Tobacco seeds of YY85 and XY1, incubated in water until germination, were sown into seedbeds. The seedbeds were then transplanted into potted containers and placed in a light incubator with a constant temperature of 28°C and relative humidity of 70-80%. The photoperiod was defined as 12 h with white light (1500 lx) and 12 h without light in one day. When sixth true leaf appeared, some of the seedlings of YY85 and XY1 were then transferred into another light incubator with temperature set to 12°C as the cold stress treatment. The remaining seedlings were considered as a control group. After 10 days, stem tips of the seedlings from cold and control groups were collected for analysis and three independent biological replicates were used in this study. The 10 days cold treated plants were then transplanted into normal growth environments.

The stem tip tissues used for light microscopy were harvested from the 25- and 30-day-old plants after transplantation and temperature treatment (12°C and 28°C, as previously described). Stem tips (about 5 cm long) were cut down and placed into a medical syringe with a length of at least 15 cm to exhaust air in the stem tip. The stem tips were then fixed in FAA fixation solution for 48 h. The anatomical structure of the meristem tips was then observed via an SZX12 stereomicroscope (Olympus Corp., http://www.olympus.co.jp/en/) at ×50 magnification and pictures were captured.

Total RNA was extracted from 100 mg of tobacco leaves using the Plant RNA Isolation Kit (Watson Biotechnologies, Inc., Shanghai, China). DNase digestion was performed using RNase-free DNase I (TaKaRa) in order to remove any residual DNA. The concentration and quality of RNA were determined using a NanoDrop ND-2000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA) and an Agilent 2100 BioAnalyzer (Agilent Technologies, Cheadle, UK). The RNA samples from the same cultivated region were then equivalently pooled together for microarray hybridization and qRT-PCR analysis.

Gene expression profiles of tobacco leaves were assessed via Agilent Tobacco Gene Expression Microarrays (G2519F). cRNA labeling, hybridization and microarray processing were carried out at CapitalBio Corporation (Beijing, China) and labeling reactions were carried out using a CapitalBio cRNA Amplification and Labeling Kit (CapitalBio Corp.) in the presence of a fluorescent dye (Cy3-dCTP). All samples were labeled with Cy3 in this study. In order to rule out bias attributed to the dye, the sample labeling with these dyes was reversed (Yu et al., 2010). Hybridization was performed at 42°C for 16 h in a CapitalBio BioMixer II Hybridization Station (CapitalBio Corp.). Microarray slides were scanned with a LuxScan 10KA confocal laser scanner (CapitalBio Crop.) at 535 nm for Cy3 and 625 nm for Cy5 after washing. The obtained images were then evaluated with LuxScan 3.0 software (CapitalBio Corp.) which employs the LOWESS method (locally weighted scatter plot smoothing regression) (Yang et al., 2002) to minimize differences of dye incorporation efficiency in a two-channel microarray platform. Spots with fluorescence signal intensities of < 800 U (after subtracting the background in both channels) were regarded as empty spots and not analyzed further.

Differential expression analysis was performed in comparing samples of the cold treatment group and control group. The raw fluorescence signal intensity of each spot was normalized to represent the expression level of one gene. The criteria used to identify differentially expressed genes (DEGs) were a fold change of either < 0.5 or > 2 and a p-value of < 0.05 when a comparison was made between samples.

Due to the limited annotation of the Agilent Tobacco Gene Expression Microarray, enhanced function annotations for probe sets were established from the best BlastX hit of the Nicotiana tabacum genome (https://solgenomics.net/organism/Nicotiana_tabacum/genome) with an e-value cutoff of 1e^-3. KEGG enrichment analysis of DEGs was performed using KEGG database, and gene functions were categorized using MapMan bin codes (http://mapman.gabipd.org/) (Usadel et al., 2005). The predication for identified genes derived from tobacco was performed by transferring annotations to the tomato and Arabidopsis genome in consideration of orthologous genes. Pathway mapping and Gene Ontology (GO) enrichment analysis of identified genes was performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (http://www.genome.jp/kegg/) and the gene ontology resource (http://geneontology.org/) (Kanehisa and Goto, 2000).

