<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1114215</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Cassava pullulanase and its synergistic debranching action with isoamylase 3 in starch catabolism</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wangpaiboon</surname>
<given-names>Karan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1357735"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Charoenwongpaiboon</surname>
<given-names>Thanapon</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Klaewkla</surname>
<given-names>Methus</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Field</surname>
<given-names>Robert A.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Panpetch</surname>
<given-names>Pawinee</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2123826"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Center of Excellence in Structural and Computational Biology, Department of Biochemistry, Faculty of Science, Chulalongkorn University</institution>, <addr-line>Bangkok</addr-line>, <country>Thailand</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Chemistry, Faculty of Science, Silpakorn University</institution>, <addr-line>Nakhon Pathom</addr-line>, <country>Thailand</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Chemistry and Manchester Institute of Biotechnology, The University of Manchester</institution>, <addr-line>Manchester</addr-line>, <country>United Kingdom</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Center of Excellence in Molecular Crop, Department of Biochemistry, Faculty of Science, Chulalongkorn University</institution>, <addr-line>Bangkok</addr-line>, <country>Thailand</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Mariam Gaid, Independent researcher, Braunschweig, Germany</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Stefan Janecek, Slovak Academy of Sciences (SAS), Slovakia; Haruhide Mori, Hokkaido University, Japan</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Pawinee Panpetch, <email xlink:href="mailto:Pawinee.p@chula.ac.th">Pawinee.p@chula.ac.th</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Plant Metabolism and Chemodiversity, a section of the journal Frontiers in Plant Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>27</day>
<month>01</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1114215</elocation-id>
<history>
<date date-type="received">
<day>02</day>
<month>12</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>11</day>
<month>01</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Wangpaiboon, Charoenwongpaiboon, Klaewkla, Field and Panpetch</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Wangpaiboon, Charoenwongpaiboon, Klaewkla, Field and Panpetch</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Pullulanase (EC 3.2.1.41, PUL), a debranching enzyme belonging to glycoside hydrolase family 13 subfamily 13, catalyses the cleavage of &#x3b1;-1,6 linkages of pullulan and &#x3b2;-limit dextrin. The present work studied PUL from cassava <italic>Manihot esculenta</italic> Crantz (<italic>Me</italic>PUL) tubers, an important economic crop. The <italic>Mepul</italic> gene was successfully cloned and expressed in <italic>E. coli</italic> and r<italic>Me</italic>PUL was biochemically characterised. <italic>Me</italic>PUL was present as monomer and homodimer, as judged by apparent mass of ~ 84 - 197 kDa by gel permeation chromatography analysis. Optimal pH and temperature were at pH 6.0 and 50 &#xb0;C, and enzyme activity was enhanced by the addition of Ca<sup>2+</sup> ions. Pullulan is the most favourable substrate for r<italic>Me</italic>PUL, followed by &#x3b2;-limit dextrin. Additionally, maltooligosaccharides were potential allosteric modulators of r<italic>Me</italic>PUL. Interestingly, short-chain maltooligosaccharides (DP 2 - 4) were significantly revealed at a higher level when r<italic>Me</italic>PUL was mixed with cassava isoamylase 3 (r<italic>Me</italic>ISA3), compared to that of each single enzyme reaction. This suggests that <italic>Me</italic>PUL and <italic>Me</italic>ISA3 debranch &#x3b2;-limit dextrin in a synergistic manner, which represents a major starch catabolising process in dicots. Additionally, subcellular localisation suggested the involvement of <italic>Me</italic>PUL in starch catabolism, which normally takes place in plastids.</p>
</abstract>
<kwd-group>
<kwd>cassava (<italic>Manihot esculenta</italic> Crantz)</kwd>
<kwd>debranching enzyme</kwd>
<kwd>pullulan</kwd>
<kwd>pullulanase</kwd>
<kwd>starch</kwd>
<kwd>starch degradation</kwd>
<kwd>synergistic debranching</kwd>
</kwd-group>
<counts>
<fig-count count="8"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="52"/>
<page-count count="13"/>
