<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1121259</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Changes and transcriptome regulation of endogenous hormones during somatic embryogenesis in <italic>Ormosia henryi</italic> Prain</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wu</surname>
<given-names>Gaoyin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2135124"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wei</surname>
<given-names>Xiaoli</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Xiao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wei</surname>
<given-names>Yi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>College of Forestry, Guizhou University</institution>, <addr-line>Guiyang, Guizhou</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>College of Life Science, Guizhou Normal University</institution>, <addr-line>Guiyang, Guizhou</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Paolo Costantino, Sapienza University of Rome, Italy</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Ying Hua Su, Shandong Agricultural University, China; Sergio J. Ochatt, INRA UMR1347 Agro&#xe9;cologie, France</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Wei Xiaoli, <email xlink:href="mailto:gdwxl-69@126.com">gdwxl-69@126.com</email>; Wu Gaoyin, <email xlink:href="mailto:wugaoyin1234@163.com">wugaoyin1234@163.com</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Plant Physiology, a section of the journal Frontiers in Plant Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>03</day>
<month>04</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1121259</elocation-id>
<history>
<date date-type="received">
<day>11</day>
<month>12</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>15</day>
<month>03</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Wu, Wei, Wang and Wei</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Wu, Wei, Wang and Wei</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>Ormosia henryi is a rare and endangered plant growing in southern China. Somatic embryo culture is an effective measure for the rapid propagation of O. henryi. It has not been reported how regulatory genes induce somatic embryogenesis by regulating endogenous hormone changes during the process of somatic embryogenesis in O. henryi.</p>
</sec>
<sec>
<title>Methods</title>
<p>In this study, we analysed the endogenous hormone levels and transcriptome data of nonembryogenic callus (NEC), embryogenic callus (EC), globular embryo (GE) and cotyledon embryo (CE) in O. henryi.</p>
</sec>
<sec>
<title>Results</title>
<p>The results showed that the indole-3-acetic acid (IAA) content was higher and the cytokinins (CKs) content was lower in EC than in NEC, and the gibberellins (GAs) and abscisic acid (ABA) contents were significantly higher in NEC than in EC. The contents of IAA, CKs, GAs and ABA increased significantly with EC development. The expression patterns of differentially expressed genes (DEGs) involved in the biosynthesis and signal transduction of auxin (AUX) (YUCCA and SAUR), CKs (B-ARR), GAs (GA3ox, GA20ox, GID1 and DELLA) and ABA (ZEP, ABA2, AAO3, CYP97A3, PYL and ABF) were consistent with the levels of endogenous hormones during somatic embryogenesis (SE). In this study, 316 different transcription factors (TFs) regulating phytohormones were detected during SE. AUX/IAA were downregulated in the process of EC formation and GE differentiation into CE, but other TFs were upregulated and downregulated. </p>
</sec>
<sec>
<title>Conclusion</title>
<p>Therefore, we believe that relatively high IAA content and low CKs, GAs and ABA contents contribute to EC formation. The differential expression of AUX, CKs, GAs and ABA biosynthesis and signal transduction genes affected the endogenous hormone levels at different stages of SE in O. henryi. The downregulated expression of AUX/IAA inhibited NEC induction, promoted EC formation and GE differentiation into CE. </p>
</sec>
</abstract>
<kwd-group>
<kwd>
<italic>Ormosia henryi</italic>
</kwd>
<kwd>somatic embryogenesis</kwd>
<kwd>differentially expressed genes</kwd>
<kwd>endogenous hormone</kwd>
<kwd>transcription factors</kwd>
</kwd-group>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<counts>
<fig-count count="8"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="32"/>
<page-count count="12"/>
<word-count count="4551"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>
<italic>Ormosia henryi</italic> Prain is an evergreen tree belonging to <italic>Ormosia</italic> and is one of the precious timber trees in China. Due to the scarcity of its wild resources, breeding and protecting them are urgent issues. Somatic embryogenesis (SE), which is the process of dedifferentiation of somatic cells into somatic embryos and further development into a large number of embryoid bodies, is an efficient method of asexual reproduction (<xref ref-type="bibr" rid="B4">Cui and Dai, 2000</xref>). SE is widely used in the propagation of rare species and the preservation of germplasm resources. The author&#x2019;s previous study established an SE regeneration system for <italic>O. henryi</italic> (<xref ref-type="bibr" rid="B27">Wu et&#xa0;al., 2020</xref>) and revealed the physiological and biochemical mechanism of EC formation, EC development and differentiation in the SE process, as well as the changes in cell tissue structure in different periods (<xref ref-type="bibr" rid="B26">Wu et&#xa0;al., 2021</xref>). However, the changes in endogenous hormones and the molecular mechanisms by which these changes are regulated during SE have not been reported.</p>    <p>Previous studies have shown that plant endogenous hormones play important roles in the development and morphogenesis of explants. Auxin and cytokinin levels affected the dedifferentiation and redifferentiation of plant cells and determined tissue regeneration and cell fate (<xref ref-type="bibr" rid="B10">Ikeuchi et&#xa0;al., 2019</xref>). Gibberellin and abscisic acid are crucial for the maturation and germination of somatic embryos (<xref ref-type="bibr" rid="B14">Khan et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B15">Li and Li, 2019</xref>). All these endogenous hormone levels are regulated and influenced by genes related to their biosynthesis and signal transduction. The <italic>YUCCA</italic> gene, as a key enzyme in auxin biosynthesis, is necessary for stem cell formation in <italic>Arabidopsis thaliana</italic> (<xref ref-type="bibr" rid="B1">Bai et&#xa0;al., 2013</xref>), EC formation in <italic>Gossypium hirsutum</italic> (<xref ref-type="bibr" rid="B31">Zheng et&#xa0;al., 2014</xref>), and somatic embryo development and maturation in <italic>Musa</italic> spp. (<xref ref-type="bibr" rid="B5">Enr&#xed;quez-Valencia et&#xa0;al., 2019</xref>). <xref ref-type="bibr" rid="B9">Hwang et&#xa0;al. (2012)</xref> reported that <italic>B-ARRs</italic>, as key components involved in Arabidopsis callus induction, played an important role in shoot apical meristem regulation. The differential expression of <italic>GA3ox</italic>, <italic>GA20ox</italic>, <italic>AAO3</italic> and <italic>PYL</italic> genes related to gibberellin and abscisic acid was of great significance in the development of somatic embryos for <italic>G. hirsutum</italic> (<xref ref-type="bibr" rid="B3">Cheng, 2016</xref>; <xref ref-type="bibr" rid="B12">Jie, 2016</xref>) and <italic>Medicago truncatula</italic> (<xref ref-type="bibr" rid="B23">Rose, 2019</xref>). In addition, <italic>AUX/IAA</italic> and <italic>ARF</italic> genes, as auxin signal transduction genes, have a high regulatory effect on SE development, but they have different expression patterns in the SE process for different plants (<xref ref-type="bibr" rid="B16">Liu et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B22">Quintana-Escobar et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B2">Chen et&#xa0;al., 2020</xref>). Therefore, it was necessary to reveal the mechanism of endogenous hormones regulating SE in <italic>O. henryi</italic> by studying the changes in endogenous hormones and analysing transcriptome data.</p>