Cluster analysis of DEGs was performed using Cluster 3.0 software (version 3.0; http://bonsai.hgc.jp/~mdehoon/software/cluster/) (De Hoon et al., 2004).

Total RNA was isolated from stem tips using the method(s) described above. RNA was reverse-transcribed using a cDNA synthesis kit (Promega, Madison, WI, USA) by following the manufacturers protocol. The qRT-PCR was performed using an EvaGreen qPCR MasterMix (Applied Biological Materials, Richmond, BC, Canada) on a MyiQ2 two-color real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The reaction conditions were as follows: 95°C for 600 seconds followed by 35 cycles of 95°C for 15 seconds and then 60°C for 60 seconds. Gene expression was normalized using actin as an internal control. Three biological replicates were performed for each sample. The primers used ( Table S1 ) were designed using Primer Premier 5.0 software (Premier Biosoft International, Silicon Valley, CA, USA) and the relative quantification method (2-ΔΔCt) was utilized to evaluate quantitative variation between the different treatments (Livak and Schmittgen, 2001).

Enzyme-linked immunosorbent assays (ELISAs) for measuring 24-epicastasterone and related brassinolide (BL) analog (with detection ranges of 0.005 to 50 pmoles) was used in this study. A portion of the stem tip samples were ground in liquid nitrogen using a pre-cooled mortar and pestle and the resulting powder was then mixed with 2 mL of 80% methanol. The mixture was incubated for 4 h at 4°C and then centrifuged for 15 min at 1200 × g. After the supernatant and precipitate were separated, the precipitate was extracted again with 1 mL methanol and the combined supernatant was then dried via nitrogen using a Nitrogen Blowing Apparatus (YGC-36, Baojing, Zhengzhou, China). The residue adhered inside the tube was BR extraction. The steps for BR level measurement were performed following the manual’s instruction for the ELISA Kit (Beinongtianyi, Beijing, China), with the BR content in the fresh stem tips expressed as ng/g FW.

According to the gene sequence of NtBRI1 (Nitab4.5_0005374g0010), NtBRI1 amplification primers (NtBRI1-F: GGATCATCATGAACCTCACAAGTGCTA, NtBRI1-R: ACTAGTTCATAGGTGTTGCTCAGCTCAT) were designed, and BamH I and SPE I digestion sites were introduced into the primers. Then, NtBRI1 was amplified by PCR and introduced into pCAMBIA2301 binary vector. To generate the NtBRI1 CRISPR/Cas9 vector, one target sequence was selected according to a web tool (http://chopchop.cbu.uib.no/), and sgRNA was generated by using overlapping PCR. And then the sgRNA was subcloned into the BamHI site of pCACas9 binary vector. The confirmed plasmids were introduced into Agrobacterium tumefaciens strain GV3101 for subsequent tobacco genetic transformation. Finally, a main cultivated tobacco variety (Honghua Dajinyuan, HD) was used to generate NtBRI1 overexpression plants and NtBRI1 mutant plants.

SPSS statistical software (version 22.0; IBM, Armonk, NY, USA) was used in the statistical analysis in this study. Statistical significance was evaluated by either the Student’s t-test when only two groups were compared or by one-way ANOVA followed by Tukey’s test when multiple groups comparisons. A p-value less than 0.05 was considered as statistically significant.

Data sets containing three independent biological replicates per sample were statistically analyzed. Principal component analysis (PCA) was performed using SIMCA-P software (Umetrics, Umea, Sweden) to assess the expression changes between samples and identify the transcriptomic changes involved in group discrimination.