<word-count count="6986"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Starch is a vital carbohydrate reserve in plants and serves as a key component of the food chain for animals. It is synthesised in plastids, including chloroplasts in leaves and amyloplasts in tubers and grain. Starch consists of two &#x3b1;-glucans: amylose and amylopectin. The amylose mainly presents as a linear glucan structure comprised of &#x3b1;-1,4 glycosidic bond with a limited &#x3b1;-1,6-linked branching (less than 1%). This glucan is synthesised by the concerted action of ADP-glucose pyrophosphorylase (AGPase) and granule-bound starch synthase I (GBSSI). In contrast, amylopectin is much more complex since it harbours highly branched structures generated by the action of AGPase, soluble starch synthases (SSs), starch branching enzymes (SBEs), and starch debranching enzymes (DBEs) (<xref ref-type="bibr" rid="B4">Ball and Morell, 2003</xref>; <xref ref-type="bibr" rid="B43">Tappiban et&#xa0;al., 2019</xref>). In addition, the starch degrading process in chloroplasts also relies on several enzymes, including &#x3b2;-amylases (BAMs), disproportionation enzyme 1 (D-enzyme1 or DPE1) and debranching enzymes (DBEs), which generate residual sugars, glucose and maltose, which are exported to the cytosol to be further metabolised (<xref ref-type="bibr" rid="B52">Zeeman et&#xa0;al., 2010</xref>).</p>
<p>Debranching enzymes (DBEs), members of glycoside hydrolase family 13 (GH13), are found in plants and microorganisms. They could be categorised into two major types: isoamylase (EC 3.2.1.68, ISA) and pullulanase (PUL, limit dextrinase, R-enzyme, EC 3.2.1.41) according to their peptide sequences and substrate specificities. Although they both can act on &#x3b1;-1,6 glucosidic linkages (<xref ref-type="bibr" rid="B35">Panpetch et&#xa0;al., 2018b</xref>), only PUL shows high specific activity against pullulan, &#x3b1;-1,6-linked maltotriose units, and liberates maltotriose final product. DBEs are required for both starch synthesis and degradation in plants. Generally, plants contain 3 isoforms of ISA (ISA1, ISA2, and ISA3) but only 1 pullulanase (<xref ref-type="bibr" rid="B52">Zeeman et&#xa0;al., 2010</xref>). The ISA isoforms 1 and 2 (ISA1 and ISA2) exist as either heterooligo- or homooligo-meric structures, depending on the plant species (<xref ref-type="bibr" rid="B16">Hussain et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B35">Panpetch et&#xa0;al., 2018b</xref>). They have been proposed to play important roles mainly in starch synthesis by the removal of redundant branches of immature amylopectin. This produces an appropriate structure that is competent to form highly structured granular starch, based on &#x201c;the glucan trimming model&#x201d; (<xref ref-type="bibr" rid="B30">Myers et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B32">Nakamura, 2002</xref>). Loss of DBEs in starch biosynthesis results in the accumulation of phytoglycogen (<xref ref-type="bibr" rid="B8">Delatte et&#xa0;al., 2005</xref>), while in starch degradation, a starch-excess or <italic>sex</italic> phenotype arises (<xref ref-type="bibr" rid="B6">Caspar et&#xa0;al., 1991</xref>). Further, PUL together with ISA3 participates in the debranching of so-called &#x3b2;-limit dextrin, starch residues arising from the action of BAM (<xref ref-type="bibr" rid="B52">Zeeman et&#xa0;al., 2010</xref>). Deficiency of these debranching enzymes promotes the accumulation of branch-maltooliogosaccharides and sex phenotypes, resulting in a slow growth rate (<xref ref-type="bibr" rid="B9">Delatte et&#xa0;al., 2006</xref>). To date, plant starch metabolism has been mainly evaluated in model plants such as <italic>Arabidopsis thaliana</italic>; additional information on starch metabolism in other plants, however, is also required.</p>
<p>Currently, only plant PUL from barley (<italic>Hordeum vulgare</italic>) (<italic>Hv</italic>LD), a monocotyledon, has been biochemically and structurally characterised (<xref ref-type="bibr" rid="B24">M&#xf8;ller et&#xa0;al., 2015</xref>). The <italic>Hv</italic>LD was classified into GH13 subfamily 13. In addition to the 3 major domains, including N-, C-, and catalytic domains, <italic>Hv</italic>LD structure also haboured an additional carbohydrate-binding module 48 (CBM48) located between N-terminal domain and catalytic domain (<xref ref-type="bibr" rid="B41">Stam et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B25">Machovi&#x10d; and Jane&#x10d;ek, 2008</xref>; <xref ref-type="bibr" rid="B45">Vester-Christensen et&#xa0;al., 2010b</xref>; <xref ref-type="bibr" rid="B12">Drula et&#xa0;al., 2022</xref>). Here is less data for PUL, especially from dicotyledonous plants. Only partially purified PUL from potato (<italic>Solarium tuberosum</italic> L.) (<italic>St</italic>PUL) (<xref ref-type="bibr" rid="B17">Ishizaki et&#xa0;al., 1983</xref>) and purified PUL from spinach (<italic>Spinacia oleracea L.</italic>) (<italic>So</italic>PUL) (<xref ref-type="bibr" rid="B39">Renz et&#xa0;al., 1998</xref>) were biochemically characterised to date. Moreover, the PUL from cassava, a tropical dicotyledonous plant, has not been studied before (<xref ref-type="bibr" rid="B43">Tappiban et&#xa0;al., 2019</xref>).</p>