<p>In this study, NEC, EC, GE and CE in the SE process for <italic>O. henryi</italic> were used as test materials to detect endogenous hormone levels by LC&#x2212;MS/MS and analyse RNA-Seq data. Aim at revealing the changes of endogenous hormone levels during SE in <italic>O. henryi</italic>, exploring the molecular mechanisms of the formation of NEC and EC and the differentiation of GE into CE, providing a theoretical basis for optimizing the SE system of <italic>O. henryi.</italic>
</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Plant materials</title>
<p>The mature seeds of fine single plants of <italic>O. henryi</italic> were collected in Mengguan town, Guiyang city in China (latitude: 26&#xb0;14&#x2032;23&#x201d;N, longitude: 106&#xb0;25&#x2032;12&#x2033;W) in Nov 2017. The authority responsible for the <italic>O. henryi</italic> resources is the Mengguan Forestry Station in Guizhou Province, China, who provided permission to collect the seeds of <italic>O. henryi</italic>. The formal identification of the plant material was undertaken by Prof. Mingtai An (Guizhou University). The matuer seeds were treated with concentrated H<sub>2</sub>S0<sub>4</sub> for 30&#xa0;min, washed with tap water for 30&#xa0;min, disinfected in 75% alcohol for 1&#xa0;min and then treated with 2% NaClO for 8&#xa0;min, followed by 5 rinses in sterile distilled water. They were then soaked in sterile water for 24&#xa0;h to make them swell and soften, and finally, mature embryos were obtained for somatic embryo induction. The somatic embryo induction methods referred to <xref ref-type="bibr" rid="B27">Wu et&#xa0;al., (2020)</xref>. NEC (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>), EC (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>), GE (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>) and CE (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>) were collected. The culture medium on the surface of the calluses was washed with distilled water and placed into a 5&#xa0;ml centrifuge tube, which was quickly frozen in liquid nitrogen and then transferred to a freezer at -80&#xb0;C for storage. After the samples were collected, endogenous hormone determination and transcriptome sequencing were performed.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Somatic embryogenesis in O. henryi. <bold>(A)</bold> Nonembryogenic callus (NEC), <bold>(B)</bold> Embryogenic callus (EC), <bold>(C)</bold> Globular embryo( GE), <bold>(D)</bold> Cotyledon embryo (CE), bar=0.5 cm.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g001.tif"/>
</fig>
</sec>
<sec id="s2_2">
<title>Determination of endogenous hormones</title>
<p>The test samples were sent to Metware (<ext-link ext-link-type="uri" xlink:href="http://www.metware.cn/">http://www.metware.cn/</ext-link>). The contents of endogenous hormones, including AUX (indole-3-acetic acid, IAA), CKs (N6-isopentenyladenine, IP), trans-zeatin (tZ), cis-zeatin (cZ), dihydrozeatin (DZ), GAs (gibberellin, GA1, GA3, GA4, GA7, GA9, GA15, GA19, GA20, GA24, GA53) and abscisic acid (ABA), were detected by liquid chromatography-tandem mass spectrometry (LC&#x2212;MS/MS).</p>
</sec>
<sec id="s2_3">
<title>RNA extraction, library construction, and Illumina sequencing</title>
<p>Total RNA was extracted from NEC, EC, GE and CE using TRIzol reagent (Metvivre, Wuhan, China). RNA purity was examined using a NanoPhotometer spectrophotometer (Implen, CA, USA), RNA concentration was measured with a high-accuracy Qubit<sup>&#xae;</sup> 2.0 fluorometer (Life Technologies, CA, USA), and RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA).</p>
<p>Poly A-tailed mRNA was enriched by Oligo(dT) magnetic beads, and then fragmentation buffer was added to break the RNA into short fragments. Using the short fragment RNA as a template, the first-strand cDNA was synthesized with six nucleobase random hexamers, buffer, dNTPs and DNA polymerase I to generate double-stranded cDNA, and then AMPure XP beads were used to purify the double-stranded cDNA. The purified double-stranded cDNA was then subjected to end repair, an A-tail was added, and a sequencing adapter was connected. Then, AMPure XP beads were used for fragment size selection, and finally, PCR enrichment was performed to obtain the final cDNA library.</p>
<p>After the library was constructed, Qubit 2.0 was used for preliminary quantification, and Agilent 2100 was used to detect the insert size of the library. The next experiment was performed only when the insert size met the expectation. Then, the effective concentration of the library was accurately quantified by the Q-PCR method (the effective concentration of the library was&gt;2 nM) to complete the library inspection. Finally, the cDNA libraries were sequenced using the Novaseq 6000 platform (Illumina, San Diego, CA, USA).</p>
</sec>
<sec id="s2_4">
<title>Assembly and gene function annotation</title>
<p>After obtaining sufficiently high-quality clean reads, Trinity software was used to splice clean reads to obtain unigenes for subsequent analysis. BLAST software was used to align the unigene sequences with the KEGG, NR, Swiss-Prot, GO, COG/KOG, and Trembl databases (E &#x2264; 1e-5), and HMMER software was used to compare them with the Pfam database to obtain annotation information for unigenes after predicting the amino acid sequences of unigenes.</p>
</sec>
<sec id="s2_5">
<title>Differential gene analysis</title>
<p>FPKM (Fragments Per Kilobase of transcript per Million mapped reads) was used as an indicator to measure transcript or gene expression levels, and the threshold standard of DEGs was |log2Fold Change|&#x2265;1 and FDR &lt; 0.05.</p>
</sec>
<sec id="s2_6">
<title>Quantitative real-time PCR analysis</title>
<p>Six genes related to the regulation of endogenous hormones were selected for qRT&#x2212;PCR verification, and the total RNA of the test samples was extracted by reverse transcription using a Thermo kit to obtain cDNA. A QIAGEN kit was used for qPCR detection. The specific reaction procedure was as follows: preheating at 95&#xb0;C for 2&#xa0;min, followed by 40 cycles at 95&#xb0;C for 5 s and 60&#xb0;C for 30 s. The relative expression level was calculated using the 2<sup>-&#x394;&#x394;Ct</sup> method. HLM-Actin was used as the internal reference gene, and the primers are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. The relative expression levels were determined with 3 biological replicates, and each biological replicate was determined with 3 technical replicates.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers for qRT&#x2212;PCR.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Gene ID</th>
<th valign="middle" align="center">Primer</th>
<th valign="middle" align="center">Forward/Reverse primer</th>
<th valign="middle" align="center">Amplicon length (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="2" align="center">Cluster-17474.55993</td>
<td valign="middle" align="center">F</td>
<td valign="middle" align="center">CAAGCGACATCGTTTCACCA</td>
<td valign="middle" rowspan="2" align="center">128</td>
</tr>
<tr>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CTTTCTCGGTAGTGTCATTGCTG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">Cluster-17474.166510</td>
<td valign="middle" align="center">F</td>
<td valign="middle" align="center">TGTTGGGAATGAAACTGAAGCA</td>
<td valign="middle" rowspan="2" align="center">151</td>
</tr>
<tr>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CCTCTTCCCACTCACTATCTCCA</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">Cluster-17474.116314</td>
<td valign="middle" align="center">F</td>
<td valign="middle" align="center">TGGAGTTGTTGGAGTCCGATTT</td>
<td valign="middle" rowspan="2" align="center">105</td>
</tr>
<tr>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">CAGCGAGAACCGAAAGGAGT</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">Cluster-17474.121945</td>
<td valign="middle" align="center">F</td>
<td valign="middle" align="center">CATCAGAATACAGCAATTGGTTCC</td>
<td valign="middle" rowspan="3" align="center">186</td>
</tr>
<tr>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">AGAAGCCTTCACCTGGTCAGC</td>
</tr>
<tr>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GGCTCTGGCTATTCTGCTTTG</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">Cluster-17474.122397</td>
<td valign="middle" align="center">F</td>
<td valign="middle" align="center">GATTTTCCACCTTCTGCGCTA</td>
<td valign="middle" rowspan="2" align="center">188</td>
</tr>
