<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1136262</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Effect of silencing <italic>Bemisia tabaci TLR3</italic> and <italic>TOB1</italic> on fitness and begomovirus transmission</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Thesnim</surname>
<given-names>Pathukandathil</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2158615"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jangra</surname>
<given-names>Sumit</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1473073"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kumar</surname>
<given-names>Manish</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1950407"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ghosh</surname>
<given-names>Amalendu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/570349"/>
<xref ref-type="author-notes" rid="fn004">
<sup>&#x2021;</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Insect Vector Laboratory, Advanced Centre for Plant Virology, ICAR-Indian Agricultural Research Institute</institution>, <addr-line>New Delhi</addr-line>, <country>India</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Division of Entomology, ICAR-Indian Agricultural Research Institute</institution>, <addr-line>New Delhi</addr-line>, <country>India</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Muhammad Naeem Sattar, King Faisal University, Saudi Arabia</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Khalid Mehmood, Muhammad Nawaz Shareef University of Agriculture, Pakistan; Luc Swevers, National Centre of Scientific Research Demokritos, Greece; Walter Leke, Institute for Agricultural Research for Development (IRAD), Cameroon; Tahir Farooq, Guangdong Academy of Agricultural Sciences, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Amalendu Ghosh, <email xlink:href="mailto:amal4ento@gmail.com">amal4ento@gmail.com</email>
</p>
</fn>
<fn fn-type="present-address" id="fn003">
<p>&#x2020;Present address: Sumit Jangra, Tropical Research and Education Centre, University of Florida, Homestead, FL, United States, Manish Kumar, Department of Plant Pathology, College of Agricultural &amp; Environmental Sciences, University of Georgia, Tifton, GA, United States</p>
</fn>
<fn fn-type="other" id="fn004">
<p>&#x2021;ORCID: Amalendu Ghosh, <uri xlink:href="https://orcid.org/0000-0001-6634-5771">orcid.org/0000-0001-6634-5771</uri>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Plant Pathogen Interactions, a section of the journal Frontiers in Plant Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>14</day>
<month>03</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1136262</elocation-id>
<history>
<date date-type="received">
<day>02</day>
<month>01</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>22</day>
<month>02</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Thesnim, Jangra, Kumar and Ghosh</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Thesnim, Jangra, Kumar and Ghosh</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Bemisia tabaci</italic> (Hemiptera: Aleyrodidae) is one of the most important invasive pests worldwide. It infests several vegetables, legumes, fiber, and ornamental crops. Besides causing direct damage by sucking plant sap, <italic>B. tabaci</italic> is the principal vector of begomoviruses. <italic>Chilli leaf curl virus</italic> (ChiLCV<italic>, Begomovirus</italic>) transmitted by <italic>B. tabaci</italic> is a major constraint in chilli production. <italic>B. tabaci</italic> genes associated with metabolism, signaling pathways, cellular processes, and organismal systems are highly enriched in response to ChiLCV infection. The previous transcriptome study suggested the association of <italic>B. tabaci Toll-like receptor 3</italic> (<italic>TLR3</italic>) and <italic>transducer of erbB2.1</italic> (<italic>TOB1</italic>) in ChiLCV infection. In the present study, <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> were silenced using double-stranded RNA (dsRNA) and the effect on fitness and begomovirus transmission has been reported. Oral delivery of dsRNA at 3 &#xb5;g/mL reduced the expression of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> by 6.77 and 3.01-fold, respectively. Silencing of <italic>TLR3</italic> and <italic>TOB1</italic> induced significant mortality in <italic>B. tabaci</italic> adults compared to untreated control. The ChiLCV copies in <italic>B. tabaci</italic> significantly reduced post-exposure to <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs. The ability of <italic>B. tabaci</italic> to transmit ChiLCV also declined post-silencing <italic>TLR3</italic> and <italic>TOB1</italic>. This is the first-ever report of silencing <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> to induce mortality and impair virus transmission ability in <italic>B. tabaci</italic>. <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> would be novel genetic targets to manage <italic>B. tabaci</italic> and restrict the spread of begomovirus.</p>
</abstract>
<kwd-group>
<kwd>whitefly</kwd>
<kwd>RNAi</kwd>
<kwd>ChiLCV</kwd>
<kwd>Toll-like receptor 3</kwd>
<kwd>transducer of erbB2.1</kwd>
<kwd>virus-vector relationship</kwd>
</kwd-group>
<counts>
<fig-count count="3"/>
<table-count count="1"/>
<equation-count count="1"/>
<ref-count count="39"/>
<page-count count="9"/>
<word-count count="4632"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Silverleaf whitefly [<italic>Bemisia tabaci</italic> (Gennadius), Hemiptera: Aleyrodidae] is a key agricultural pest of horticultural and field crops worldwide. Except for Antarctica, <italic>B. tabaci</italic> has been reported from all the continents. It infests over 900 plant species (<xref ref-type="bibr" rid="B1">Abd-Rabou and Simmons, 2010</xref>; <xref ref-type="bibr" rid="B18">Li et&#xa0;al., 2011</xref>). Adults and nymphs of <italic>B. tabaci</italic> cause economic damage to a wide range of vegetables, legumes, fibers, and ornamentals. <italic>B. tabaci</italic> causes direct damage to plants by sucking sap. Besides, it affects the quality and quantity of the produce by secreting honeydew and transmitting plant viruses (<xref ref-type="bibr" rid="B12">Jones, 2003</xref>; <xref ref-type="bibr" rid="B10">Hogenhout et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B11">Horowitz et&#xa0;al., 2020</xref>). <italic>B. tabaci</italic> transmits more than 400 plant viruses of the genera <italic>Begomovirus</italic> (<italic>Geminiviridae</italic>)<italic>, Torradovirus</italic> (<italic>Secoviridae</italic>), <italic>Carlavirus</italic> (<italic>Betaflexiviridae</italic>)<italic>, Crinivirus</italic> (<italic>Colesteroviridae</italic>), <italic>Ipomovirus</italic> (<italic>Potyviridae</italic>), <italic>Polerovirus</italic> (<italic>Solemoviridae</italic>), and <italic>Cytorhabdovirus</italic> (<italic>Rhabdoviridae</italic>) (<xref ref-type="bibr" rid="B37">Wang et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B7">Ghosh and Ghanim, 2021</xref>). <italic>B. tabaci</italic> is the principal vector of begomoviruses that cause annual losses of around 300 million US$ every year (<xref ref-type="bibr" rid="B34">Varma and Malathi, 2003</xref>; <xref ref-type="bibr" rid="B22">Navas-Castillo et&#xa0;al., 2011</xref>). The yield losses in vegetable crops caused by begomoviruses range from 20-100% (<xref ref-type="bibr" rid="B26">Polston and Anderson, 1997</xref>). <italic>B. tabaci</italic> transmits begomovirus in a persistent-circulative manner which means the virus particles need to cross the midgut barrier and reach the salivary glands through hemolymph in <italic>B. tabaci</italic> (<xref ref-type="bibr" rid="B28">Rosen et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B4">Czosnek et&#xa0;al., 2017</xref>). Several proteins such as heat shock protein 70 (hsp70), cyclophilin B (CypB), and peptidoglycan recognition protein (PGRP) were reported to interact with the coat protein of begomovirus in the midgut of <italic>B. tabaci</italic> (<xref ref-type="bibr" rid="B8">G&#xf6;tz et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B13">Kanakala and Ghanim, 2016</xref>; <xref ref-type="bibr" rid="B38">Wang et&#xa0;al., 2016</xref>). The current understanding of <italic>B. tabaci</italic>-begomovirus interactions is largely based on the tomato yellow leaf curl virus (TYLCV). Limited evidence is available on the functions of <italic>B. tabaci</italic> genes in the transmission of other predominant begomoviruses.</p>