<p>Cassava (<italic>Manihot esculenta</italic> Crantz), one of the most important economic crops in Asia, Africa and South America, in particular, possesses a very high starch content in its tubers (<xref ref-type="bibr" rid="B43">Tappiban et&#xa0;al., 2019</xref>). Although cassava starch has been widely used for many years, its starch-modifying enzymes have been little studied. Some of these enzymes have been cloned, expressed, and characterised (<xref ref-type="bibr" rid="B43">Tappiban et&#xa0;al., 2019</xref>), such as DPE1 (<xref ref-type="bibr" rid="B42">Tantanarat et&#xa0;al., 2014</xref>), ISA1/ISA2 (<xref ref-type="bibr" rid="B35">Panpetch et&#xa0;al., 2018b</xref>), and ISA3 (<xref ref-type="bibr" rid="B34">Panpetch et&#xa0;al., 2018a</xref>). Notably, most studies of plant pullulanases have been conducted <italic>in vivo</italic> (<xref ref-type="bibr" rid="B10">Dinges et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B13">Fujita et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B21">Li et&#xa0;al., 2019</xref>), which is complicated by the concerted action of several other enzymes and, as a result, specific action information about individual enzymes has rarely been investigated. This study aimed to biochemically characterise pullulanase from <italic>Manihot esculenta</italic> Crantz (<italic>Me</italic>PUL), with a view to determining its biological role in starch metabolism which remained unclear.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>
<italic>Mepul</italic> gene cloning</title>
<p>Total RNA was extracted from nine-month-old cassava <italic>Manihot esculenta</italic> Crantz cultivar &#x2018;KU50&#x2019; tubers harvested from the National Research Centre of Millet and Corn, Thailand, using PureLink&#x2122; Plant RNA Reagent (Invitrogen&#x2122;). The RNA was converted into cDNA using a SMARTer<sup>&#xae;</sup> RACE 5&#x2032;/3&#x2032; Kit (Clontech<sup>&#xae;</sup>) followed the manufacturer&#x2019;s manual. Full length <italic>MePUL</italic> was amplified by PrimeSTAR<sup>&#xae;</sup> HS DNA Polymerase (Clontech<sup>&#xae;</sup>) using the 5&#x2032; RACE cDNA as a template. 5&#x2032; RACE forward primer provided in the RACE kit and a gene specific reverse primer (5&#x2032; GTAAGCTTAAATTTTCCTAGGCTCAACAAACACAG 3&#x2032;) were used for PCR. The PCR product was cloned into a pJET1.2/blunt (Thermo Fisher Scientific&#x2122;) and the putative gene was confirmed by DNA sequencing (1<sup>st</sup> BASE DNA sequencing). A new forward primer (5&#x2032; CTCTA GCTAGCGGTTCCACTCCCACTTCTGAGTTGC 3&#x2032;) excluding a transit peptide sequence predicted by ChloroP1.1 server and a new reverse primer (5&#x2032; AAGGAAAAAATGCGGCCGCAATTTTCCTAGGCTCAACAAACAC 3&#x2032;) were specifically designed. The gene excluding a stop codon was subcloned into a pET21b vector <italic>via Nhe</italic>I and <italic>Not</italic>I restriction sites in-framed with C-terminal 6x His sequence of the plasmid. The recombinant plasmid (pET21b-<italic>Mepul</italic>) was transformed into <italic>E. coli</italic> TOP10 (Invitrogen&#x2122;). The plasmid was extracted and subjected to DNA sequencing.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>
<italic>Mepul</italic> gene expression and purification of the recombinant <italic>Me</italic>PUL (r<italic>Me</italic>PUL)</title>
<p>The pET21b-<italic>Mepul</italic> was transformed into <italic>E. coli</italic> SoluBL21 (DE3) and grown on an LB agar plate containing 100 &#x3bc;g/mL ampicillin. Then, the transformant was cultured in LB broth containing 100 &#x3bc;g/mL ampicillin until OD<sub>600</sub> reached ~ 0.6. Cells were induced for protein production by adding 0.4 mM IPTG and continuously cultured at 16&#xb0;C with shaking at 250 rpm for overnight. Cells were collected by centrifugation at 8,000 x g for 10&#xa0;min at 4&#xb0;C. After that, the cell pellet was suspended in buffer A (25 mM phosphate buffer + 500 mM NaCl + 25 mM imidazole, pH 7.2) and lysed by ultrasonication. After that, cell debris was removed by centrifugation at 10,000 x g for 10&#xa0;min at 4&#xb0;C. The supernatant was loaded onto a Histrap&#x2122; FF column equilibrated with the buffer A. The column was washed by the same buffer and the r<italic>Me</italic>PUL was eluted with a linear gradient of buffer B (25 mM phosphate buffer + 500 mM NaCl + 50 &#x2013; 300 mM imidazole, pH 7.2). Finally, the purified fractions containing <italic>Me</italic>PUL activity were pooled and subjected to dialysis against 25 mM phosphate buffer pH 7.2 at 4&#xb0;C for overnight. SDS-PAGE and western blot analysis were used for evaluating protein purity.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>r<italic>Me</italic>PUL oligomer state analysis</title>