<tr>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">GCTTCATCATCCCGTCGTTT</td>
</tr>
<tr>
<td valign="middle" rowspan="2" align="center">Cluster-17474.27245</td>
<td valign="middle" align="center">F</td>
<td valign="middle" align="center">ATGGAGACTGTGGCGGTGAA</td>
<td valign="middle" rowspan="2" align="center">146</td>
</tr>
<tr>
<td valign="middle" align="center">R</td>
<td valign="middle" align="center">TCTGGGTTTGTTGGATAACTGC</td>
</tr>
<tr>
<td valign="middle" align="center">HLM-18S<break/>(Cluster-17474.100110)</td>
<td valign="middle" align="center">F</td>
<td valign="middle" align="center">ATGCTTTCGCAGTTGTTCGTC</td>
<td valign="middle" align="center">98</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_7">
<title>Statistical analysis</title>
<p>All data were assessed for significant differences using Tukey&#x2019;s test with SPSS 21.0 software. All data are presented as the mean &#xb1; standard deviation (SD) of three replicates. The graphs were created with Origin 9.0 and Photoshop 2019 software.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Endogenous hormone contents</title>
<p>There were significant differences in endogenous hormone contents at different SE stages of <italic>O. henryi</italic> (P&lt;0.05, <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). The content of IAA in NEC was the lowest, while the contents of CKs, GAs and ABA in EC were the lowest. The content of IAA in EC was higher than that in NEC. The contents of GAs and ABA in NEC were 5.5 and 12 times those in EC, respectively. The results showed that relatively high IAA and low CKs, GAs and ABA contents promoted EC formation. With EC development, the contents of IAA, CKs, GAs and ABA gradually increased and were the highest in CE, which were 3.7, 10.4, 10.7 and 12.7 times those in EC, respectively. These results indicated that these four endogenous hormones contents were increased with somatic embryo development in <italic>O. henryi</italic>, and each tissue stage had its specific hormone content.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Contents of phytohormones at various phases of SE in <italic>O. henryi</italic>. Auxin is IAA, cytokinin content is the sum of IP, tZ, cZ and DZ, gibberellin content is the sum of GA1, GA3, GA4, GA7, GA9, GA15, GA19, GA20, GA24 and GA53, and abscisic acid is ABA. The different lowercase letters are significantly different using the Tukey&#x2019;s test (P&lt; 0.05).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g002.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>RNA sequence analysis and quantitative real-time PCR</title>
<p>In this study, a total of 12 samples were sequenced, and 105.67 GB of clean data was obtained. The clean data, Q30, Q20, GC, clean reads and transcripts of each sample are shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. The sequence and assembly quality levels of the 12 samples were high. The overall expression trends of the qRT&#x2212;PCR and RNA-Seq expression levels of the 6 genes were consistent (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>), indicating that the transcriptome data were reliable and could be further analysed.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Transcriptome sequence analysis of 12 samples from different SE stages of <italic>O. henryi</italic>.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="bottom" align="left">Sample</th>
<th valign="bottom" align="center">Raw Reads</th>
<th valign="bottom" align="center">Clean Reads</th>
<th valign="bottom" align="center">Clean Base (G)</th>
<th valign="bottom" align="center">Q20 (%)</th>
<th valign="bottom" align="center">Q30 (%)</th>
<th valign="bottom" align="center">GC Content (%)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="bottom" align="left">NEC1</td>
<td valign="bottom" align="center">61525848</td>
<td valign="bottom" align="center">59981196</td>
<td valign="bottom" align="center">9</td>
<td valign="bottom" align="center">98.19</td>
<td valign="bottom" align="center">94.36</td>
<td valign="bottom" align="center">44.46</td>
</tr>
<tr>
<td valign="bottom" align="left">NEC2</td>
<td valign="bottom" align="center">50257358</td>
<td valign="bottom" align="center">49093036</td>
<td valign="bottom" align="center">7.36</td>
<td valign="bottom" align="center">98.19</td>
<td valign="bottom" align="center">94.37</td>
<td valign="bottom" align="center">44.91</td>
</tr>
<tr>
<td valign="bottom" align="left">NEC3</td>
<td valign="bottom" align="center">58819680</td>
<td valign="bottom" align="center">57217534</td>
<td valign="bottom" align="center">8.58</td>
<td valign="bottom" align="center">98.27</td>
<td valign="bottom" align="center">94.54</td>
<td valign="bottom" align="center">44.46</td>
</tr>
<tr>
<td valign="bottom" align="left">EC1</td>
<td valign="bottom" align="center">62388836</td>
<td valign="bottom" align="center">60599088</td>
<td valign="bottom" align="center">9.09</td>
<td valign="bottom" align="center">98.22</td>
<td valign="bottom" align="center">94.44</td>
<td valign="bottom" align="center">44.72</td>
</tr>
<tr>
<td valign="bottom" align="left">EC2</td>
<td valign="bottom" align="center">56115266</td>
<td valign="bottom" align="center">54671970</td>
<td valign="bottom" align="center">8.2</td>
<td valign="bottom" align="center">98.3</td>
<td valign="bottom" align="center">94.64</td>
<td valign="bottom" align="center">44.51</td>
</tr>
<tr>
<td valign="bottom" align="left">EC3</td>
<td valign="bottom" align="center">59556858</td>
<td valign="bottom" align="center">58190132</td>
<td valign="bottom" align="center">8.73</td>
<td valign="bottom" align="center">98.15</td>
<td valign="bottom" align="center">94.21</td>
<td valign="bottom" align="center">44.6</td>
</tr>
<tr>
<td valign="bottom" align="left">GE1</td>
<td valign="bottom" align="center">56381688</td>
<td valign="bottom" align="center">54866444</td>
<td valign="bottom" align="center">8.23</td>
<td valign="bottom" align="center">98.26</td>
<td valign="bottom" align="center">94.56</td>
<td valign="bottom" align="center">44.81</td>
</tr>
<tr>
<td valign="bottom" align="left">GE2</td>
<td valign="bottom" align="center">57158306</td>
<td valign="bottom" align="center">55918886</td>
<td valign="bottom" align="center">8.39</td>
<td valign="bottom" align="center">98.31</td>
<td valign="bottom" align="center">94.65</td>
<td valign="bottom" align="center">44.98</td>
</tr>
<tr>
<td valign="bottom" align="left">GE3</td>
<td valign="bottom" align="center">64227500</td>
<td valign="bottom" align="center">62546844</td>
<td valign="bottom" align="center">9.38</td>
<td valign="bottom" align="center">98.29</td>
<td valign="bottom" align="center">94.61</td>
<td valign="bottom" align="center">44.94</td>
</tr>
<tr>
<td valign="bottom" align="left">CE1</td>
<td valign="bottom" align="center">64559336</td>
<td valign="bottom" align="center">62809376</td>
<td valign="bottom" align="center">9.42</td>
<td valign="bottom" align="center">98.28</td>
<td valign="bottom" align="center">94.59</td>
<td valign="bottom" align="center">44.72</td>
</tr>
<tr>
<td valign="bottom" align="left">CE2</td>
<td valign="bottom" align="center">73366476</td>
<td valign="bottom" align="center">71246432</td>
<td valign="bottom" align="center">10.69</td>
<td valign="bottom" align="center">98.27</td>
<td valign="bottom" align="center">94.58</td>
<td valign="bottom" align="center">44.64</td>
</tr>
<tr>
<td valign="bottom" align="left">CE3</td>
<td valign="bottom" align="center">59086514</td>
<td valign="bottom" align="center">57301864</td>
<td valign="bottom" align="center">8.6</td>
<td valign="bottom" align="center">98.29</td>
<td valign="bottom" align="center">94.61</td>
<td valign="bottom" align="center">44.72</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Analysis of the RNA-Seq and qRT&#x2212;PCR data for the 6 genes. The different lowercase letters are significantly different using the Tukey&#x2019;s test (P&lt; 0.05).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g003.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>Annotation and functional classification of unigenes</title>
<p>The functions of unigenes were annotated by BLAST software and were predicted by comparative analysis with seven databases (KEGG, NR, Swiss-Prot, Trembl, KOG, GO and Pfam). Among the 235394 unigenes distributed to each of the databases, 47.93%, 59.47%, 39.58%, 59.05%, 35.75%, 49.27% and 40.44% of the genes were annotated (<xref ref-type="supplementary-material" rid="SM1">