<p>Chilli leaf curl virus (ChiLCV) poses a significant problem in chilli production especially in tropical and sub-tropical countries (<xref ref-type="bibr" rid="B30">Senanayake et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B31">Shingote et&#xa0;al., 2022</xref>). ChiLCV is a monopartite begomovirus with a circular, single-stranded DNA-A component of 2.7 kb and associated with alphasatellites (~1.4 kb) and/or betasatellites (~1.3 kb). The symptoms of ChiLCV include upward leaf curling, crinkling, puckering, and stunting of the entire plant. Under extreme circumstances, fruit yields have been recorded to drop by up to 100 percent (<xref ref-type="bibr" rid="B32">Thakur et&#xa0;al., 2018</xref>). The application of pesticides to curb <italic>B. tabaci</italic> is the primary control measure in practice (<xref ref-type="bibr" rid="B11">Horowitz et&#xa0;al., 2020</xref>). However, chemical insecticides are largely ineffective against <italic>B. tabaci</italic> due to the quick development of insecticide resistance. In India, an epidemic of <italic>B. tabaci</italic>-transmitted viral diseases during 2015-16 was mainly due to the failure of chemical pesticides (<xref ref-type="bibr" rid="B35">Verma and Bhattacharya, 2015</xref>; <xref ref-type="bibr" rid="B16">Kumar et&#xa0;al., 2020</xref>). Chemical insecticides also have the issue of health and environmental hazards.</p>
<p>Implementation of RNA interference (RNAi) would be a novel alternative for the sustainable management of <italic>B. tabaci</italic> and begomoviruses. RNAi is a eukaryotic gene silencing mechanism that has been employed to impair the development, fecundity, and survival of insect pests by knocking down key genes involved in the processes. However, inadequate information on the gene function of the target pest has restricted the scope of developing an RNAi-based pest management programme. Silencing of <italic>B. tabaci hsp70</italic> and <italic>fasciclin 2</italic> (<italic>fas2)</italic> modulates the ChiLCV transmission (<xref ref-type="bibr" rid="B3">Chakraborty and Ghosh, 2022</xref>). In our previous study, the differentially expressed genes (DEGs) of <italic>B. tabaci</italic> in response to ChiLCV have been reported (<xref ref-type="bibr" rid="B23">Nekkanti et&#xa0;al., 2022</xref>). DEGs associated with innate immunity such as <italic>Toll-like receptor 3 (TLR3)</italic>, <italic>fas2</italic>, <italic>transducer of erbB2.1</italic> (<italic>TOB1</italic>), and <italic>GMP reductase</italic> were highly abundant. Toll receptors induce interferons to confer antiviral resistance in vertebrates (<xref ref-type="bibr" rid="B17">Lester and Li, 2014</xref>). <italic>TOB1</italic> attenuates IRF3-directed antiviral responses by recruiting HDAC8 in virus-infected macrophages (<xref ref-type="bibr" rid="B39">Yu et&#xa0;al., 2022</xref>). However, the role of <italic>TLR3</italic> and <italic>TOB1</italic> in the virus transmission by <italic>B. tabaci</italic> or any other arthropods is not known. In the present study, <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> were chosen to be silenced through RNAi and the resultant effect on fitness and ChiLCV transmission ability of <italic>B. tabaci</italic> has been reported. To the best of our knowledge, this is the first evidence of functional validation of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> for ChiLCV transmission.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>
<italic>B. tabaci</italic> Asia II 1 population</title>
<p>An isofemale population of <italic>B. tabaci</italic> Asia II 1 being maintained at the whitefly rearing facility, Advanced Centre for Plant Virology, Indian Agricultural Research Institute (IARI), New Delhi since 2015 was used in the present study. The iso-female line was reared on eggplants, <italic>Solanum melongena</italic> (var. Navkiran, Mahyco, India) at 28 &#xb1; 2&#xb0;C temperature, 60 &#xb1; 10% RH, and 16 hr light - 8 hr dark photoperiod. The identity of the pure culture was confirmed by sequencing of mitochondrial cytochrome oxidase subunit I (<italic>mtCOI</italic>).</p>
</sec>
<sec id="s2_2">
<title>ChiLCV culture</title>
<p>The initial inoculum was taken from a pure culture of ChiLCV maintained at the laboratory by <italic>B. tabaci-</italic>inoculation. The culture was maintained on chilli plants (var. Priti, Nunhems) in insect-proof conditions. The identity of the virus was further confirmed by sequencing the DNA-A component amplified in PCR using primer pair, Begomo F-Begomo R (<xref ref-type="bibr" rid="B2">Akhter et&#xa0;al., 2009</xref>).</p>
</sec>
<sec id="s2_3">
<title>Designing and synthesis of dsRNA</title>
<p>In our previous study, the expression of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> was found highly abundant in response to ChiLCV infection (<xref ref-type="bibr" rid="B23">Nekkanti et&#xa0;al., 2022</xref>). In the present study, dsRNAs were designed to knock down <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic>. The conserved regions were identified by aligning the sequences of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> available in NCBI. Putative siRNAs in the conserved regions were identified using the siRNA Wizard online tool (<ext-link ext-link-type="uri" xlink:href="https://www.invivogen.com/sirna-wizard">https://www.invivogen.com/sirna-wizard</ext-link>, accessed on 12-12-2021). The regions with the maximum number of siRNAs were selected for designing dsRNA. The dsRNA stretch was further investigated for off-target effects with other organisms like humans, mice, birds, ants, and bees. A dsRNA targeting <italic>Thrips palmi collagen alpha-1(III) chain-like</italic> (<italic>TpCOL3A1</italic>) and not specific to <italic>B. tabaci</italic> was used as negative control.</p>
<p>The primer pairs were designed using the NCBI primer blast tool (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/tools/primer-blast">https://www.ncbi.nlm.nih.gov/tools/primer-blast</ext-link>) to amplify the dsRNA stretches. The primers were validated and PCR conditions were optimized in a gradient PCR. The primer pairs used in the study are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. A 25 &#xb5;L PCR mixture contained 1X PCR buffer (Thermo Fisher Scientific, USA), 0.4 &#xb5;M of each forward and reverse primer (GCC Biotech, India), 0.26 mM dNTP mix (Thermo Fisher Scientific), 50 ng DNA template of <italic>B. tabaci</italic>, and 2 U of DreamTaq DNA polymerase (Thermo Fisher Scientific). PCR was performed in a T100 thermocycler (Bio-Rad, USA) with initial denaturation at 95&#xb0;C for 5 min followed by 35 cycles of denaturation at 95&#xb0;C for 40 s, annealing at 55&#xb0;C for 40 s, extension at 72&#xb0;C for 40 s, and a final extension at 72&#xb0;C for 10 min. The amplified PCR products were resolved on 2% agarose gel along with 1 kb plus DNA ladder (Thermo Fisher Scientific) and visualized under a Gel documentation system (MaestroGen Inc, Taiwan).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>List of primers used in the study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Sl. No.</th>
<th valign="top" align="left">Gene name</th>
<th valign="top" align="left">Primer Name</th>
<th valign="top" align="left">Primer Sequence (5&#xb4;-3&#xb4;)</th>
<th valign="top" align="left">Annealing temperature (&#xb0;C) in PCR/qPCR</th>
<th valign="top" align="left">Amplicon size</th>
<th valign="top" align="left">Purpose</th>
<th valign="top" align="left">Reference</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="2" align="left">1</td>
<td valign="top" rowspan="2" align="left">Begomovirus DNA-A</td>
<td valign="middle" align="left">Begomo F</td>
<td valign="middle" align="left">ACGCGTGCCGTGCTGCTGCCCCCATTGTCC</td>
<td valign="top" rowspan="2" align="left">57</td>
<td valign="top" rowspan="2" align="left">2.7 kb</td>
<td valign="top" rowspan="2" align="left">Detection of begomovirus</td>
<td valign="top" rowspan="2" align="left">
<xref ref-type="bibr" rid="B2">Akhter et&#xa0;al., 2009</xref>
</td>
</tr>
<tr>
<td valign="middle" align="left">Begomo R</td>
<td valign="middle" align="left">ACGCGTATGGGCTGYCGAAGTTSAGAC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">2</td>
<td valign="top" rowspan="2" align="left">ChiLCV coat protein</td>
<td valign="top" align="left">AG149F</td>
<td valign="top" align="left">TGAACAGGCCCATGAACAG</td>
<td valign="top" rowspan="2" align="left">53</td>
<td valign="top" rowspan="2" align="left">290 bp</td>
<td valign="top" rowspan="2" align="left">Estimation of ChiLCV copies</td>
<td valign="top" rowspan="2" align="left">
<xref ref-type="bibr" rid="B29">Roy et&#xa0;al., 2021</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">AG150R</td>
<td valign="top" align="left">ACGGACAAGGAAAAACATCAC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">3</td>