<p>The molecular size of purified r<italic>Me</italic>PUL was analysed with an MAbPac&#x2122; SEC-1 column (4 x 300&#xa0;mm, Thermo Fisher Scientific&#x2122;). The system was run in 25 mM phosphate buffer pH 6.8 containing 300 mM NaCl with a flowrate of 0.2 mL/min at 30&#xb0;C. The signal was monitored by measuring A<sub>280</sub>. Gel Filtration Standards (Bio-Rad) were used for molecular weight calibration. To investigate the multimeric state of r<italic>Me</italic>PUL/r<italic>Me</italic>ISA3 (<xref ref-type="bibr" rid="B34">Panpetch et&#xa0;al., 2018a</xref>), ~ 0.26 nmol of each enzyme was mixed and incubated in 25 mM phosphate buffer pH 7.2 in 0.1 mL total volume at 4&#xb0;C overnight prior to analysis.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>r<italic>Me</italic>PUL activity assay</title>
<p>The purified r<italic>Me</italic>PUL was incubated with 0.75% (w/v) pullulan (Megazyme<sup>&#xae;</sup>) in 25 mM acetate buffer pH 6.0 in the total volume of 0.2 mL at 50&#xb0;C to determine debranching activity. The reaction was terminated by adding an equal volume of 2,4-dinitrosalicylic (DNS) acid reagent (<xref ref-type="bibr" rid="B28">Miller, 1959</xref>) and then boiled for 10&#xa0;min. The colour development of the reactions was monitored by measuring A<sub>540</sub>. One unit of <italic>Me</italic>PUL was defined as the amount of enzyme that release 1 &#x3bc;mol of reducing sugar from pullulan substrate in a minute. Standard glucose in range of 0, 0.5, 1, 1.5, 2, 4, 6, and 8 mM was used for a standard curve.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Biochemical characterisations of r<italic>Me</italic>PUL</title>
<p>The substrate specificity of r<italic>Me</italic>PUL and the effect of pH, temperature, and metal ions and chemicals, and enzyme kinetics were studied. The characterisation was monitored by relative debranching activity of the purified enzyme determined by modified DNS method as described in the enzymatic assay. All experiments were performed in triplicate.</p>
<sec id="s2_5_1">
<label>2.5.1</label>
<title>Optimal pH</title>
<p>The purified r<italic>Me</italic>PUL was assayed in the reaction containing 0.75% (w/v) pullulan in 25 mM buffer at various pH values [acetate buffer (pH 4.0 &#x2013; 6.0) and phosphate buffer (pH 6.0 &#x2013; 7.5)] at 30&#xb0;C.</p>
</sec>
<sec id="s2_5_2">
<label>2.5.2</label>
<title>Optimal temperature</title>
<p>The purified r<italic>Me</italic>PUL was assayed in reactions containing 0.75% (w/v) pullulan in 25 mM acetate buffer pH 6.0 incubated at various temperatures (30 - 60&#xb0;C).</p>
</sec>
<sec id="s2_5_3">
<label>2.5.3</label>
<title>Effect of metal ions</title>
<p>To evaluate the effect of EDTA, the activity of purified r<italic>Me</italic>PUL was measured in the reaction containing 0.75% (w/v) pullulan in 25 mM acetate buffer pH 6.0 and 1 mM EDTA at 50&#xb0;C. The activity was compared with the reaction without EDTA.</p>
<p>The effect of various metal ions was observed. The purified r<italic>Me</italic>PUL was dialysed against 1 mM EDTA in 25 mM phosphate buffer pH 7.2 at 4&#xb0;C overnight. Next, the pretreated enzyme was incubated with 0.75% (w/v) pullulan substrate in 25 mM acetate buffer pH 6.0 at 50&#xb0;C with the presence of 10 mM metal ion [CaCl<sub>2</sub>, CoCl<sub>2</sub>, CuSO<sub>4</sub>, FeCl<sub>2</sub>, MnCl<sub>2</sub>, MgCl<sub>2</sub>, NiSO<sub>4</sub>, and ZnCl<sub>2</sub>].</p>
</sec>
<sec id="s2_5_4">
<label>2.5.4</label>
<title>Substrate specificity</title>
<p>The purified r<italic>Me</italic>PUL was incubated with 0.75% (w/v) of different types of substrates [pullulan, &#x3b2;-limit dextrin, amylopectin, potato starch, cassava starch, glycogen type II, and maltodextrin] in 25 mM acetate buffer pH 6.0 at 50&#xb0;C.</p>
</sec>
<sec id="s2_5_5">
<label>2.5.5</label>
<title>Kinetic studies</title>
<p>To assess enzyme kinetics, the purified r<italic>Me</italic>PUL was incubated with pullulan or &#x3b2;-limit dextrin in 25 mM acetate buffer pH 6.0 at 50&#xb0;C in 0.1-mL reactions under enzyme initial velocity of 15&#xa0;min. The reactions were initiated by addition of 0.75 &#x3bc;g of the purified r<italic>Me</italic>PUL and then analysed by DNS method. To determine the effect of some maltooligosaccharides on enzyme activity, 1 - 3 mM maltose or maltotriose were mixed in the reactions. The kinetic parameters were fitted and determined by the OriginPro 2017 software.</p>
</sec>
<sec id="s2_5_6">
<label>2.5.6</label>