<bold>Additional file 1</bold>
</xref>). The highest species match was found in <italic>Lupinus angustifolius</italic> (18.74%), followed by <italic>Cajanus cajan</italic> (17.21%) and <italic>Glycine max</italic> (4.23%) (<xref ref-type="supplementary-material" rid="SM2">
<bold>Additional file 2</bold>
</xref>).</p>
<p>A total of 115981 genes were annotated in the GO database, among which there were a large number of genes in cell (76165), cell component (76047), organelle (59197), cell membrane (36686) and organelle component (27642) for the cellular component; binding activity (72917) and catalytic activity (61800) for molecular function; and cellular process (73879) and metabolic process (64693) for biological process (<xref ref-type="supplementary-material" rid="SM3">
<bold>Additional file 3</bold>
</xref>).</p>
<p>A total of 84165 genes were annotated in the KOG database, and a total of 25 classification functions were obtained. The top three KOG functions were &#x201c;General function prediction only&#x201d; (28881), &#x201c;Posttranslational modification, protein turnover, chaperones&#x201d; (7702) and &#x201c;Signal transduction mechanisms&#x201d; (7492), and the lowest was &#x201c;Cell motility&#x201d; (37) (<xref ref-type="supplementary-material" rid="SM4">
<bold>Additional file 4</bold>
</xref>).</p>
<p>In total, 112816 unigenes were mapped into 141 KEGG database pathways. The top eleven KEGG pathways were &#x201c;Metabolic pathways&#x201d; (20565), &#x201c;Biosynthesis of secondary metabolites&#x201d; (9661), &#x201c;Carbon metabolism&#x201d; (2930), &#x201c;Protein processing in endoplasmic reticulum&#x201d; (2296), &#x201c;RNA transport&#x201d; (2283), &#x201c;Plant&#x2212;pathogen interaction&#x201d; (2232), &#x201c;Biosynthesis of amino acids&#x201d; (2207), &#x201c;Amino sugar and nucleotide sugar metabolism&#x201d; (2169), &#x201c;Endocytosis&#x201d; (2151), &#x201c;Plant hormone signal transduction&#x201d; (2018) and &#x201c;Starch and sucrose metabolism&#x201d; (1961). In summary, the annotated gene information could provide data support for exploring its biological functions and revealing the molecular mechanism involved in SE at different stages for <italic>O. henryi</italic> (<xref ref-type="supplementary-material" rid="SM5">
<bold>Additional file 5</bold>
</xref>).</p>
</sec>
<sec id="s3_4">
<title>Analysis of DEGs and KEGG metabolic pathways</title>
<p>The numbers of DEGs in NEC vs. EC, EC vs. GE, and GE vs. CE were 11589, 8999, and 27982, respectively, totalling 38100, and the number of common DEGs was 876 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). In NEC vs. EC, 7716 DEGs were downregulated and 3873 were upregulated, of which the number of upregulated DEGs was 2 times that of downregulated DEGs. In EC vs. GE, 4358 DEGs were downregulated and 4641 were upregulated. GE vs. CE had the largest number of DEGs, with 14060 upregulated and 13922 downregulated (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>DEG numbers at SE stages in O. henryi. <bold>(A)</bold> Venn diagram show the DEGs in NEC vs EC, EC vs GE, and GE vs. CE; <bold>(B)</bold> Statistic of Up/Down regulated genes in pairwise comparisons of NEC vs EC, EC vs GE, and GE vs. CE.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g004.tif"/>
</fig>
<p>The DEGs of NEC vs. EC, EC vs. GE and GE vs. CE were annotated into the KEGG database to obtain 137, 135 and 141 metabolic pathways, respectively (<xref ref-type="supplementary-material" rid="SM6">
<bold>Additional file 6</bold>
</xref>). Among them, metabolic pathways such as &#x201c;plant hormone signal transduction&#x201d;, &#x201c;metabolic pathways&#x201d;, &#x201c;biosynthesis of secondary metabolites&#x201d;, &#x201c;circadian rhythm - plant&#x201d;, &#x201c;flavonoid biosynthesis&#x201d;, &#x201c;isoflavonoid biosynthesis&#x201d;, &#x201c;isoquinoline alkaloid biosynthesis&#x201d; and &#x201c;phenylpropanoid biosynthesis&#x201d; were significantly enriched (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>KEGG enrichment analysis of the differential genes. I-III represent KEGG enrichment of differential genes at NEC vs. EC, EC vs. GE and GE vs. CE, respectively.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g005.tif"/>
</fig>
<p>The above analysis showed that there were significant differences in the contents of endogenous hormones at different SE stages. To understand how the changes in endogenous hormone contents were regulated by the gene expression of the plant hormone biosynthesis and signal transduction pathways, we focused on five metabolic pathways involved in the biosynthesis and signal transduction of auxin, cytokinin, gibberellin and abscisic acid. The results showed that (1) tryptophan metabolism (ko00380) was annotated with 42 DEGs; (2) zeatin biosynthesis (KO00908) was annotated to 27 DEGs; (3) diterpenoid biosynthesis (KO00904) was annotated to 24 DEGs; (4) carotenoid biosynthesis (KO00906) was annotated to 48 DEGs; and (5) in plant hormone signal transduction (KO04075), there were 192, 90, 97 and 69 differentially expressed signal transduction genes annotated with auxin, cytokinin, GAs and abscisic acid, respectively (<xref ref-type="supplementary-material" rid="SM7">
<bold>Additional file 7</bold>
</xref>). The results showed that the differences in endogenous hormone contents at different SE stages were regulated by related genes encoding plant hormones.</p>
<p>I-III represent KEGG enrichment of differential genes at NEC vs. EC, EC vs. GE and GE vs. CE, respectively.</p>
</sec>
<sec id="s3_5">
<title>DEGs related to phytohormones regulating SE in <italic>Ormosia henryi</italic>
</title>
<p>To further explore the related genes that affect the changes in endogenous hormones during SE for <italic>O. henryi</italic>, DEGs related to plant hormone biosynthesis and signal transduction were screened from the transcriptome data, as shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>. In tryptophan metabolism (ko00380), there was a DEG, <italic>YUCCA</italic>, that was not expressed in NEC, was expressed at low levels in EC and GE, and was expressed at high levels in CE. In diterpene biosynthesis (ko00904), one <italic>GA3ox</italic> and two <italic>GA20ox</italic> genes were highly expressed in NEC and low in EC, and these expression levels gradually increased with EC development. In carotenoid biosynthesis (ko00906), the expression patterns of <italic>CYP97A3</italic> (cytochrome P450 enzymes), <italic>ZEP</italic> (zeaxanthin epoxidase), <italic>ABA2</italic> and <italic>AAO3</italic> (Arabidopsis aldehyde oxidase 3) were the same as those of <italic>GA3ox</italic> and two <italic>GA20ox</italic> genes during SE for <italic>O. henryi</italic>. In plant hormone signal transduction (ko04075), 1 small auxin-up RNA (<italic>SAUR</italic>), 2 type-B ARA-bidopsis response regulators (<italic>B-ARR</italic>), 2 GA-insensitive dwarf 1 (<italic>GID1</italic>), 3 <italic>DELLA</italic>, 1 PYR1-like (<italic>PYL</italic>) and 1 ABRE-binding factor (<italic>ABF</italic>) were screened. Their expression patterns were consistent with the trend of endogenous hormone contents in SE at different stages for <italic>O. henryi</italic>. It was speculated that these genes were involved in the biosynthesis of corresponding endogenous hormones and affected the SE process of <italic>O. henryi</italic>.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Differentially expressed genes of endogenous hormone biosynthesis and signal transduction in <italic>O. henryi</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g006.tif"/>
</fig>
</sec>
<sec id="s3_6">
<title>TFs related to phytohormones regulating SE in <italic>Ormosia henryi</italic>
</title>
<p>A large number of differential TFs were found during SE of <italic>O. henryi</italic>, with 713 in NEC vs. EC, 750 in EC vs. GE, and 1959 in GE vs. CE (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). Among them, there were 66, 62 and 188 differential TFs involved in plant hormone regulation, respectively, 55 <italic>AUX/IAAs</italic> and 58 <italic>ARFs</italic> in auxin; 8 <italic>CER1s</italic>, 30 <italic>B-ARRs</italic> and 5 <italic>A-ARRs</italic> in cytokinin; 35 <italic>DELLAs</italic> and 32 TFs in gibberellin; and 15 ABFs in abscisic acid, for a total number of 238 differential TFs during SE for <italic>O. henryi</italic> (<xref ref-type="supplementary-material" rid="SM8">