<td valign="top" rowspan="2" align="left">
<italic>mtCOI</italic> gene</td>
<td valign="top" align="left">C1-J-2195</td>
<td valign="top" align="left">TTGATTTTTTGGTCATCCAGAAGT</td>
<td valign="top" rowspan="2" align="left">53</td>
<td valign="top" rowspan="2" align="left">860 bp</td>
<td valign="top" rowspan="2" align="left">Identification of cryptic species of <italic>B. tabaci</italic>
</td>
<td valign="top" rowspan="2" align="left">
<xref ref-type="bibr" rid="B41">Simon et&#xa0;al., 1994</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">L2-N-3014</td>
<td valign="top" align="left">TCCAATGCACTAATCTGCCATATTA</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">4</td>
<td valign="top" rowspan="2" align="left">
<italic>&#x3b2;-actin</italic>
</td>
<td valign="top" align="left">AG177F</td>
<td valign="top" align="left">ACATGGAAAAGATCTGGCAT</td>
<td valign="top" rowspan="2" align="left">55</td>
<td valign="top" rowspan="2" align="left">121 bp</td>
<td valign="top" rowspan="2" align="left">Housekeeping gene</td>
<td valign="top" rowspan="2" align="left">
<xref ref-type="bibr" rid="B3">Chakraborty and Ghosh, 2022</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">AG178R</td>
<td valign="top" align="left">TGAGTCATCTTTTCACGGTT</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">5</td>
<td valign="top" rowspan="2" align="left">
<italic>TOB1</italic>
</td>
<td valign="top" align="left">AG301F</td>
<td valign="top" align="left">AGGTCAGCTATAGGATTGGT</td>
<td valign="top" rowspan="2" align="left">53</td>
<td valign="top" rowspan="2" align="left">167 bp</td>
<td valign="top" rowspan="2" align="left">dsRNA synthesis, qPCR</td>
<td valign="top" rowspan="2" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">AG302R</td>
<td valign="top" align="left">TGAGCTGACTTAAACTGGAC</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">6</td>
<td valign="top" rowspan="2" align="left">
<italic>TLR3</italic>
</td>
<td valign="top" align="left">AG568F</td>
<td valign="top" align="left">GCATCGCAAAAGTATAAAGC</td>
<td valign="top" rowspan="2" align="left">53</td>
<td valign="top" rowspan="2" align="left">340 bp</td>
<td valign="top" rowspan="2" align="left">dsRNA synthesis, qPCR</td>
<td valign="top" rowspan="2" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">AG569R</td>
<td valign="top" align="left">CGAGACGTAGGAACTAATGT</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>The amplified PCR products were eluted, ligated in the L4440 expression vector between two T7 promoters, and sequenced for further confirmation. The recombinant plasmids were transformed into RNase III mutant <italic>E. coli</italic> HT115 cells. The recombinant <italic>E. coli</italic> HT115 cells were induced with 0.8 M isopropyl-&#x3b2;-D-1-thiogalactopyranoside (IPTG) and cultured overnight at 37&#xb0;C in a shaking incubator. Total RNA from the induced HT115 cells was extracted using Trizol reagent (Invitrogen, CA, USA) and resuspended in nuclease-free water. The dsRNA was purified by incubating with 1 U of RNase A, DNase and protease-free (Thermo Fisher Scientific) and 1 U of DNase I, RNase-free (Thermo Fisher Scientific) for 1 hr at 37&#xb0;C in the presence of 500 mM sodium chloride as described by <xref ref-type="bibr" rid="B3">Chakraborty and Ghosh (2022)</xref>. The enzymes were inactivated by chloroform extraction. The purified dsRNA was quantified in a spectrophotometer (NanoDrop 2000, Thermo Fisher Scientific), and visualized on 2% native agarose gel stained with GoodView (BR Biochem, India).</p>
</sec>
<sec id="s2_4">
<title>Oral delivery of dsRNAs to <italic>B. tabaci</italic>
</title>
<p>The purified <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs were separately delivered to <italic>B. tabaci via</italic> the oral feeding method described by <xref ref-type="bibr" rid="B3">Chakraborty and Ghosh (2022)</xref>. Briefly, around 30 flies were collected in each cylindrical pet bottle (3.5 cm diameter, 16 cm height). The open end of the bottle was sealed with a stretched UV-sterilized Parafilm M. Based on our previous study, purified dsRNA at 3.0 &#x3bc;g/mL was supplemented with the artificial diet comprised of 20% sucrose and 5% yeast extract. The diet with dsRNA was sandwiched between two layers of stretched Parafilm M membrane. A diet without dsRNA and diet with <italic>TpCOL3A1</italic> dsRNA were served as control. For ventilation, a hole was made in the wall of the pet bottle and sealed with a muslin cloth. The pet bottles were kept in the upright position in dark at 26 &#xb1; 2&#xb0;C and 60% RH. Three replicates were maintained for each treatment and repeated nine times. Percent mortality data was recorded 48 hr post dsRNA exposure. Tukey&#x2019;s test was used to differentiate the mean differences across the categories with a 95% confidence interval using XLSTAT 2014.5.03. The surviving <italic>B</italic>. <italic>tabaci</italic> from these replicates were utilized to examine the relative expression of <italic>TLR3</italic> and <italic>TOB1</italic> mRNA and ChiLCV acquisition and transmission efficiency as described below.</p>
</sec>
<sec id="s2_5">
<title>Estimating expression of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic>
</title>
<p>The relative expression of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> was estimated 48 hr post dsRNA feeding considering the <italic>&#x3b2;-actin</italic> gene as endogenous control. The primer pairs, AG301F-AG302R and AG568F-AG569R for <italic>TOB1</italic> and <italic>TLR3</italic>, respectively were used in the RT-qPCR assay (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). Around 30 surviving <italic>B. tabaci</italic> in three replicates post <italic>TLR3</italic> and <italic>TOB1</italic> dsRNA exposure were used for total RNA isolation using Trizol reagent. The RNA was quantified in a spectrophotometer (NanoDrop 2000) and used for complementary DNA (cDNA) synthesis using the FIREScript RT cDNA synthesis kit (Solis BioDyne, Estonia). The 20 &#x3bc;L reaction mixture comprised of 1.0 &#x3bc;g RNA template, 5 &#x3bc;M oligo dT primers, 500 &#x3bc;M dNTP mix, 2 &#x3bc;L of 1 X reaction buffer, 10 U FIREScript RT, and 1 U RiboGrip RNase inhibitor. cDNA synthesis was carried out in a T100 thermocycler with reverse transcription at 42&#xb0;C for 60 min, and enzyme inactivation at 85&#xb0;C for 5 min. The relative RT-qPCR assay was performed in an Insta Q48M real-time PCR (Himedia, India). A 20 &#xb5;L reaction mixture contained 1X GoTaq qPCR master mix (Promega, USA), 300 nM CXR passive reference dye, 0.25 &#xb5;M of each forward and reverse primer, and 2 &#xb5;L of template cDNA. Thermal cycling was performed at initial denaturation at 95&#xb0;C for 5 min, 35 cycles of 95&#xb0;C for 40 s, 55&#xb0;C for 40 s, and 72&#xb0;C for 40 s. After each reaction, a dissociation or melting curve was performed to evaluate the specificity of the amplicons. Three biological and two technical replicates were used in the RT-qPCR. The relative expression of mRNA in dsRNA-fed <italic>B. tabaci</italic> was measured in comparison to untreated control following the <inline-formula>
<mml:math display="inline" id="im1">
<mml:mrow>
<mml:msup>
<mml:mn>2</mml:mn>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:mi>&#x394;</mml:mi>
<mml:mi>&#x394;</mml:mi>
<mml:mi>CT</mml:mi>
</mml:mrow>
</mml:msup>
</mml:mrow>
</mml:math>
</inline-formula> method (<xref ref-type="bibr" rid="B19">Livak and Schmittgen, 2001</xref>). Microsoft Excel version 2016 was used to perform statistical analysis and prepare graphs. Expression of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> in <italic>TpCOL3A1</italic> dsRNA-fed flies was considered as the negative control.</p>
</sec>
<sec id="s2_6">
<title>Quantification of virus titer in <italic>B. tabaci</italic>
</title>
<p>A portion of surviving flies post-dsRNA exposure was used to quantify the virus titer in <italic>B. tabaci</italic>. The flies were allowed to acquire ChiLCV by feeding on a ChiLCV-infected chilli plant (var. Preeti) for 24 hr. The ChiLCV copies acquired by dsRNA-exposed and nonexposed <italic>B. tabaci</italic> were estimated by absolute quantification in qPCR. DNA was isolated from the batch of 30 adult flies in three replicates using a CTAB extraction buffer as described by <xref ref-type="bibr" rid="B29">Roy et&#xa0;al. (2021)</xref> and quantified in a spectrophotometer. qPCR was performed in Insta Q48M real-time PCR with ChiLCV-specific primer pair, AG149F-AG150R (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) (<xref ref-type="bibr" rid="B29">Roy et&#xa0;al., 2021</xref>). This was followed by a melting curve analysis to check the specificity of the reaction. Each treatment had three biological and two technical replicates. A standard curve of ChiLCV using primer pair AG149F-AG150R generated in our previous study (<xref ref-type="bibr" rid="B3">Chakraborty and Ghosh, 2022</xref>) was used to quantify the ChiLCV copies. The mean CT values obtained in qPCR were fitted into the standard curve and the resulting concentration was used for the calculation of virus copy number in Microsoft Excel 2016 using the following formula.</p>