In investigating the effects of cold stress on flower bud differentiation, the seedlings of N. tabacum (XY1 and YY85) were treated with cold stress (12°C for 10 days). After a transplantation of 25 and 30 days, the stem tips were collected for microscopy analysis. Both XY1 and YY85 exhibited an earlier flower bud differentiation in the cold treatment group than that of control group ( Figure 1 ). Compared to the control seedlings, XY1 and YY85 in the cold treatment group had advanced to the initiation stage of flower bud differentiation (ISFD) and calyx primordial formation stage (CPFS), respectively, when after being transplanted for 25 days ( Figure 1A ). After 5 days, the cold treatment group XY1 and YY85 had reached the CPFS and pistil primordial formation stage (PPFS), respectively, while those in the control group remained at the ISFD and CPFS, respectively ( Figure 1B ), and YY85 is more sensitive to cold treatment. After being transplanted for 25 days, more than 80% seedlings had been completed flower bud differentiation ( Figure 1C ). In contrast, only a few plants of XY1 have completed flower bud differentiation at the same time ( Figure 1D ). Field observation also showed that cold treatment group reached the budding stage earlier than that of control ( Figure S1A ). Consistently, the number of leaves in the low temperature treatment group decreased significantly compared with control, owing to early flower bud differentiation ( Figure S1B ). Based on the comparison between XY1 and YY85, it was clearly demonstrated that YY85 exhibited earlier floral transition and development than that of XY1, and it is more sensitive to cold stress in cold-induced early flowering.

To investigate the molecular mechanism of tobacco flower in response to the cold treatment, transcriptomic analysis was performed using Agilent Tobacco Gene Expression Microarrays. RNA was isolated from the stem tips of XY1 and YY85 that were grown at 28°C and 12°C, and cDNA was synthesized, labeled, hybridized, and analyzed. Principle component analysis (PCA) on the gene expression was performed to demonstrate the particularity of cold treatment samples. In Figure S2A , cold treatment samples of XY1 showed good separatatio from the control samples in PCA1 (60.6%) with a similar result found in samples of YY85. In the cold treatment group, samples of the two strains were not separated in either of the PCA quadrants; however, in the control group, XY1 and YY85 were significantly separated in PCA2 (18.0%). Furthermore, the PCA analysis also exhibited demonstrable repeatability in the replicated samples in XY1 and YY85. The DEGs were selected for further cluster analysis using cluster 3.0 software. A total of 7326 genes that were differentially expressed in response to the cold stress in the two tobacco strains were examined based on their expression values and then clustered into 2 groups ( Figure S2B ). Genes in cluster I were upregulated while genes in cluster II were downregulated in response the cold stress of the two tobacco strains. Cluster analysis performed between samples produced two sub-clusters, indicating a dramatic influence of cold stress on gene expression in stem tips of tobacco.

In order to determine the mechanism by which cold affects stem tips of tobacco, expression levels of genes under cold treatment were compared with those of the control condition. A total of 4176 and 5773 genes were differentially expressed in response to the cold treatment in XY1 and YY85 ( Figure 2A ; Table S2 ), respectively, with 2609 DEGs commonly detected in both XY1 and YY85. Among the commonly detected DEGs, 1304 and 1305 DEGs were upregulated and downregulated in response to the cold stress, respectively ( Figure 2B ).

The multiple functions of DEGs were predicted based on comparisons with functional annotations of the N.tabacum genome and were classified using MapMan bin codes. The results of the functional analyses demonstrated that the DEGs exhibited an extremely similar functional distribution in both XY1 and YY85 when responding to cold treatment. The DEGs were mainly enriched in protein metabolism, RNA, stress, transport, and secondary metabolism. Genes involved in secondary metabolism, cell wall, redox, polyamine metabolism, and mitochondrial ETC were nearly all upregulated in response to cold treatment while the downregulated genes were mainly enriched in RNA, protein metabolism, stress, photosynthesis, and hormone metabolism ( Figure 2C ).