<title>Effect of &#x3b2;-cyclodextrin on <italic>Me</italic>PUL activity</title>
<p>The r<italic>Me</italic>PUL was incubated with 0.75% (w/v) pullulan and 0.01% (w/v) &#x3b2;-CD in 25 mM acetate buffer pH 6.0 in the total volume of 0.2 mL at 50&#xb0;C. The activity was assayed by DNS method. Relative activity was compared with the control reaction without adding &#x3b2;-CD.</p>
</sec>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Product analysis</title>
<sec id="s2_6_1">
<label>2.6.1</label>
<title>Thin-layer chromatography (TLC)</title>
<p>To determine the substrate specificity of <italic>Me</italic>PUL, purified r<italic>Me</italic>PUL was incubated with 2.5 mg/mL various oligosaccharides [maltohexaose (G6, Wako<sup>&#xae;</sup>), maltotriosyl maltotriose (G3G3, Megazyme<sup>&#xae;</sup>), glucosyl maltotriose (G1G3), panose (Megazyme<sup>&#xae;</sup>), isopanose (Megazyme<sup>&#xae;</sup>), isomaltotriose (IMO3, TCI<sup>&#xae;</sup>), &#x3b2;-CD (Sigma<sup>&#xae;</sup>), maltosyl &#x3b2;-CD (&#x3b2;-CD-G2, Ensuiko Sugar Reffining Co., Ltd.), glucosyl &#x3b2;-CD (&#x3b2;-CD-G1, Bio Research Coporation of Yokohama), and acarbose (Wako<sup>&#xae;</sup>)] in 25 mM acetate buffer pH 6.0 at 50&#xb0;C for 2.5 hr.</p>
<p>In addition, to confirm the specificity of pullulan cleavage, products produced by <italic>Kp</italic>PUL (commercial pullulanase, Sigma<sup>&#xae;</sup>) and the purified r<italic>Me</italic>PUL were also compared. 0.2 U/mL of both PULs were incubated with 0.5% (w/v) pullulan in 25 mM acetate buffer pH 6.0 at 25&#xb0;C and at 50&#xb0;C for <italic>Kp</italic>PUL and r<italic>Me</italic>PUL, respectively. The products were analysed at 0, 0.5, 1, 3.5, 6, and 24 hr after incubation.</p>
<p>The products from the enzymatic reactions were spotted onto TLC plates (TLC Silica gel 60 F<sub>254</sub>, Merck). The TLC was run in a TLC tank equilibrated with acetonitrile:ethylacetate:1-propanol:water (85:20:50:60). Finally, the result was visualised by heating at 110&#xb0;C for 10&#xa0;min after staining with orcinol solution orcinol solution (sulphuric acid:ethanol:water (5:27:13) containing 0.2%(w/v) orcinol) (<xref ref-type="bibr" rid="B46">Waksmundzka-Hajnos et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B48">Wangpaiboon et&#xa0;al., 2021</xref>).</p>
</sec>
<sec id="s2_6_2">
<label>2.6.2</label>
<title>High-performance anion-exchange chromatography with pulsed amperometric detection analysis (HPAEC-PAD)</title>
<p>To analyse the product pattern according to the debranching activity of PUL on pullulan substrate, The 0.2 U/mL of both PULs were incubated with 0.5% (w/v) pullulan in 25 mM acetate buffer pH 6.0 at 25&#xb0;C and at 50&#xb0;C for <italic>Kp</italic>PUL and r<italic>Me</italic>PUL, respectively. The products were analysed at 0.5 hr after incubation.</p>
<p>The enzymatic reactions were analysed by HPAEC-PAD using a CarboPac&#x2122; PA-100 column with a flowrate of 1 mL/min at 30&#xb0;C. The products were eluted with a linear gradient of 0 &#x2013; 0.5 M sodium acetate in 150 mM NaOH solution for 35&#xa0;min, followed by 0.5 M sodium acetate in 150 mM NaOH for 5&#xa0;min.</p>
</sec>
<sec id="s2_6_3">
<label>2.6.3</label>
<title>Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS)</title>
<p>Each sample obtained from PUL reactions (section 2.6.2) was desalted by using a mixed bed resin (AG 501-X8, Bio-Rad). The samples were diluted 10-fold prior to mixing with 10 mg/mL of 2,5-dihydroxybenzoic acid with the ratio of 1:1 and spotted onto a MALDI target plate. Masses were analysed with a JEOL SpiralTOF MALDI Imaging-TOF/TOF Mass Spectrometer using spiral mode.</p>
</sec>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Synergistic action between cassava r<italic>Me</italic>PUL and r<italic>Me</italic>ISA3</title>
<p>To investigate the possible relationship between PUL and ISA3 in starch degradation process, r<italic>Me</italic>ISA3 and r<italic>Me</italic>PUL activities were defined under the same condition; 0.75% (w/v) &#x3b2;-limit dextrin (Megazyme<sup>&#xae;</sup>) in 25 mM acetate buffer pH 6.0 at 37&#xb0;C. For the individual enzyme reactions, 0.2 U/mL of either r<italic>Me</italic>ISA3 or r<italic>Me</italic>PUL was incubated with 0.5% (w/v) &#x3b2;-limit dextrin in 25 mM acetate buffer pH 6.0 at 37&#xb0;C. For the mixed-enzyme reaction, 0.1 U/mL of each enzyme was added to the reaction and then incubated under the same conditions. The reactions were collected at the time points of 0, 0.5, 1, 3.5, 6, and 24 hr and analysed by HPAEC-PAD and MALDI-TOF MS.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Computational structural analysis by molecular dynamics simulation (MD)</title>