<disp-formula>
<mml:math display="block" id="M1">
<mml:mrow>
<mml:mrow>
<mml:mi>N</mml:mi>
</mml:mrow>
<mml:mo>=</mml:mo>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:mi>x</mml:mi>
<mml:mo>&#xd7;</mml:mo>
<mml:mn>6.022</mml:mn>
<mml:mo>&#xd7;</mml:mo>
<mml:msup>
<mml:mrow>
<mml:mn>10</mml:mn>
</mml:mrow>
<mml:mrow>
<mml:mn>23</mml:mn>
</mml:mrow>
</mml:msup>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
<mml:mo stretchy="false">/</mml:mo>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:mi>n</mml:mi>
<mml:mo>&#xd7;</mml:mo>
<mml:mn>660</mml:mn>
<mml:mo>&#xd7;</mml:mo>
<mml:msup>
<mml:mrow>
<mml:mn>10</mml:mn>
</mml:mrow>
<mml:mn>9</mml:mn>
</mml:msup>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
</mml:mrow>
</mml:math>
</disp-formula>
<p>where N = number of viral copies, x = amount of amplicon in ng, and n = length of linearized plasmid DNA. The mean differences in virus copies were assessed for statistical significance by Tukey&#x2019;s test at a confidence interval of 95% using XLSTAT 2014.5.03.</p>
</sec>
<sec id="s2_7">
<title>Transmission of ChiLCV by <italic>TLR3</italic> and <italic>TOB1</italic> dsRNA-treated <italic>B. tabaci</italic>
</title>
<p>To check the transmission efficacy of dsRNA-treated <italic>B. tabaci</italic>, a portion of <italic>B. tabaci</italic> exposed to ChiLCV for 24 hr was released onto the healthy chilli plants (var. Preeti) at the 3-4 leaf stage. They were allowed for 24 hr of inoculation feeding and eliminated manually. Ten plants in three replicates were used and four adult females per plant were released. The plants were maintained under insect-proof conditions and monitored for symptom development. <italic>B. tabaci</italic>, not exposed to dsRNA, were used as control. The ChiLCV infection in the inoculated plants was confirmed by ChiLCV-specific PCR at 21 days post-inoculation (dpi).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>
<italic>B. tabaci</italic> population and ChiLCV culture</title>
<p>The identity of the <italic>B. tabaci</italic> population was confirmed by the nucleotide sequence of <italic>mtCOI</italic> gene. PCR with primer pair C1-J-2195 and L2-N-3014 amplified ~600 bp product as visualized on 1% agarose gel. The sequence analysis with BLASTn showed 100% homology to <italic>B. tabaci</italic> Asia II 1. The sequence submitted to GenBank can be retrieved by Accession No. OP223446.</p>
<p>PCR amplified a 2.7 kb product of full-length DNA-A segment from ChiLCV-infected plants. The sequence of DNA-A showed 100% homology to ChiLCV isolates upon BLASTn analysis. The sequence can be retrieved by Accession No. OM513903.</p>
</sec>
<sec id="s3_2">
<title>Synthesis of dsRNA targeting <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic>
</title>
<p>Based on the multiple alignments of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> sequences available in NCBI, the conserved 340 nt and 167 nt stretches of <italic>TLR3</italic> (~5.6 kb) and <italic>TOB1</italic> (~2.28 kb), respectively were chosen for dsRNA designing. The dsRNA sequences were unique to <italic>B. tabaci</italic> and no off-target hits were detected with <italic>Homo sapiens</italic> (taxid: 9605), Formicidae (taxid: 36668), mice (taxid: 10088), honeybees (taxid: 7460), and <italic>Aves</italic> (taxid: 8782) in blastn analysis.</p>
<p>PCR with primer pairs AG568F-AG569R and AG301F-AG302R produced amplicons of 340 bp and 167 bp for <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic>, respectively (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure 1</bold>
</xref>). The nucleotide sequences of the amplified products showed 100% homology with already available <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> sequences. The sequences can be retrieved by Accession No. OP784422 and OP219521. The dsRNA purified from total RNA using DNase I and RNase A produced single specific bands of ~340 bp and ~167 bp, respectively on 2% agarose gel (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). The concentration of <italic>TLR3</italic> dsRNA was 970.0 ng/&#xb5;L, whereas it was 779.9 ng/&#xb5;L in the case of <italic>TOB1</italic> dsRNA.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Delivery of dsRNA targeting <italic>B. tabaci TOB1</italic> and <italic>TLR3</italic>. Artificial feeding setup for <italic>B. tabaci</italic> adults. The artificial diet was supplemented with 3.0 &#x3bc;g/mL of dsRNA and sterile water (control). Red arrows show the <italic>B. tabaci</italic> adults feeding on the artificial diet.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1136262-g001.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>Effect of <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs on target mRNA expression</title>
<p>The feeding of <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs significantly reduced the target gene expression in <italic>B. tabaci</italic> adults. In RT-qPCR analysis, the log <inline-formula>
<mml:math display="inline" id="im2">
<mml:mrow>
<mml:msup>
<mml:mn>2</mml:mn>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:mi>&#x394;</mml:mi>
<mml:mi>&#x394;</mml:mi>
<mml:mi>CT</mml:mi>
</mml:mrow>
</mml:msup>
</mml:mrow>
</mml:math>
</inline-formula>value of <italic>B. tabaci TLR3</italic> expression was 11.55 under normal conditions. Exposure to <italic>TLR3</italic> dsRNA significantly declined the <italic>TLR3</italic> mRNA level by 6.77-fold compared to the untreated control at 48 hr. The downregulation of target gene expression was consistent in all the biological replicates. Similarly, <italic>TOB1</italic> dsRNA significantly down-regulated the <italic>TOB1</italic> mRNA level by 3.01-fold (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). The log2<sup>&#x2212;&#x394;&#x394;CT</sup> value of <italic>B. tabaci TOB1</italic> expression was 3.19 under normal conditions. The reduction in the target mRNA expression level of <italic>B. tabaci</italic> was significantly higher in <italic>TLR3</italic> dsRNA exposure than <italic>TOB1</italic> dsRNA at 48 hr after oral delivery. The expression of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> post <italic>TpCOL3A1</italic> dsRNA exposure was statistically at par with untreated control. There was no significant regulation of the endogenous control gene, <italic>&#x3b2;-actin</italic> between dsRNA-exposed and non-exposed <italic>B. tabaci</italic> populations which indicated the specificity of the <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs on the target mRNAs. The melting curve analysis in RT-qPCR showed that the primer pairs for <italic>TLR3</italic>, <italic>TOB1</italic> and <italic>&#x3b2;-actin</italic> did not produce any secondary peaks that indicated the specificity of the reactions.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Effect of silencing <italic>TOB1</italic> and <italic>TLR3</italic> on survival of <italic>B. tabaci</italic>. <bold>(A)</bold> Normalized relative expression of <italic>B. tabaci TOB1</italic> and <italic>TLR3</italic> mRNA post 48 hr of dsRNA feeding. <bold>(B)</bold> Percent mortality of adult <italic>B. tabaci</italic> post <italic>TLR3</italic> and <italic>TOB1</italic> dsRNA feeding at 3.0 &#xb5;g/mL. The mean denoted by an asterisk (*) indicates a significant difference (p&lt; 0.0001). The error bars are the standard error of the mean (SEM). <bold>(C)</bold> <italic>B. tabaci</italic> adults fed on the diet mixed with <italic>TLR3</italic> and <italic>TOB1</italic> dsRNA and without dsRNA. No morphological deformities were observed in <italic>TOB1</italic> and <italic>TLR3</italic> dsRNA-fed <italic>B. tabaci</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1136262-g002.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Effect of silencing <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> on <italic>B. tabaci</italic> fitness</title>