Genes related to the flowering pathway are listed in the Song and Chen study (Song and Chen, 2018). In order to analyze the expression of tobacco flowering genes in response to cold, the flowering pathway genes of DEGs in tobacco were list in Table 1 . Genes associated with the MADS-box transcription factor family (AGL21, AP1, AGL67, AGL7, and AG), which is a key regulator of the transition into flowering and flower development, were all upregulated in both XY1 and YY85 in response to the cold stress. The upregulation of these genes indicates an advanced flower transition and development in tobacco under the cold treatment, with HUA2 and Flowering locus C (FLC) genes acting as repressors in flower transitioning in Arabidopsis (Jali et al., 2014; Kinmonth-Schultz et al., 2021). It was demonstrated in this study that HUA2 was downregulated in both XY1 and YY85 in response to the cold stress as well as NtFLC expression inhibition (determined by qRT-PCR) in the two tobacco strains when cold stressed ( Figure S3 ).

Phytohormones are crucial for plant flowering, and we sorted the hormone signaling related DEGs in our microarray data. A total of 113 genes were identified to be involved in five phytohormone signal pathway, including auxin, ethylene, abscisic acid (ABA), gibberellin acid (GA) and cytokinin ( Table S3 ). Among them, auxin and ethylene had the most significant changes, with 42 and 41 differently expressed genes, respectively, including auxin transporters, receptors, auxin response factors and repressors, auxin response genes, and lots of ethylene-responsive transcription factors. Abscisic acid signal had 11 DEGs, cytokinin signal had 11 DEGs, and gibberellin signal was the fewest 8 DEGs. Of all 112 genes, 38 genes were up-regulated by cold stress, 72 genes were down-regulated by cold stress, and the expression of 2 genes showed different trends in XY1 and YY85. Most down-regulated genes were involved in auxin and ethylene signaling pathway. About 70% DEGs involved in auxin and ethylene signaling were down-regulated genes by cold stress.

Flower bud differentiation in stem tips is tightly linked to cell differentiation and proliferation. We found that a large number of genes related to cell division and cell cycle were differentially expressed under cold treatment, including many cell division protein kinases (CDKs), cell division cycle (CDCs) genes, Cyclin B and Cyclin D genes ( Table S4 ). Furthermore, expansin proteins is crucial regulators of cell growth by modulating cell wall organization, and we found that many expansin genes were up-regulated by cold stress ( Table S4 ). These data indicating that cold stress may reprogram cell differentiation, proliferation and growth of tobacco shoot apical meristem (SAM) to promote flower bud differentiation.

To further understand the function of DEGs affected by cold stress in tobacco, all detected genes were subjected to the KEGG and GO enrichment analysis ( Table S5 ; Figure S4 ). Twelve and twenty enriched KEGG pathways were identifified as signifificant with Qvalues < 0.05 in XY1 and YY85, respectively ( Table S5 ). An internal timing mechanism called the circadian clock is important for determining flowering by integrating multiple environmental signals (Freytes et al., 2021). KEGG enrichment data showed that 22 DEGs are enriched in the circadian system with a large number of up-regulated genes, including COP1, LHY and CO et al, indicating cold-induced early flowering is also closely related to circadian clock ( Figure 3 and Table S7 ). During the signifificantly altered KEGG pathways, some secondary metabolism pathway, starch and sucrose metabolism, amino acid metabolism and brassinosteroid biosynthesis are involved in tobacco response to cold stress. For brassinosteroid biosynthesis, ten brassinosteroid biosynthesis related genes were identifified with a signifificant change in their expression levels (with 9 up-regulated and 1 downregulated) in response to the cold stress ( Table S4 ). The function and the expression of these DEGs are displayed in Figure 4A . In addition to brassinosteroid, we also found that many hormones synthesis related genes were differently expressed, including: auxin, zeatin-riboside, ethylene, abscisic acid, gibberellin and cytokinin ( Table S6 ). These results indicated that cold stress promoted flower bud differentiation process by modulating multiple signal pathway in tobacco.

