological restoration technology of coastal salt-marsh: a review</article-title>. <source>J. Da Lian Sci.</source> <volume>37</volume> (<issue>4</issue>), <fpage>539</fpage>&#x2013;<lpage>549</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.16535/j.cnki.dlhyxb.2022-181</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q. Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W. H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Xi</surname> <given-names>W. P.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Identification of key genes and regulators associated with carotenoid metabolism in apricot (Prunus armeniaca) fruit using weighted gene coexpression network analysis</article-title>. <source>BMC Genomics</source> <volume>20</volume> (<issue>1</issue>), <fpage>876</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12864-019-6261-5</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ceng</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Effect of NaCl stress on pigment accumulation of <italic>Suaeda salsa</italic> l</article-title>. <source>Mod Agric. Sci. Technol.</source> <volume>8</volume>, <fpage>191</fpage>&#x2013;<lpage>192+196</lpage>.</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname> <given-names>X. L.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>L. Y.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>C. Z.</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>Z. X.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Promoter-cloning, protein subcellular localization, and expression analysis for ama DOPA 5-GT gene of amaranth tricolor</article-title>. <source>Fujian J. Agricl Sci.</source> <volume>30</volume> (<issue>11</issue>), <fpage>1064</fpage>&#x2013;<lpage>1070</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.19303/j.issn.1008-0384.2015.11.008</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhuo</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Z. Y.</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>H. T.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>Y. H.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>The ralstonia solanacearum effector RipI induces a defence reaction by interacting with the bHLH93 transcription factor in nicotiana benthamiana</article-title>. <source>Mol. Plant Pathol.</source> <volume>21</volume> (<issue>7</issue>), <fpage>999</fpage>&#x2013;<lpage>1004</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/mpp.12937</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>