<p>Feeding on <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs significantly altered the fitness of <italic>B. tabaci</italic> under controlled conditions (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). <italic>TLR3</italic> and <italic>TOB1</italic> dsRNA feeding at a concentration of 3.0 &#x3bc;g/mL induced mortality in <italic>B. tabaci</italic> adults. A mortality of 30.66% was recorded in <italic>TLR3</italic> dsRNA-fed <italic>B. tabaci</italic> 24 hr post-feeding, whereas it was 29.99% when fed on <italic>TOB1</italic> dsRNA. The mortality further increased with an increase in the exposure period. Up to 47.32% mortality was recorded 48 hr post-feeding on <italic>TLR3</italic> dsRNA. In the case of <italic>TOB1</italic> dsRNA, the mortality increased up to 43.99% compared to <italic>B. tabaci</italic> fed on a diet without dsRNA (9.33%). However, no morphological deformities were recorded in the <italic>TLR3</italic> or <italic>TOB1</italic> dsRNA-fed <italic>B. tabaci</italic> when observed under a microscope (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Mortality induced by <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs was found to be significant at p&lt;0.0001 at a confidence limit of 95%. There was no significant mortality of <italic>B. tabaci</italic> post <italic>TpCOL3A1</italic> dsRNA exposure compared to untreated control.</p>
</sec>
<sec id="s3_5">
<title>Effect of <italic>TLR3</italic> and <italic>TOB1</italic> silencing on ChiLCV acquisition and transmission by <italic>B. tabaci</italic>
</title>
<p>Silencing of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> significantly decreased the ChiLCV titer within <italic>B. tabaci.</italic> The mean ChiLCV copy number was 2.84 x 10<sup>7</sup> in <italic>B. tabaci</italic> fed on the diet without dsRNA (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). Exposure to <italic>TLR3</italic> dsRNA at 3 &#x3bc;g/mL induced 45.58 -fold reduction (6.23 x 10<sup>5</sup> copies) in the mean ChiLCV copy. The decrease in ChiLCV copy in <italic>TOB1</italic> dsRNA-treated <italic>B. tabaci</italic> was comparatively lower than in <italic>TLR3</italic> dsRNA treatment. The ChiLCV titer in <italic>B. tabaci</italic> was reduced by 10.75-fold (2.64 x 10<sup>6</sup> copies) post <italic>TOB1</italic> dsRNA exposure. There was no significant change in ChiLCV titer post <italic>TpCOL3A1</italic> dsRNA exposure compared to untreated control.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Effect of silencing <italic>TLR3</italic> and <italic>TOB1</italic> on ChiLCV acquisition and transmission by <italic>B. tabaci</italic>. <bold>(A)</bold> Mean ChiLCV copy numbers acquired by <italic>TLR3</italic> and <italic>TOB1</italic> dsRNA-fed <italic>B. tabaci</italic>. The mean denoted by an asterisk (*) indicates a significant difference (p&lt; 0.0001). The error bars are the standard error of the mean (SEM). <bold>(B)</bold> Leaf curl symptoms on chilli plants inoculated by <italic>B. tabaci</italic> not exposed to dsRNA and exposed to <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1136262-g003.tif"/>
</fig>
<p>
<italic>B. tabaci</italic> that were not exposed to <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs successfully transmitted ChiLCV to the inoculated plants. 93.33% of the inoculated plants tested positive in PCR with ChiLCV-specific primers. The infected plants showed characteristic ChiLCV symptoms like vein clearing, curling, and twisting of leaves, reduction of leaf size, puckering, reduction in inter-nodal length, thickening of leaves, swelling of veins, and overcrowding of leaves (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). Chilli plants inoculated by <italic>B. tabaci</italic> exposed to <italic>TLR3</italic> and <italic>TOB1</italic> dsRNAs showed no symptoms up to 21 dpi. No amplification specific to ChiLCV was recorded in PCR for the plants inoculated by dsRNA-fed <italic>B. tabaci.</italic>
</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Several transcripts of <italic>B. tabaci</italic> are differentially regulated upon ChiLCV infection, yet the functional roles of these genes in virus transmission remain unknown. In ChiLCV-infected <italic>B. tabaci, TLR3</italic> and <italic>TOB1</italic> were highly abundant in adult <italic>B. tabaci</italic> which might facilitate the invasion and multiplication of the virus in <italic>B. tabaci</italic> (<xref ref-type="bibr" rid="B23">Nekkanti et&#xa0;al., 2022</xref>). Toll-like receptors are actively involved in innate immune responses against viruses (<xref ref-type="bibr" rid="B25">Perales-Linares and Navas-Mart&#xed;n, 2013</xref>; <xref ref-type="bibr" rid="B17">Lester and Li, 2014</xref>; <xref ref-type="bibr" rid="B9">He et&#xa0;al., 2021</xref>) and <italic>TLR3</italic> is involved in protective antiviral responses (<xref ref-type="bibr" rid="B24">Ozato et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B5">Fernandes-Santos and Azeredo, 2022</xref>). <xref ref-type="bibr" rid="B25">Perales-Linares and Navas-Mart&#xed;n (2013)</xref> reported that <italic>TLR3</italic> participates in both defense and offense in host immunity to viruses. <italic>TOB1</italic> attenuates IRF3-directed antiviral responses by recruiting HDAC8 to specifically suppress IFN-&#x3b2; expression in virus-infected macrophages. <italic>TOB1</italic> deficiency enhanced antiviral response and suppressed viral replication <italic>in vivo</italic> (<xref ref-type="bibr" rid="B39">Yu et&#xa0;al., 2022</xref>). The present study aimed to understand the functional role of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> in ChiLCV infection.</p>
<p>dsRNAs targeting <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> were orally administered to <italic>B. tabaci</italic> adults in the present study. The expression of <italic>TLR3</italic> and <italic>TOB1</italic> mRNA was down-regulated by 6.67- and 3.01-folds, respectively 48 hr post-dsRNA feeding. dsRNA targeting <italic>T. palmi COL3A1</italic> was taken as a negative control in <italic>B. tabaci</italic>. There was no significant regulation in the expression of <italic>TL3</italic> and <italic>TOB1</italic> post <italic>TpCOL3A1</italic> dsRNA exposure. Significant downregulation of target genes by oral delivery of dsRNA was previously reported for <italic>B. tabaci ribosomal protein L9 (RPL9), vacuolar-type ATPase subunit A (V-ATPase A), cytochrome P450 family 3 subfamily A polypeptide 1 (Cyp315a1), Cyp18a1, ecdysone receptor gene (EcR5), ecdysone inducible gene (E75), hsp70</italic>, and <italic>fas2</italic> (<xref ref-type="bibr" rid="B33">Upadhyay et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B20">Luan et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B36">Vyas et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B3">Chakraborty and Ghosh, 2022</xref>). Feeding on transgenic plants expressing dsRNA showed a down-regulation of around 90% in <italic>B. tabaci aquaporin (AQP)</italic> mRNA level 24 hr post-feeding (<xref ref-type="bibr" rid="B40">Raza et&#xa0;al., 2016</xref>). The difference in the level of silencing might be due to the variation in concentration of dsRNA, exposure period, target mRNA copies, delivery method, and the host&#x2019;s defense mechanism (<xref ref-type="bibr" rid="B27">Ramkumar et&#xa0;al., 2021</xref>).</p>
<p>Silencing of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> also significantly altered the survival of <italic>B. tabaci</italic> adults. Silencing of <italic>B. tabaci TLR3</italic> induced a mean mortality of 30.66% 24 hr post-dsRNA exposure which increased to 47.32% at 48 hr. Similarly, the silencing of <italic>B. tabaci TOB1</italic> caused up to 43.99% mortality compared to <italic>B. tabaci</italic> (9.33%) fed on a diet without dsRNA and diet with <italic>TpCOL3A1</italic> dsRNA. <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> are involved in a network of molecular and biological processes. Loss of <italic>TLR3</italic> and <italic>TOB1</italic> functions due to depletion of mRNA might hamper the critical physiological processes in <italic>B. tabaci</italic>, leading to mortality. Silencing of <italic>actin ortholog</italic>, <italic>ADP/ATP translocase</italic>, <italic>&#x3b1;-tubulin</italic>, <italic>ribosomal protein L9 (RPL9)</italic>, and <italic>V-ATPase A subunit</italic> also caused 27-97% mortality in <italic>B. tabaci</italic> (<xref ref-type="bibr" rid="B33">Upadhyay et&#xa0;al., 2011</xref>). Significant mortality was reported in <italic>B. tabaci</italic> upon silencing <italic>AQP</italic>, <italic>calcitonin</italic> (<italic>CAL</italic>), <italic>SWItch/sucrose non-fermentable</italic> (<italic>SNF7</italic>), <italic>inhibitor of apoptosis</italic> (<italic>IAP</italic>)<italic>, hsp20, hsp40</italic>, <italic>knottin-1</italic> (<italic>k-1</italic>), <italic>CypB</italic>, <italic>hsp70</italic>, and <italic>fas2</italic> (<xref ref-type="bibr" rid="B15">Kaur et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B3">Chakraborty and Ghosh, 2022</xref>). Morphological deformities like twisting wings were reported post-silencing <italic>B. tabaci hsp70</italic> (<xref ref-type="bibr" rid="B14">Kanakala et&#xa0;al., 2019</xref>). However, no such morphological abnormalities were recorded post-silencing <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> in the present study. Probably, <italic>TLR3</italic> and <italic>TOB1</italic> are not involved in any morphogenesis of <italic>B. tabaci</italic> or the exposure was too short to induce any morphological deformities.</p>