The analysis of DEGs enriched in brassinosteroid biosynthesis pathway indicated that the brassinosteroid (BR) biosynthetic pathway may be affected by cold treatment, and in order to further analyze the relationship between cold stress and brassinosteroid in cold-induced tobacco flower bud differentiation, we measured the content of brassinosteroid in tobacco after cold stress treatment. BR was extracted from stem tips collected from tobacco under 28°C and 12°C conditions and the content was measured by using an ELISA technique to determine the level of BR in tobacco under cold stress treatment. The results indicate that BR contents in XY1 and XY85 tobaccos under cold treatment were significantly increased than those in control plants under normal condition ( Figure 4B ), indicating the mutual influence of cold treatment on BR content in tobacco plants. Furthermore, we found that the expression of NtFLC in tobacco was rapidly inhibited by BR, while NtFLY was not affected by BR in a short time treatment ( Figure S5 ), suggesting that cold stress may suppress FLC expression through brassinosteroid signaling, leading to cold-inducing early flowering in tobacco.

As a brassinosteroid receptor, BRI1 is essential for BR perception and signaling transduction by interacting with BAK1 to regulate plant growth and development in plants as well as in floral-induction (Li et al., 2002; Li et al., 2010; Nolan et al., 2019). And we found that the expression of NtBRI1 was induced by BR and cold stress in tobacco ( Figure S6 ). In order to understand whether cold-induced early flowering is dependent on BR signaling, we constructed NtBRI1 overexpression lines (NtBRI1-ox). Under normal conditions, NtBRI1-ox exhibited earlier flowering than WT. While, NtBRI1-ox and WT showed no significant difference in flowering time under low temperature treatment ( Figures 5A, B ). qPCR data showed that the expression of FLC was significantly inhibited in the wild type plants under low temperature treatment. And the expression of FLC gene was at a low level in NtBRI1-ox whether treated with low temperature or not. On the other hand, low temperature could induce the expression of LFY, an essential transcriptional regulator that promotes the transition to flowering, in wild-type plants, but the expression of LFY in NtBRI1-ox is at a high level whether treated or not treated with low temperature ( Figure 5C ). Furthermore, the mutant of NtBRI1 was generated (Ntbri1-1 and Ntbri1-2), and several bases deletion in NtBRI1 lead to early translation termination in Ntbri1-1 and Ntbri1-2 ( Figure 6A ). Under normal conditions, Ntbri1-1 and WT show similar flowering time. After cold treatment, both Ntbri1-1 and WT exhibited early flowering, and Ntbri1-1 flowering later than that of WT ( Figures 6B, C ). In addition, we found that the expression of FLC was significantly induced in Ntbri1-1 compared with WT after cold treatment. And cold treatment induced the expression of LFY in Ntbri1-1 was significantly lower than that of WT ( Figure 6D ). These results show that low temperature can regulate the expression of flowering related genes through BR signal, and NtBRI1 participates in the regulation of cold induced early flowering in tobacco. Since the output of brassinosteroid signal mainly depends on the transcription factor of BES1 and BZR1, we analyzed the promoter of some flowering related DEGs (including circadian rhythm, hormone biosynthesis, hormone signal transduction, cell division, cell cyclin and expansin related DEGs) by using PlantPAN 3.0 web tools (http://plantpan.itps.ncku.edu.tw/) (Chow et al., 2019). Results showed that BES1 (CANNTG) and BZR1 (CGTGT/C) recognition motif exists on the promoter sequence of these genes ( Table S8 ), indicating that brassinosteroid may affect the expression of these genes in the BES1 and BZR1 dependent manner.