<bold>Additional file 8</bold>
</xref>). It is worth noting that most <italic>AUX/IAA</italic> TFs were downregulated during EC formation and GE differentiation into CE and highly expressed in NEC, while other TFs were upregulated and downregulated at different SE stages. These results suggest that <italic>AUX/IAA</italic> played important roles in EC formation and CE differentiation of <italic>O. henryi</italic> (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>), and the regulation of its development by other TFs is a complex process.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Different TFs at SE stages in <italic>O. henryi</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g007.tif"/>
</fig>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>DGEs and TFs of endogenous hormone biosynthesis and signal transduction regulated SE process at different stages in <italic>O. henryi</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1121259-g008.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Plant hormones regulate various processes of plant growth, development and environmental adaptation. They both independently and cooperatively regulate plant seed germination, vegetative growth, reproductive growth, embryonic development, seed maturation and dormancy and other growth and development processes, as well as the adaptation of biotic and abiotic environmental stress during the plant growth cycle (<xref ref-type="bibr" rid="B15">Li and Li, 2019</xref>). Among them, IAA is an important hormone regulating SE development. The content of IAA in EC of <italic>O. henryi</italic> was higher than that in NEC and increased significantly as the EC developed into GE and CE, which was similar to the findings for <italic>Cyathea delgadii</italic> (<xref ref-type="bibr" rid="B8">Grzyb et&#xa0;al., 2017</xref>), <italic>Norway Spruce</italic> (<xref ref-type="bibr" rid="B25">Vondrakova et&#xa0;al., 2018</xref>), and <italic>Medicago truncatula</italic> (<xref ref-type="bibr" rid="B13">K&#x119;pczy&#x144;ska and Or&#x142;owska, 2021</xref>) larch (<xref ref-type="bibr" rid="B24">Von Aderkas et&#xa0;al., 2001</xref>), these results indicated that the increase in auxin concentration was related to the establishment of embryo polarity, the initiation of stem cells, shoot apical meristem maintenance (<xref ref-type="bibr" rid="B25">Vondrakova et&#xa0;al., 2018</xref>), and stimulated <italic>M. truncatula MtSERK1</italic> gene expression (<xref ref-type="bibr" rid="B18">Nolan et&#xa0;al., 2003</xref>), which has been associated with SE and <italic>in vitro</italic> root formation in several plant species (<xref ref-type="bibr" rid="B19">Nolan et&#xa0;al., 2009</xref>). <xref ref-type="bibr" rid="B2">Chen et&#xa0;al. (2020)</xref> reported that <italic>YUCCA</italic>, <italic>NIT</italic>, and <italic>CYP71A13</italic> genes involved in auxin synthesis were upregulated from NEC to EC in longan, and <italic>YUCCA</italic> was upregulated in the early somatic embryo. In this study, <italic>YUCCA</italic> and <italic>SAUR</italic> genes involved in auxin biosynthesis and signal transduction were downregulated in NEC and were gradually upregulated with EC development. It was speculated that the differential expression of <italic>YUCCA</italic> and <italic>SAUR</italic> affected the <italic>IAA</italic> level, thereby playing a key role in regulating the SE process in <italic>O. henryi</italic>.</p>
<p>The CKs content of EC was lower than that of NEC in <italic>O. henryi</italic>, which was consistent with the findings of <xref ref-type="bibr" rid="B21">P&#xe9;rez-Jim&#xe9;nez et&#xa0;al. (2013)</xref>. The study of <xref ref-type="bibr" rid="B7">Fraga et&#xa0;al. (2016)</xref> similarly supported this view and reported that the decrease in CKs levels was associated with embryogenic potential. <italic>B-ARRs</italic>, as positive factors and key genes of cytokinin transduction, mediate cytokinin signal activation, upregulate the expression of the downstream gene <italic>CYCLIND3</italic>, and promote cells to re-enter the cell cycle (<xref ref-type="bibr" rid="B10">Ikeuchi et&#xa0;al., 2019</xref>), playing important roles in callus induction and stem cell regulation (<xref ref-type="bibr" rid="B11">Ikeuchi et&#xa0;al., 2013</xref>). <italic>B-ARR</italic> was upregulated with EC development, and the expression trend was consistent with CKs levels, indicating that the differential expression of <italic>B-ARR</italic> affected CKs levels in the SE process for <italic>O. henryi</italic>, thus regulating EC induction and differentiation and cotyledon embryo germination. Similar results have been reported in SE for <italic>G. hirsutum</italic> (<xref ref-type="bibr" rid="B3">Cheng, 2016</xref>).</p>
<p>GAs and ABA play important roles in regulating plant development, adapting to stress responses and improving crop yield (<xref ref-type="bibr" rid="B14">Khan et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B15">Li and Li, 2019</xref>). It was surprising to find that low ABA : GAs ratios in <italic>M. truncatula</italic> acted synergistically to stimulate SE, however, it is a high ABA : GAs ratio in Arabidopsis (<xref ref-type="bibr" rid="B20">Nolan et&#xa0;al., 2014</xref>), these have utility in inducing and improving SE for regeneration in different plant. However, the contents of GAs and ABA in EC were significantly lower than those in NEC of <italic>O. henryi</italic> and increased gradually with EC development. Similar results were reported in <italic>Hevea brasiliensis</italic> (<xref ref-type="bibr" rid="B6">Etienne et&#xa0;al., 1993</xref>), <italic>Norway Spruce</italic> (<xref ref-type="bibr" rid="B25">Vondrakova et&#xa0;al., 2018</xref>) and tree fern (<xref ref-type="bibr" rid="B8">Grzyb et&#xa0;al., 2017</xref>). <italic>GA3ox</italic> and <italic>GA20ox</italic> are the rate-limiting enzymes in the biosynthesis of GAs, and <italic>GA20ox</italic> can oxidize inactive GA53 and GA12 into GA9 and GA20 with biological activity. <italic>GA3ox</italic> catalyses the synthesis of GA1, GA1, GA3 and GA4 with GA9 and GA20 as substrates (<xref ref-type="bibr" rid="B29">Yamaguchi, 2008</xref>). <xref ref-type="bibr" rid="B32">Zheng et&#xa0;al. (2016)</xref> demonstrated interaction between AUX and GAs in the promotion of SE and document an inverse correlation between bioactive GAs and SE in soybean, the increase of GA2ox expression regulated negatively SE in Arabidopsis (<xref ref-type="bibr" rid="B20">Nolan et&#xa0;al., 2014</xref>). <xref ref-type="bibr" rid="B17">Mitsuhashi et&#xa0;al. (2003)</xref> reported that <italic>GA20ox</italic> was continuously expressed during embryo development in carrots, and <italic>GA3ox</italic> was continuously upregulated after embryonic developmental induction. The gibberellin receptor GID1 and the signal transduction gene <italic>DELLA</italic> also showed the same expression trends, and their expression patterns were consistent with GAs levels, indicating that their differential expression affected GAs biosynthesis in the SE process for <italic>O. henryi</italic>.</p>
<p>ABA content was more higher in NEC and CE, indicating that ABA could inhibite EC induction and promote CE maturation and differentiation. Similar results were shown in <italic>M. truncatula</italic> (<xref ref-type="bibr" rid="B13">K&#x119;pczy&#x144;ska and Or&#x142;owska, 2021</xref>), while <xref ref-type="bibr" rid="B21">P&#xe9;rez-Jim&#xe9;nez et&#xa0;al. (2013)</xref> found no significant difference in ABA content between NEC and EC <italic>Prunus persica.</italic> Perhaps these differences between NEC and EC are due to the different content of ABA catabolites and conjugates. The ABA biosynthesis genes <italic>CYP97A3</italic>, <italic>ZEP</italic>, <italic>ABA2</italic> and <italic>AAO3</italic> were expressed at low levels in EC for <italic>O. henryi</italic> and at high levels in GE differentiating into CE. Similar results were also found in SE development for <italic>G. hirsutum</italic> (<xref ref-type="bibr" rid="B3">Cheng, 2016</xref>). As an ABA receptor protein, <italic>PYL</italic> was downregulated in dedifferentiated tissues of eucalyptus (<xref ref-type="bibr" rid="B28">Xiao et&#xa0;al., 2020</xref>). <xref ref-type="bibr" rid="B12">Jie (2016)</xref> reported that <italic>PYL</italic> was significantly upregulated during SE for <italic>G. hirsutum</italic>, which was consistent with the results of this study. These results provide a reliable molecular basis for explaining why high contents of GAs and ABA can inhibit SE induction but promote SE maturation and differentiation in <italic>O. henryi</italic>.</p>