<p>SWISS-MODEL server was employed to constructed homology model of mature <italic>Me</italic>PUL using crystal structure of barley limit dextrinase (E510A mutant) in complex with a 6<sup>II</sup>-O-maltotriosylmaltotriose (branched maltohexaose, PDB ID: 4J3W) (<xref ref-type="bibr" rid="B24">M&#xf8;ller et&#xa0;al., 2015</xref>) as a template. Structure of branched maltohexaose in complex with <italic>Me</italic>PUL homology model was also extracted from this crystal structure. H<sup>++</sup> server was used to protonated all amino acids of this model at pH 6.0 (<xref ref-type="bibr" rid="B15">Gordon et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B29">Myers et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B1">Aguilar et&#xa0;al., 2012</xref>). LEaP module of AMBER20 was employed to solvated the complex in an isomeric truncated octahedral box of TIP3P water model (<xref ref-type="bibr" rid="B19">Jorgensen et&#xa0;al., 1983</xref>) with the buffer distance of 13 &#xc5;. Sodium ions (Na<sup>+</sup>) were added to neutralise the systems. PMEMD module of AMBER 20 was then used to minimise and simulate the system under the periodic boundary condition as previously described (<xref ref-type="bibr" rid="B47">Wangpaiboon et&#xa0;al., 2022</xref>). In the production run, the systems were simulated at 323&#xa0;K for 50 ns. The Cpptraj module (<xref ref-type="bibr" rid="B40">Roe and Cheatham, 2013</xref>) of AMBER 20 was employed to calculated for Root Mean Square Deviation (RMSD) of the complex, and percentage of Hydrogen bond (H-bond) occupation (%H-bond<sub>oc</sub>). RMSD value of all atoms of the protein or ligands were calculated with respect to the minimised structure. The structure was found to be stable in the range of 40 to 50 ns. Therefore, this trajectory was used for analysis. Hydrogen bonds will present if the following conditions are met: (i) a donor-acceptor distance of less than 3.5, and (ii) a donor H-acceptor bond angle of less than 120&#xb0;. H-bond occupations &gt; 50% were taken into account (<xref ref-type="bibr" rid="B20">Klaewkla et&#xa0;al., 2021</xref>). The binding affinity of each residue to the ligand was calculated based on molecular mechanics/Generalised Born surface area (MM/GBSA) method (<xref ref-type="bibr" rid="B14">Genheden et&#xa0;al., 2012</xref>) using MMPBSA.py modules (<xref ref-type="bibr" rid="B14">Genheden et&#xa0;al., 2012</xref>) of AMBER20.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Subcellular localisation of <italic>Me</italic>PUL expressed in <italic>Nicotiana benthamiana</italic> leaves</title>
<p>The full-length <italic>Mepul</italic> was cloned into a pCR&#x2122;8/GW/TOPO<sup>&#xae;</sup> TA vector (Invitrogen&#x2122;) based on circular polymerase extension cloning technique (<xref ref-type="bibr" rid="B3">Aslanidis and De Jong, 1990</xref>; <xref ref-type="bibr" rid="B37">Quan and Tian, 2011</xref>). The gene with LR sequences was then subcloned into a pGWB5 vector fused with the C-terminal green fluorescent protein (GFP) (<xref ref-type="bibr" rid="B31">Nakagawa et&#xa0;al., 2007</xref>) using Gateway<sup>&#xae;</sup> LR Clonase<sup>&#xae;</sup> II (Invitrogen&#x2122;). The pGWB5-<italic>Mepul</italic> was transformed into an <italic>Agrobacterium tumefaciens</italic> GV3101 by electroporation.</p>
<p>
<italic>A. tumefaciens</italic> harbouring pGWB5-<italic>Mepul</italic> and <italic>A. tumefaciens</italic> containing the silencing suppressor <italic>p19</italic> gene were co-infiltrated into 4-week <italic>Nicotiana benthamiana</italic> leaves (<xref ref-type="bibr" rid="B22">Lindbo, 2007</xref>; <xref ref-type="bibr" rid="B36">Panpetch and Sirikantaramas, 2021</xref>). A pGWB2 bearing <italic>GFP</italic> gene was used as a control for infiltration experiments. After 3 days, localisation of <italic>Me</italic>PUL was observed under a FluoView<sup>&#xae;</sup> FV10i-DOC confocal laser scanning microscope (Olympus Corp.). GFP fluorescence signal was monitored at 488/510&#x2009;nm of excitation/emission, while chloroplast autofluorescence was observed at 633/664&#x2009;nm.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Sequence analysis, gene expression, and protein production</title>
<p>The full-length <italic>Mepul</italic> sequence with an open reading frame of 2,904 bp (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S1</bold>
</xref>) was successfully obtained from 5&#x2032; RACE and encoded 967 amino acid residues. According to the full peptide sequence, the first 74 residues belonged to a transit peptide, as predicted by the ChloroP1.1 server (<xref ref-type="supplementary-material" rid="SM2">
<bold>Supplementary Figure S2</bold>