The transition from vegetative growth to flowering is of utmost importance, with environment cues influencing a plant’s flower transition through the strict genetic control (Quiroz et al., 2021). As described in the ABC model for floral development, AP2, AP1, AP3, PI, and AG are integral components for regulating development of various floral organs (Bowman et al., 1991). The floral meristem identity genes regulate spatially restricted patterns of the classical ABC model (Weigel and Meyerowitz, 1994; Irish, 2017). AP1 is considered an expression marker for flowering that shows a quantitative relationship between expression level and flowering (Jaya et al., 2010). Cold treatment dismisses AGL19 expression by activating AP1, thus resulting in flowering in Arabidopsis (Kim et al., 2013). Since AG is a master regulator that guides floral determinacy, ag mutations produced abnormal flower phenotypes (Bowman et al., 1989). In Arabidopsis, AG was activated during the early phase of flower development by the LEAFY and WUSCHEL genes (Busch et al., 1999; Lenhard et al., 2001; Lohmann et al., 2001). Early expression of AG was negatively regulated by AP2 and is distributed throughout third and fourth whorl organ primordia; however, it was proven that late AG expression is not directly dependent on AP2 activity (Bowman et al., 1991). FLC is the central regulator of flowering induction by vernalization, as there is a quantitative relationship between the duration of cold treatment and the extent of FLC activity downregulation. Furthermore, HUA2 acts as a repressor with FLC, as the missing expression of HUA2 in the hua2 mutant led to a significant decrease in FLC expression, but with no influence on AG expression (Cheng et al., 2003). In this study, a series of flowering pathway related genes (including AP1 and AG) were shown to be upregulated while FLC and HUA2 were downregulated in the stem tips of tobacco in response to the cold stress, indicating that cold stress induces events of floral transition and promote the flowering pathway.

Recent microarray analysis reveals that the cold response of plants was controlled by the circadian clock (Nakaminami et al., 2009). In this study, many circadian system related genes were identified and most of them were showed significantly increased expression in response to the cold stress ( Figure 6 ; Table S7 ), indicating that cold may induce the floral transition by up-regulating the expression of circadian system related genes in tobacco. In further investigating the molecular mechanism of the regulation of early flora transition by cold, the DEGs were analyzed and showed that the ARR related genes exhibited positive expression in both XY1 and YY85. ARR (APRR) genes are important components of the circadian clock mechanism that regulates the diverse biological processes, including the control of flowering and abiotic stress response (Liu et al., 2015). PRR7, PRR9, and TOC1 have been shown to be transcriptional repressors involved in the transcriptional-translational feedback loops in the circadian network and can repress the clock components CCA1 and LHY when expressed at dawn (Nakamichi et al., 2010; Gendron et al., 2012). The CCA1 and LHY, in turn, can activate the expression of PRR9 and PRR7 as well as repress the expression of TOC1 (Farré et al., 2005), and the Myb transcription factors, including CCA1 and LHY, act as activators for TOC1 (Rawat et al., 2011). The constituted core feedback loop by CCA1, LHY, and TOC1 elicits a dramatic effect on the CO-FT pathway and regulates short vegetative phase (SVP) genes, with SVP represses the expression of the floral pathway genes by interacting with FLC in vegetative tissue (Li et al., 2008). In our study, the circadian clock related the genes COP1, LHY, and autonomous pathway related genes such as CO were significantly regulated by cold stress, suggesting a close relationship of cold and circadian system in tobacco flower bud differentiation ( Figure 6 ; Table S7 ).