<p>TFs play a key role in plant growth and development. They are widely involved in not only plant growth and development but also stress response and hormone regulation. It was found that <italic>AUX/IAA</italic> TFs involved in the SE process of <italic>O. henryi</italic> were highly expressed in NEC and were downregulated in EC formation and GE differentiation into CE. Similar results were reported in the SE process for <italic>G. hirsutum</italic> (<xref ref-type="bibr" rid="B30">Yang et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B3">Cheng, 2016</xref>). <xref ref-type="bibr" rid="B22">Quintana-Escobar et&#xa0;al. (2019)</xref> found that the expression of <italic>AUX/IAA</italic> decreased gradually with the SE process in coffee. It was speculated that the high expression of <italic>AUX/IAA</italic> promoted NEC formation and inhibited EC formation and CE differentiation in <italic>O. henryi</italic>. To explain the important role of <italic>AUX/IAA</italic> in SE development, previous studies have shown that <italic>AUX/IAA</italic> proteins form a dimer with ARF at low auxin levels and inhibit ARF activity by binding to TPL coinhibitory factor (TOPLESS), thereby inhibiting the response of auxin signal transduction genes. In contrast, <italic>AUX/IAA-ARF</italic> was degraded by <italic>SCFTIR1/AFB</italic> at high auxin levels and activated <italic>ARF</italic>, thereby positively or negatively regulating the response of downstream auxin signals (<xref ref-type="bibr" rid="B31">Zheng et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B22">Quintana-Escobar et&#xa0;al., 2019</xref>). In general, exogenous auxin was the key hormone for EC induction. The high auxin content could stimulate the expression of the <italic>AUX/IAA</italic> gene in EC induction medium and promote NEC formation in <italic>O. henryi</italic>, resulting in a low EC induction rate, explaining why the NEC induction rate was high and the EC induction rate was low in the process of SE induction for <italic>O. henryi</italic>. The authors considered that the EC induction rate could be increased by using other hormones instead of high auxin concentrations or adjusting medium components. In the differentiation stage of somatic embryos, the auxin content was low in the medium, the <italic>AUX/IAA-ARF</italic> dimer was formed and <italic>AUX/IAA</italic> expression was inhibited, providing a reliable theoretical basis for the downregulation of the <italic>AUX/IAA</italic> gene in CE differentiation for <italic>O. henryi</italic>. Other TFs involved in the regulation of plant hormones during SE were upregulated and downregulated, indicating that these TFs regulated SE in <italic>O. henryi</italic> as part of a complex process.</p>
</sec>
<sec id="s5" sec-type="conclusion">
<title>Conclusion</title>
<p>The changes in endogenous hormone levels were the material basis for the growth and morphogenesis of SE in <italic>O. henryi</italic>, and the related expression profiles of genes involved in plant hormone biosynthesis and signal transduction affected the endogenous hormone levels, thus regulating the SE process. Relatively high IAA and low CKs, GAs and ABA contents promoted EC formation. The differential expression of auxin biosynthesis and signal transduction genes (<italic>YUCCA, SAUR</italic>), cytokinin (<italic>B-ARR</italic>), gibberellin (<italic>GA3ox</italic>, <italic>GA20ox</italic>, <italic>GID1</italic> and <italic>DELLA</italic>) and abscisic acid (<italic>ZEP</italic>, <italic>ABA2</italic>, <italic>AAO3</italic>, <italic>CYP97A3</italic>, <italic>PYL</italic> and <italic>ABF</italic>) affected the endogenous hormone levels at different SE stages. The downregulated expression of <italic>AUX/IAA</italic> and differential TFs inhibited NEC induction and promoted EC formation and GE differentiation into CE. Other TFs involved in the regulation of plant hormones during SE were upregulated and downregulated, providing a technical and theoretical basis for further mining its mechanism.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>The project was conceived by GYW and XLW. The experiment was executed by GYW, XW and YW. All coauthors drafted, reviewed, and edited the manuscript. All authors read and approved the final version of this manuscript.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This study was funded by the National Natural Science Foundation of China (31460193) and the High-Level Innovative Talents Training Programme of Guizhou Province ([2016]5661).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We are very grateful to the members of the research group for their help and interesting scientific discussions. This work has benefited from the facilities and expertise of Metware (<ext-link ext-link-type="uri" xlink:href="http://www.metware.cn/">http://www.metware.cn/</ext-link>) and the experimental conditions of the Institute for Forest Resources &amp; Environment of Guizhou. We thank the first-class disciplines of forestry and ecology for offering good experimental conditions for this work.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2023.1121259/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2023.1121259/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table_1.xlsx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Additional file 1</label>
<caption>
<p>Gene annotation information.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table_2.xlsx" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Additional file 2</label>
<caption>
<p>Species match.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table_3.xlsx" id="SM3" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Additional file 3</label>
<caption>
<p>GO database.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table_4.xlsx" id="SM4" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Additional file 4</label>
<caption>
<p>KOG database.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table_5.xlsx" id="SM5" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet">
<label>Additional file 5</label>
<caption>
<p>KEGG database pathways.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table_6.xls" id="SM6" mimetype="application/vnd.ms-excel">
<label>Additional file 6</label>
<caption>
<p>KEGG enrichment analysis of the differential genes.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SM7" mimetype="application/pdf">
<label>Additional file 7</label>
<caption>
<p>The DEGs analysis of plant hormone biosynthesis pathway and signal transduction pathway.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SM8" mimetype="application/pdf">
<label>Additional file 8</label>
<caption>
<p>The number of differential TFs for phytohormones.</p>
</caption>
</supplementary-material>
</sec>
<fn-group>
<title>Abbreviations</title>
<fn fn-type="abbr">