</xref>). For gene expression in <italic>E. coli</italic>, mature <italic>Mepul</italic> without the transit peptide was directly cloned into a pET21b expression vector and successfully expressed in soluble form in <italic>E. coli</italic> SoluBL (DE3) transformant. After purification by a metal ion affinity column, SDS-PAGE and western blot analyses showed a single band of the purified r<italic>Me</italic>PUL. The apparent molecular mass of ~ 100 kDa corresponded to that calculated for monomeric protein the by Expasy Compute pI/Mw tool (<uri xlink:href="https://web.expasy.org/compute.pi/">https://web.expasy.org/compute.pi/</uri>) which was 100776.98 Da (including 6x His). Nevertheless, r<italic>Me</italic>PUL exhibited two protein peaks by gel filtration chromatography with the calculated sizes of 197 and 84 kDa, as shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>: the higher MW peak was a major form.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Molecular weight analysis of r<italic>Me</italic>PUL. <bold>(A, B)</bold> SDS-PAGE and western blot analyses. Crude extract and pooled activity fractions of r<italic>Me</italic>PUL purified by a Histrap&#x2122; column were analysed and visualised by SDS-PAGE and Western blot analysis. Lane M: TriColour Broad Protein Ladder (3.5 &#x2013; 245 kDa) (BiotechRabbit); lane 1: crude protein; lane 2: purified r<italic>Me</italic>PUL (~ 100 kDa). <bold>(C)</bold> Non-denaturing gel filtration analysis. Concentrated pooled purified fraction was loaded onto a gel filtration column (MAbPac&#x2122; SEC-1). Protein standards (shown by dashed line) are as follows; (1) vitamin B12 (1.35 kDa), (2) myoglobin (17 kDa), (3) ovalbumin (44 kDa), (4) &#x3b3;-globulin (158 kDa), and (5) thyroglobulin (670 kDa).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Biochemical characterisation</title>
<p>The r<italic>Me</italic>PUL exhibited optimal temperature and pH at 50 &#xb0;C and pH 6.0, respectively (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A, B</bold>
</xref>). In addition, EDTA treatment could increase enzyme activity of around 30%. Only Ca<sup>2+</sup> ion could promote r<italic>Me</italic>PUL activity ~ 30% higher than the control reaction. Conversely, Co<sup>2+</sup>, Cu<sup>2+</sup>, Zn<sup>2+</sup>, Mg<sup>2+</sup>, and Ni<sup>2+</sup> ions could apparently inhibit <italic>Me</italic>PUL activity (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). Under assay conditions with different branched substrates, r<italic>Me</italic>PUL exhibited the highest activity against pullulan, followed by &#x3b2;-limit dextrin with ~ 80% activity (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). r<italic>Me</italic>PUL showed little hydrolysis activity on potato starch and maltodextrin, at ~ 20% compared with that of pullulan. In contrast, amylopectin, cassava starch, and glycogen type II were barely cleaved by r<italic>Me</italic>PUL.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Biochemical characterisations of purified r<italic>Me</italic>PUL. <bold>(A)</bold> Optimum temperature for debranching activity of r<italic>Me</italic>PUL determined at temperatures ranging from 30 &#x2013; 60&#xb0;C. <bold>(B)</bold> Optimum pH for debranching activity of r<italic>Me</italic>PUL measured at pH 4.0 &#x2013; 7.5 [acetate buffer (&#x25cf;) (pH 4.0, 5.0, 6.0); potassium phosphate buffer (&#x25aa;) (pH 6.0, 7.0, 7.5)]. <bold>(C)</bold> The effect of metal ions [10 mM of Ca<sup>2+</sup>, Co<sup>2+</sup>, Cu<sup>2+</sup>, Fe<sup>2+</sup>, Mg<sup>2+</sup>, Mn<sup>2+</sup>, Ni<sup>2+</sup>, and Zn<sup>2+</sup>] on debranching activity of r<italic>Me</italic>PUL. <bold>(D)</bold> Substrate specificity of the r<italic>Me</italic>PUL on various types of branched substrates (pullulan, &#x3b2;-limit dextrin, potato amylopectin, potato starch, cassava starch, glycogen type II, and maltodextrin). Enzyme activity was analysed by DNS assay.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g002.tif"/>
</fig>
<p>In addition, the kinetics study showed that r<italic>Me</italic>PUL catalysis could be fitted well with Hill plots, with both pullulan and &#x3b2;-limit dextrin substrates (represent in black lines in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A, B</bold>
</xref>). In contrast, pullulan and &#x3b2;-limit dextrin kinetics in the presence of maltose or maltotriose could not be fitted with the same kinetic model. Notably, addition of maltotriose could obviously reduce the <italic>k</italic> value when pullulan was used as substrate (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>), while both <italic>k<sub>cat</sub>
</italic> and <italic>K<sub>m</sub>
</italic> values of &#x3b2;-limit dextrin kinetics in the presence of maltose or maltotriose were highly increased (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM2">
<bold>Supplementary Figure S3</bold>