<p>Further, silencing of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> reduced the ability of <italic>B. tabaci</italic> to acquire and transmit ChiLCV. The mean ChiLCV copies acquired by <italic>B. tabaci</italic> were decreased by 45.58 and 10.75- folds post-silencing <italic>TLR3</italic> and <italic>TOB1</italic> compared to <italic>B. tabaci</italic> fed on the diet without dsRNA and diet with <italic>TpCOL3A1</italic> dsRNA. There were no symptoms in chilli plants up to 21 dpi when inoculated by <italic>B. tabaci</italic> fed on a diet mixed with <italic>TLR3</italic> or <italic>TOB1</italic> dsRNA. In contrast to the expectation, the results indicated that <italic>TLR3</italic> is not involved in viral defense in <italic>B. tabaci</italic> as silencing of <italic>TLR3</italic> decreases ChiLCV titer and transmission ability. Whereas, a reduction in ChiLCV titer post-silencing <italic>TOB1</italic> supports its negative regulatory role in viral defense. Moreover, both target genes are essential for normal physiological functions in <italic>B. tabaci</italic>. Virus transmission might also be affected due to the poor physiological fitness of <italic>B. tabaci</italic> resulting from the depletion of <italic>TLR3</italic> and <italic>TOB1</italic> mRNAs. The results indicated that <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> would be novel targets to induce mortality and reduce ChiLCV transmission by <italic>B. tabaci</italic>. Complete inhibition of the ChiLCV transmission ability of <italic>B. tabaci</italic> was earlier demonstrated by the spray-on application of naked <italic>hsp70</italic> dsRNA under controlled conditions (<xref ref-type="bibr" rid="B3">Chakraborty and Ghosh, 2022</xref>). A similar strategy to restrict begomovirus spread by <italic>B. tabaci</italic> was used by <xref ref-type="bibr" rid="B38">Wang et&#xa0;al. (2016)</xref> by silencing <italic>B. tabaci defensin-like</italic> gene (<italic>Btdef</italic>) which led to a lower accumulation of tomato yellow leaf curl China virus in <italic>B. tabaci</italic>. However, the silencing of <italic>fas2</italic> increased the ChiLCV acquisition by <italic>B. tabaci</italic> (<xref ref-type="bibr" rid="B3">Chakraborty and Ghosh, 2022</xref>).</p>
<p>The present study is the first to demonstrate the involvement of <italic>B. tabaci TLR3</italic> and <italic>TOB1</italic> in the survival of <italic>B. tabaci</italic> and ChiLCV transmission by RNAi. It enriches our understanding of the gene functions of <italic>B. tabaci</italic> in begomovirus transmission. The outcome of the study would enable an in-depth study on the functional genomics of <italic>B. tabaci</italic> and apprise the <italic>B. tabaci</italic>-begomovirus relationships.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>AG conceived and designed the research and wrote and edited the final manuscript. PT, SJ, and MK conducted the experiments, recorded the experimental data, and wrote the draft manuscript. AG and SJ reviewed the data. All authors read and approved the manuscript. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>The fellowship of PT was supported by the Indian Council of Agricultural Research, New Delhi.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors are thankful to Vinay Kalia, MS Saharan, and Debjani Dey (IARI) for their advisories. The support received from IARI, New Delhi is thankfully acknowledged.</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2023.1136262/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2023.1136262/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SM1" mimetype="application/pdf"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abd-Rabou</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Simmons</surname> <given-names>A. M.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Survey of reproductive host plants of <italic>Bemisia tabaci</italic> (Hemiptera: Aleyrodidae) in Egypt, including new host records</article-title>. <source>Entomol. News</source> <volume>121</volume>, <fpage>456</fpage>&#x2013;<lpage>465</lpage>. doi: <pub-id pub-id-type="doi">10.3157/021.121.0507</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Akhter</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Qazi</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Saeed</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Mansoor</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>A severe leaf curl disease on chilies in Pakistan is associated with multiple begomovirus components</article-title>. <source>Plant Dis.</source> <volume>93</volume>, <fpage>962</fpage>. doi: <pub-id pub-id-type="doi">10.1094/PDIS-93-9-0962B</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chakraborty</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ghosh</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Topical spray of dsRNA induces mortality and inhibits chilli leaf curl virus transmission by bemisia tabaci Asia II 1</article-title>. <source>Cells</source> <volume>11</volume>, <fpage>833</fpage>. doi: <pub-id pub-id-type="doi">10.3390/cells11050833</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Czosnek</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Hariton-Shalev</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sobol</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Gorovits</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Ghanim</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>The incredible journey of begomoviruses in their whitefly vector</article-title>. <source>Viruses</source> <volume>9</volume>, <fpage>273</fpage>. doi: <pub-id pub-id-type="doi">10.3390/v9100273</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fernandes-Santos</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Azeredo</surname> <given-names>E. L.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Innate immune response to dengue virus: Toll-like receptors and antiviral response</article-title>. <source>Viruses</source> <volume>14</volume>, <fpage>992</fpage>. doi: <pub-id pub-id-type="doi">10.3390/v14050992</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghosh</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ghanim</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Factors determining transmission of persistent viruses by bemisia tabaci and emergence of new virus-vector relationships</article-title>. <source>Viruses</source> <volume>13</volume>, <fpage>1808</fpage>. doi: <pub-id pub-id-type="doi">10.3390/v13091808</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>G&#xf6;tz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Popovski</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kollenberg</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Gorovits</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>J. K.</given-names>
</name>
<name>
<surname>Cicero</surname> <given-names>J. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Implication of bemisia tabaci heat shock protein 70 in begomovirus-whitefly interactions</article-title>. <source>J. Virol.</source> <volume>86</volume>, <fpage>13241</fpage>&#x2013;<lpage>13252</lpage>. doi: <pub-id pub-id-type="doi">10.1128/JVI.00880-12</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>Y. J.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Qi</surname> <given-names>Y. H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X. D.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>H. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Activation of toll immune pathway in an insect vector induced by a plant virus</article-title>. <source>Front. Immunol.</source> <volume>11</volume>, <elocation-id>613957</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fimmu.2020.613957</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hogenhout</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Ammar</surname> <given-names>e.-D.</given-names>
</name>
<name>
<surname>Whitfield</surname> <given-names>A. E.</given-names>