<p>NEC, nonembryogenic callus; EC, embryogenic callus; GE, globular embryo; CE, cotyledon embryo; SE, somatic embryogenesis; IAA, indole-3-acetic acid; AUX, auxin; CKs, cytokinins; GA, gibberellins; ABA, abscisic acid; TF, transcription factors; DEGs, differentially expressed genes; GID1:GA-insensitive dwarf 1; B-ARR, type-B ARA-bidopsis response regulators; SAUR, small auxin-up RNA; ZEP, zeaxanthin epoxidase; AAO3, Arabidopsis aldehyde oxidase 3; PYL, PYR1-like; ABF , ABRE-binding factor; CYP97A3, cytochrome P450 enzymes; RNA-seq, RNA sequencing; qRT-PCR, quantitative real-time PCR; GO, gene ontology; KEGG, kyoto encyclopedia of genes and genomes; COG, clusters of orthologous groups.</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bai</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>Y. H.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X. S.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Induction of somatic embryos in arabidopsis requires local YUCCA expression mediated by the down-regulation of ethylene biosynthesis</article-title>. <source>Mol. Plant</source> <volume>6</volume>, <fpage>1247</fpage>&#x2013;<lpage>1260</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/mp/sss154</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Xuhan</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Global scale transcriptome analysis reveals differentially expressed genes involve in early somatic embryogenesis in <italic>Dimocarpus longan</italic> lour</article-title>. <source>BMC Genomics</source> <volume>21</volume>, <elocation-id>4</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12864-019-6393-7</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname> <given-names>W. H.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Research on physiological and molecular mechanisms of somatic embryogenensis in cotton <italic>(Gossypium hirsutum</italic> l.<italic>)</italic>
</article-title>. <publisher-loc>Shihezi</publisher-loc>, <publisher-name>Shihezi University</publisher-name> pp <fpage>22</fpage>&#x2013;<lpage>42</lpage>.</citation>
</ref>
<ref id="B4">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Cui</surname> <given-names>K. R.</given-names>
</name>
<name>
<surname>Dai</surname> <given-names>R. L.</given-names>
</name>
</person-group> (<year>2000</year>). <source>Molecular biology of somatic embryogenesis in plants</source> (<publisher-loc>Beijing</publisher-loc>: <publisher-name>Science press</publisher-name>).</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Enr&#xed;quez-Valencia</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>V&#xe1;zquez-Flota</surname> <given-names>F. A.</given-names>
</name>
<name>
<surname>Ku-Cauich</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Escobedo-GraciaMedrano</surname> <given-names>R. M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Differentially expressed genes during the transition from early to late development phases in somatic embryo of banana (Musa spp. AAB group, silk subgroup) cv. manzano</article-title>. <source>Plant Cell Tiss Org Cult.</source> <volume>136</volume>, <fpage>289</fpage>&#x2013;<lpage>302</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-018-1514-6</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Etienne</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Sotta</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Montoro</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Miginiac</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Carron</surname> <given-names>M. P.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>Relations between exogenous growth regulators and endogenous indole-3-acetic acid and abscisic acid in the expression of somatic embryogenesis in <italic>Hevea brasiliensis</italic> (M&#xfc;ll. arg.)</article-title>. <source>Plant Sci.</source> <volume>88</volume>, <fpage>91</fpage>&#x2013;<lpage>96</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0168-9452(93)90113-E</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fraga</surname> <given-names>H. P.</given-names>
</name>
<name>
<surname>Vieira</surname> <given-names>L. D.</given-names>
</name>
<name>
<surname>Puttkammer</surname> <given-names>C. C.</given-names>
</name>
<name>
<surname>Dos Santos</surname> <given-names>H. P.</given-names>
</name>
<name>
<surname>Garighan</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Guerra</surname> <given-names>M. P</given-names>
</name>
</person-group>. (<year>2016</year>). <article-title>Glutathione and abscisic acid supplementation influences somatic embryo maturation and hormone endogenous levels during somatic embryogenesis in <italic>Podocarpus lambertii</italic> klotzsch ex endl</article-title>. <source>Plant Sci.</source> <volume>253</volume>, <fpage>98</fpage>&#x2013;<lpage>106</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.plantsci.2016.09.012</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grzyb</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Kalandyk</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Walig&#xf3;rski</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Miku</surname> <given-names>A. ,. A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>The content of endogenous hormones and sugars in the process of early somatic embryogenesis in the tree fern cyathea delgadii sternb</article-title>. <source>Plant Cell Tiss Org Cult.</source> <volume>129</volume>, <fpage>387</fpage>&#x2013;<lpage>397</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-017-1185-8</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hwang</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Sheen</surname> <given-names>J.</given-names>
</name>
<name>
<surname>M&#xfc;ller</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Cytokinin signaling networks</article-title>. <source>Annu. Rev. Plant Biol.</source> <volume>63</volume>, <fpage>353</fpage>&#x2013;<lpage>380</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-arplant-042811-105503</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ikeuchi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Favero</surname> <given-names>D. S.</given-names>
</name>
<name>
<surname>Sakamoto</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Iwase</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Coleman</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Rymen</surname> <given-names>B</given-names>
</name>
</person-group>. (<year>2019</year>). <article-title>Molecular mechanisms of plant regeneration</article-title>. <source>Annu. Rev. Plant Biol.</source> <volume>70</volume>, <fpage>377</fpage>&#x2013;<lpage>406</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-arplant-050718-100434</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ikeuchi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sugimoto</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Iwase</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Plant callus: Mechanisms of induction and repression</article-title>. <source>Plant Cell.</source> <volume>25</volume>, <fpage>3159</fpage>&#x2013;<lpage>3173</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1105/TPC.113.116053</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Jie</surname> <given-names>X. Y.</given-names>
</name>
</person-group> (<year>2016</year>). <source>Proteome and transcriptome analysis of cotton somatic embryo and study of JA and ABA mediated cotton somatic embryogenesis</source> (<publisher-loc>Beijing</publisher-loc>: <publisher-name>China Agricultural University</publisher-name>).</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>K&#x119;pczy&#x144;ska</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Or&#x142;owska</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Profiles of endogenous ABA, bioactive GAs, IAA and their metabolites in medicago truncatula gaertn. non-embryogenic and embryogenic tissues during induction phase in relation to somatic embryo formation</article-title>. <source>Planta</source> <volume>253</volume>, <fpage>67</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00425-021-03582-8</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Nazar</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Iqbal</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2012</year>). <source>). phytohormones and abiotic stress tolerance in plants</source> (<publisher-loc>Berlin</publisher-loc>: <publisher-name>Springer</publisher-name>).</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C. Y.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Seventy-year major research progress in plant hormones by Chinese scholars</article-title>. <source>Sci. Sin. Vitae</source> <volume>49</volume>, <fpage>1227</fpage>&#x2013;<lpage>1281</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1360/SSV-2019-0197</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>He</surname> <given-names>Z.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Comparative transcriptome analysis highlights the hormone effects on somatic embryogenesis in <italic>Catalpa bungei</italic>