Floral transition is known to be regulated by multiple interacting endogenous hormone signaling and environmental cues. In this study, we found that a large number of hormone synthesis and signal transduction pathways related genes were differentially expressed under cold treatment, among which changes of auxin and ethylene signaling were the most obvious. Auxin can promote floral meristem initiation by modulating the expression of LFY (Cucinotta et al., 2021). Under cold treatment, we found that the expression of NtLFY was significant induced, suggesting that auxin may be involved in cold induced NtLFY expression to promote floral meristem initiation. In a previous study, Ogawara et al. showed that ethylene signaling is involved in regulation transition from vegetative growth to flowering in Arabidopsis (Ogawara et al., 2003). In our data, EIN2 and EIL3, two key components of ethylene signal, are significantly up-regulated by cold stress, implying ethylene signaling was activated by cold stress. GA is generally understood to be one of the critical regulators in mediating the flowering (Jung et al., 2012). Recent evidence indicates that GA biosynthetic genes are induced by cold stress in dormant buds (Rinne et al., 2011); however, the detailed regulation mechanism in mediating the flowering in the cold treated plants were remain unclear.

In addition to playing a crucial role in flower bud differentiation, these changed hormone signals may also take part in tobacco response to cold stress. Usually, cold stress could induce the accumulation of ABA in plants, leading to the closure of plant stomata to help plants adapt to low temperature environment (Agurla et al., 2018). GAs induced degradation of DELLA repressor protein is also involved in cold responses. Recently, Lantzouni et al. showed that DELLAs could interact with GROWTH REGULATORY FACTOR (GRF) to regulate plant growth under cold stress (Lantzouni et al., 2020). Under cold stress, the biosynthesis and signal transduction of multiple hormones have changed, suggesting that the change of multiple hormone signals induced by cold stress may play two roles at the same time, including flower bud differentiation and cold stress tolerance.

BRs are a class of steroidal hormones essential for plant growth and development (Kim and Russinova, 2020). And as biologically active agents, BL and other BRs have since been identified and widely recognized as a major group of plant growth regulators (Bajguz and Tretyn, 2003; Zullo and Kohout, 2004). In this study, the KEGG enrichment of DEGs demonstrated that the brassinosteroid biosynthesis pathway exhibited a very positive response to the cold stress, with phytochemical measurement confirming the increase of BL accumulation in the two cold treated tobacco strains ( Figure 3 ). Although there is limited information regarding the function of BRs in regulation of flowering transition, the role of BRs in a flowering physiological study was investigated. Domagalska showed that the mutations impaired in BR biosynthesis exhibited typical phenotype of delayed flowering in Arabidopsis (Domagalska et al., 2007). As Li et al. reviewed, there may be multiple regulation relationships between BRs and the flowering time (Li et al., 2010).

One possible relationship is that BRs regulate the floral transition through the circadian system given the fact that it has been shown that BRs shortened the period of circadian rhythm of chlorophyll a/b binding protein (CAB), cold and circadian-regulated 2 (CCR2), and circadian clock associated 1 (CCA1) under both continuous white light and dark (Hanano et al., 2006). As we understand, the circadian clock is an endogenous mechanism that regulates metabolism and physiology in plant life. The circadian system displays dramatic effects on the flowering time by regulating the CO and FT genes (Suárez-López et al., 2001; Yanovsky and Kay, 2002). The secondary relationship is that BRs regulate the flowering time by mediating the expression of FLC by the BRI regulation pathway. It has been demonstrated in Arabidopsis that BR signaling promotes flowering by increasing the repression level of the luminidependens (LD), FCA, and FLC genes that are in the autonomous pathway (Domagalska et al., 2007). Another link between floral induction and BR signaling is the interaction between bri1-ems-supressor 1 (BES1) and early flowering 6/relative of early flowering 6 proteins. In Yu’s study, the BES1 was demonstrated to recruit ELF6 and REF6 to regulate the autonomous genes in Arabidopsis (Yu et al., 2008). Promoter analysis also showed that some BES1/BZR1 recognition motifs existed in DEGs, suggesting that these genes may be regulated by BES1/BZR1. In this study, we identified that BR signaling pathways may respond to the cold stress contributed to the apparent expression of related genes in these pathways, especially the NtBRI1 genes. BL accumulation first responded to the cold stress in the stem tips of tobacco, and then the BR signaling regulated flowering related genes, thus leading to phenotypic characteristics of early floral transition.