</name>
<name>
<surname>Redinbaugh</surname> <given-names>M. G.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Insect vector interactions with persistently transmitted viruses</article-title>. <source>Annu. Rev. Phytopathol.</source> <volume>46</volume>, <fpage>327</fpage>&#x2013;<lpage>359</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev.phyto.022508.092135</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Horowitz</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Ghanim</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Roditakis</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Nauen</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Ishaaya</surname> <given-names>I.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Insecticide resistance and its management in <italic>Bemisia tabaci</italic> species</article-title>. <source>J. Pest Sci.</source> <volume>93</volume>, <fpage>893</fpage>&#x2013;<lpage>910</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s10340-020-01210-0</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jones</surname> <given-names>D. R.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Plant viruses transmitted by whiteflies</article-title>. <source>Eur. J. Plant Pathol.</source> <volume>109</volume>, <fpage>195</fpage>&#x2013;<lpage>219</lpage>. doi: <pub-id pub-id-type="doi">10.1023/A:1022846630513</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanakala</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ghanim</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Implication of the whitefly <italic>Bemisia tabaci</italic> cyclophilin b protein in the transmission of tomato yellow leaf curl virus</article-title>. <source>Front. Plant Sci.</source> <volume>7</volume>, <elocation-id>1702</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fpls.2016.01702</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanakala</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kontsedalov</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lebedev</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Ghanim</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Plant-mediated silencing of the whitefly bemisia tabaci cyclophilin b and heat shock protein 70 impairs insect development and virus transmission</article-title>. <source>Front. Physiol.</source> <volume>10</volume>, <elocation-id>557</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fphys.2019.00557</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaur</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Gupta</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Joshi</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Enhancing RNAi efficiency to decipher the functional response of potential genes in <italic>Bemisia tabaci</italic> AsiaII-1 (Gennadius) through dsRNA feeding assays</article-title>. <source>Front. Physiol.</source> <volume>11</volume>, <elocation-id>123</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fphys.2020.00123</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Kular</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Sidhu</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Chhuneja</surname> <given-names>P. K.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Integrated whitefly [<italic>Bemisia tabaci</italic> (Gennadius)] management in bt-cotton in north India: An agroecosystem-wide community-based approach</article-title>. <source>Curr. Sci.</source> <volume>119</volume> (<issue>4</issue>), <fpage>618</fpage>&#x2013;<lpage>624</lpage>. doi: <pub-id pub-id-type="doi">10.18520/cs/v119/i4/618-624</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lester</surname> <given-names>S. N.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Toll-like receptors in antiviral innate immunity</article-title>. <source>J. Mol. Biol.</source> <volume>426</volume>, <fpage>1246</fpage>&#x2013;<lpage>1264</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jmb.2013.11.024</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Xue</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Ahmed</surname> <given-names>M. Z.</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>S. X.</given-names>
</name>
<name>
<surname>Du</surname> <given-names>Y. Z.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Host plants and natural enemies of <italic>Bemisia tabaci</italic> (Hemiptera: Aleyrodidae) in China</article-title>. <source>Insect Sci.</source> <volume>18</volume>, <fpage>101</fpage>&#x2013;<lpage>112</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1744-7917.2010.01395.x</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname> <given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2<sup>&#x2013;&#x394;&#x394;C</sup> <sub>T</sub> method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. doi: <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luan</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Ghanim</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Czosnek</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Silencing the ecdysone synthesis and signaling pathway genes disrupts nymphal development in the whitefly</article-title>. <source>Insect Biochem. Mol. Biol.</source> <volume>43</volume>, <fpage>740</fpage>&#x2013;<lpage>746</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.ibmb.2013.05.012</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Navas-Castillo</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Fiallo-Oliv&#xe9;</surname> <given-names>E.</given-names>
</name>
<name>
<surname>S&#xe1;nchez-Campos</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Emerging virus diseases transmitted by whiteflies</article-title>. <source>Annu. Rev. Phytopathol.</source> <volume>49</volume>, <fpage>219</fpage>&#x2013;<lpage>248</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev-phyto-072910-095235</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nekkanti</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chakraborty</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ghosh</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Iquebal</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Jaiswal</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Baranwal</surname> <given-names>V. K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Transcriptomic changes of <italic>Bemisia tabaci</italic> Asia II 1 induced by chilli leaf curl virus trigger infection and circulation in its vector</article-title>. <source>Front. Microbiol.</source> <volume>13</volume>, <elocation-id>423&#x2013;466</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fmicb.2022.890807</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ozato</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Tsujimura</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Tamura</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Toll-like receptor signaling and regulation of cytokine gene expression in the immune system</article-title>. <source>BioTechniques</source> <volume>Suppl. 66-8</volume>, <fpage>70, 72 passim</fpage>. doi: <pub-id pub-id-type="doi">10.2144/Oct0208</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perales-Linares</surname> <given-names>R. F.</given-names>
</name>
<name>
<surname>Navas-Mart&#xed;n</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Toll-like receptor 3 in viral pathogenesis: Friend or foe</article-title>? <source>Immunology</source> <volume>140</volume>, <fpage>153</fpage>&#x2013;<lpage>167</lpage>. doi: <pub-id pub-id-type="doi">10.1111/imm.12143</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Polston</surname> <given-names>J. E.</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>P. K.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>The emergence of whitefly-transmitted geminiviruses in tomato in the Western hemisphere</article-title>. <source>Plant Dis.</source> <volume>81</volume>, <fpage>1358</fpage>&#x2013;<lpage>1369</lpage>. doi: <pub-id pub-id-type="doi">10.1094/PDIS.1997.81.12.1358</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramkumar</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Asokan</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Prasannakumar</surname> <given-names>N. R.</given-names>
</name>
<name>