</article-title>. <source>Plant Reproduction</source> <volume>32</volume>, <fpage>141</fpage>&#x2013;<lpage>151</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00497-018-0349-y</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mitsuhashi</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Toyomasu</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Masui</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Katho</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Nakaminami</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Kashiwagi</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Gibberellin is essentially required for carrot (Daucus carota l.) somatic embryogenesis: Dynamic regulation of gibberellin 3-oxidase gene expressions</article-title>. <source>Biosci. Biotechnol. Biochem.</source> <volume>67</volume>, <fpage>2438</fpage>&#x2013;<lpage>2447</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1271/bbb.67.2438</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nolan</surname> <given-names>K. E.</given-names>
</name>
<name>
<surname>Irwanto</surname> <given-names>R. R.</given-names>
</name>
<name>
<surname>Rose</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Auxin up-regulates <italic>MtSERK1</italic> expression in both <italic>Medicago truncatula</italic> root-forming and embryogenic cultures</article-title>. <source>Plant Physiol.</source> <volume>133</volume>, <fpage>218</fpage>&#x2013;<lpage>230</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.103.020917</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nolan</surname> <given-names>K. E.</given-names>
</name>
<name>
<surname>Kurdyukov</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rose</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Expression of the SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE1 (SERK1) gene is associated with developmental change in the life cycle of the model legume <italic>Medicago truncatula</italic>
</article-title>. <source>J. Exp. Bot.</source> <volume>60</volume>, <fpage>1759</fpage>&#x2013;<lpage>1771</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jxb/erp046</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nolan</surname> <given-names>K. E.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Saeed</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Rose</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>An unusual abscisic acid and gibberellic acid synergism increases somatic embryogenesis, facilitates its genetic analysis and improves transformation in <italic>Medicago truncatula</italic>
</article-title>. <source>PloS One</source> <volume>9</volume>, <elocation-id>e99908</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0099908</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>P&#xe9;rez-Jim&#xe9;nez</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Elena</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Jos&#xe9;</surname> <given-names>C. T.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Relationships between endogenous hormonal content and direct somatic embryogenesis in <italic>Prunus persica</italic> l. batsch cotyledons</article-title>. <source>Plant Growth Regulation</source> <volume>71</volume>, <fpage>219</fpage>&#x2013;<lpage>224</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10725-013-9822-7</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quintana-Escobar</surname> <given-names>A. O.</given-names>
</name>
<name>
<surname>Nic-Can</surname> <given-names>G. I.</given-names>
</name>
<name>
<surname>Galaz-Avalos</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Loyola-Vargas</surname> <given-names>V. M.</given-names>
</name>
<name>
<surname>Gongora-Castillo</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Transcriptome analysis of the induction of somatic embryogenesis in <italic>Coffea canephora</italic> and the participation of ARF and Aux/IAA genes</article-title>. <source>PeerJ</source> <volume>7</volume>, <elocation-id>e7752</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.7717/peerj.7752</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rose</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Somatic embryogenesis in the medicago truncatula model: Cellular and molecular mechanisms</article-title>. <source>Frontin Plant Sci.</source> <volume>10</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2019.00267</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Von Aderkas</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Lelu</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Label</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Plant growth regulator levels during maturation of larch somatic embryos</article-title>. <source>Plant Physiol. &amp; Biochem.</source> <volume>39</volume>, <fpage>495</fpage>&#x2013;<lpage>502</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0981-9428(01)01271-2</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vondrakova</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Dobrev</surname> <given-names>P. I.</given-names>
</name>
<name>
<surname>Pesek</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Fischerova</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Motyka</surname> <given-names>V.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Profiles of endogenous phytohormones over the course of <italic>Norway spruce</italic> somatic embryogenesis</article-title>. <source>Front. Plant Sci.</source> <volume>9</volume>, <elocation-id>1283</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fpls.2018.01283</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>G. Y.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>X. L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Changes in biochemistry and histochemical characteristics during somatic embryogenesis in <italic>Ormosia henryi</italic> prain</article-title>. <source>Plant Cell Tiss Org Cult.</source> <volume>144</volume>, <fpage>505</fpage>&#x2013;<lpage>517</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-020-01973-5</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>G. Y.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>X. L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Induction of somatic embryogenesis in different explants from <italic>Ormosia henryi</italic> prain</article-title>. <source>Plant Cell Tiss Org Cult</source> <volume>142</volume>, <fpage>229</fpage>&#x2013;<lpage>240</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11240-020-01822-5</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Transcriptome analysis identifies genes involved in the somatic embryogenesis of eucalyptus</article-title>. <source>BMC Genomics</source> <volume>21</volume>, <fpage>803</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21203/rs.3.rs-47390/v1</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamaguchi</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Gibberellin metabolism and its regulation</article-title>. <source>Annu. Rev. Plant Biol.</source> <volume>59</volume>, <fpage>225</fpage>&#x2013;<lpage>251</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.arplant.59.032607.092804</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Transcript profiling reveals complex auxin signalling pathway and transcription regulation involved in dedifferentiation and redifferentiation during somatic embryogenesis in cotton</article-title>. <source>BMC Plant Biol.</source> <volume>12</volume>, <elocation-id>110</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2229-12-110</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Duan</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>AtWuschel promotes formation of the embryogenic callus in <italic>Gossypium hirsutum</italic>
</article-title>. <source>PloS One</source> <volume>9</volume>, <elocation-id>e87502</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0087502</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Burnie</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Perry</surname> <given-names>S. E.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Gene regulation by the AGL15 transcription factor reveals hormone interactions in somatic embryogenesis</article-title>. <source>Plant Physiol.</source> <volume>172</volume>, <fpage>2374</fpage>&#x2013;<lpage>2387</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1104/pp.16.00564</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>