<surname>Kariyanna</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Karthi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Alwahibi</surname> <given-names>M. S.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>RNA Interference suppression of v-ATPase b and juvenile hormone binding protein genes through topically applied dsRNA on tomato leaves: Developing biopesticides to control the south American pinworm, <italic>Tuta absoluta</italic> (Lepidoptera: Gelechiidae)</article-title>. <source>Front. Physiol.</source> <volume>12</volume>, <elocation-id>742871</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fphys.2021.742871</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raza</surname> <given-names>A</given-names>
</name>
<name>
<surname>Malik</surname> <given-names>H.J.</given-names>
</name>
<name>
<surname>Shafiq</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Amin</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Scheffler</surname> <given-names>J.A.</given-names>
</name>
<name>
<surname>Scheffler</surname> <given-names>B.E.</given-names>
</name>
<name>
<surname>Mansoor</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>RNA interference based approach to down regulate osmoregulators of whitefly (<italic>Bemisia tabaci</italic>): potential technology for the control of whitefly</article-title>. <source>PLoS ONE</source> <volume>11</volume>(<issue>4</issue>), <elocation-id>e0153883</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0153883</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rosen</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Kanakala</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kliot</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Cathrin Pakkianathan</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Farich</surname> <given-names>B. A.</given-names>
</name>
<name>
<surname>Santana-Magal</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Persistent, circulative transmission of begomoviruses by whitefly vectors</article-title>. <source>Curr. Opin. Virol.</source> <volume>15</volume>, <fpage>1</fpage>&#x2013;<lpage>8</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.coviro.2015.06.008</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Chakraborty</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ghosh</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>How many begomovirus copies are acquired and inoculated by its vector, whitefly (Bemisia tabaci) during feeding</article-title>? <source>PloS One</source> <volume>16</volume>, <elocation-id>e0258933</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0258933</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Senanayake</surname> <given-names>D. M. J. B.</given-names>
</name>
<name>
<surname>Mandal</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Lodha</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Varma</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>First report of chilli leaf curl virus affecting chilli in India</article-title>. <source>Plant Pathol.</source> <volume>56</volume>, <fpage>343</fpage>&#x2013;<lpage>343</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1365-3059.2007.01513.x</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shingote</surname> <given-names>P. R.</given-names>
</name>
<name>
<surname>Wasule</surname> <given-names>D. L.</given-names>
</name>
<name>
<surname>Parma</surname> <given-names>V. S.</given-names>
</name>
<name>
<surname>Holkar</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Karkute</surname> <given-names>S. G.</given-names>
</name>
<name>
<surname>Parlawar</surname> <given-names>N. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>An overview of chili leaf curl disease: Molecular mechanisms, impact, challenges, and disease management strategies in Indian subcontinent</article-title>. <source>Front. Microbiol.</source> <volume>29</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2022.899512</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Simon</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Frati</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Beckenbach</surname> <given-names>A.T.</given-names>
</name>
<name>
<surname>Crespi</surname> <given-names>B.J.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Flook</surname> <given-names>P.K.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers</article-title>. <source>Ann. Entomol. Soc. Am</source> <volume>87</volume>, <fpage>651</fpage>&#x2013;<lpage>701</lpage>. doi: <pub-id pub-id-type="doi">10.1093/AESA/87.6.651</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thakur</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Jindal</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Dhaliwal</surname> <given-names>M. S.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Chilli leaf curl virus disease: A serious threat for chilli cultivation</article-title>. <source>J. Plant Dis. Prot.</source> <volume>125</volume>, <fpage>239</fpage>&#x2013;<lpage>249</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s41348-018-0146-8</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Upadhyay</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Chandrashekar</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Thakur</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Verma</surname> <given-names>P. C.</given-names>
</name>
<name>
<surname>Borgio</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Singh</surname> <given-names>P. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>RNA Interference for the control of whiteflies (<italic>Bemisia tabaci</italic>) by oral route</article-title>. <source>J. Biosci.</source> <volume>36</volume>, <fpage>153</fpage>&#x2013;<lpage>161</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s12038-011-9009-1</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Varma</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Malathi</surname> <given-names>V. G.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Emerging geminivirus problems: A serious threat to crop production</article-title>. <source>Ann. Appl. Biol.</source> <volume>142</volume>, <fpage>145</fpage>&#x2013;<lpage>164</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1744-7348.2003.tb00240.x</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="web">
<person-group person-group-type="author">
<name>
<surname>Verma</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Bhattacharya</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2015</year>)<article-title>Whitefly destroys 2/3rd of punjab&#x2019;s cotton crop, 15 farmers commit suicide</article-title>. In: <source>Times of India</source>. Available at: <uri xlink:href="http://timesofindia.indiatimes.com/articleshow/49265083.cms?source=contentofinterest&amp;utm_medium=text&amp;utm_campaign=cpps">http://timesofindia.indiatimes.com/articleshow/49265083.cms?source=contentofinterest&amp;utm_medium=text&amp;utm_campaign=cpps</uri> (Accessed <access-date>21-02-2023</access-date>).</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vyas</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Raza</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>M. Y.</given-names>
</name>
<name>
<surname>Ashraf</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Mansoor</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shahid</surname> <given-names>A. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Knock-down of whitefly gut gene expression and mortality by orally delivered gut gene-specific dsRNAs</article-title>. <source>PLoSOne</source> <volume>12</volume>, <elocation-id>e0168921</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0168921</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>He</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Mechanisms of plant virus transmission by the whitefly <italic>Bemisia tabaci</italic>
</article-title>. <source>Chin. Sci. Bull.</source> <volume>65</volume>, <fpage>1463</fpage>&#x2013;<lpage>1475</lpage>. doi: <pub-id pub-id-type="doi">10.1360/TB-2019-0854</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Z. Z.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>Y. C.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X. W.</given-names>
</name>
<name>
<surname>Stanley</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X. X.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>A peptidoglycan recognition protein acts in whitefly (Bemisia tabaci) immunity and involves in begomovirus acquisition</article-title>. <source>Sci. Rep.</source> <volume>6</volume>, <fpage>37806</fpage>. doi: <pub-id pub-id-type="doi">10.1038/srep37806</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>TOB1 attenuates IRF3-directed antiviral responses by recruiting HDAC8 to specifically suppress IFN-&#x3b2; expression</article-title>. <source>Commun. Biol.</source> <volume>5</volume>, <fpage>943</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s42003-022-03911-x</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>