</xref>, and <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>).To further investigate the linkage-specificity of substrates for r<italic>Me</italic>PUL, the enzyme was incubated with different oligosaccharides harbouring various types of linkages. Among those substrates, maltotriosyl-maltotriose was the only substrate that was completely hydrolysed, releasing maltotriose. On the other hand, for other oligosaccharide substrates including maltohexose, &#x3b2;-cyclodextrin, maltosyl-&#x3b2;-cyclodextrin, glucosyl-&#x3b2;-cyclodextrin, panose, isopanose, glucosyl-maltotriose, isomaltotriose, and acarbose, no catalysis was apparently observed even after 2.5-hr incubation with the enzyme (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Additionally, the effect of &#x3b2;-CD on the inhibition of r<italic>Me</italic>PUL in pullulan hydrolysis was also investigated. The result clearly showed that the pullulan cleavage was almost completely inhibited which only the relative activity of 2.4% was shown compared to the control reaction.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Kinetics study of r<italic>Me</italic>PUL. <bold>(A, B)</bold> Pullulan and &#x3b2;-limit dextrin were used as substrates, respectively. Black lines represent kinetics without addition of maltooligosaccharide (control) and meanwhile red and blue lines show enzyme kinetics with the presence of 1 mM maltose and maltotriose, respectively. The reactions were carried out in 25 mM acetate buffer pH 6.0 at 50&#xb0;C. The debranching activity was determined by DNS assay.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g003.tif"/>
</fig>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Product analysis by TLC of PUL action. <bold>(A)</bold> TLC analysis of r<italic>Me</italic>PUL activity on 2.5 mg/mL various oligosaccharides with different linkages after incubating in 25 mM acetate buffer pH 6.0 at 50&#xb0;C for 2.5 hr. <bold>(B)</bold> TLC analysis of products produced from <italic>Kp</italic>PUL (commercial pullulanase, Sigma) and r<italic>Me</italic>PUL. The 0.2 U/mL of both PULs were incubated with 5 mg/mL pullulan in 25 mM acetate buffer pH 6.0 at 25&#xb0;C for <italic>Kp</italic>PUL and at 50&#xb0;C for r<italic>Me</italic>PUL. The products were analysed at 0, 0.5, 1, 3.5, 6, and 24 hr after incubation.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g004.tif"/>
</fig>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>kinetic parameters of r<italic>Me</italic>PUL.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Substrate</th>
<th valign="bottom" align="center">
<italic>k</italic> or <italic>K<sub>m</sub>
</italic>
<break/>(mg/mL)</th>
<th valign="bottom" align="center">V<sub>max</sub> (x 10<sup>-3</sup>)<break/>(&#x3bc;mol s<sup>-1</sup>)</th>
<th valign="middle" align="center">
<italic>n</italic>
</th>
<th valign="bottom" align="center">
<italic>k<sub>cat</sub>
</italic>
<break/>(s<sup>-1</sup>)</th>
<th valign="middle" align="center">Kinetic model</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="bottom" align="left">pullulan</td>
<td valign="bottom" align="center">1.6 &#xb1; 0.3</td>
<td valign="bottom" align="center">2.5 &#xb1; 0.3</td>
<td valign="bottom" align="center">1.1 &#xb1; 0.2</td>
<td valign="bottom" align="center">333.2 &#xb1; 35</td>
<td valign="bottom" align="left">Hill</td>
</tr>
<tr>
<td valign="bottom" align="left">pullulan +</td>
<td valign="middle" rowspan="2" align="center">0.4 &#xb1; 0.1</td>
<td valign="middle" rowspan="2" align="center">2.3 &#xb1; 0.1</td>
<td valign="middle" rowspan="2" align="center"/>
<td valign="middle" rowspan="2" align="center">309 &#xb1; 15</td>
<td valign="middle" rowspan="2" align="left">MM<sup>&#x1c2;</sup>
</td>
</tr>
<tr>
<td valign="bottom" align="left">1 mM maltotriose</td>
</tr>
<tr>
<td valign="bottom" align="left">&#x3b2;-limit dextrin</td>
<td valign="bottom" align="center">2.9 &#xb1; 0.1</td>
<td valign="bottom" align="center">2.5 &#xb1; 0.7</td>
<td valign="bottom" align="center">2.1 &#xb1; 0.1</td>
<td valign="bottom" align="center">335.9 &#xb1; 10</td>
<td valign="bottom" align="left">Hill</td>
</tr>
<tr>
<td valign="bottom" align="left">&#x3b2;-limit dextrin +</td>
<td valign="middle" rowspan="2" align="center">5.1 &#xb1; 0.7</td>
<td valign="middle" rowspan="2" align="center">3.1 &#xb1;0.2</td>
<td valign="middle" rowspan="2" align="center"/>
<td valign="middle" rowspan="2" align="center">417.9 &#xb1; 31</td>
<td valign="middle" rowspan="2" align="left">MM</td>
</tr>
<tr>
<td valign="bottom" align="left">1 mM maltose</td>
</tr>
<tr>
<td valign="bottom" align="left">&#x3b2;-limit dextrin +</td>
<td valign="middle" rowspan="2" align="center">6.3 &#xb1; 1.3</td>
<td valign="middle" rowspan="2" align="center">3.7 &#xb1; 0.4</td>
<td valign="middle" rowspan="2" align="center"/>
<td valign="middle" rowspan="2" align="center">499.9 &#xb1; 54</td>
<td valign="middle" rowspan="2" align="left">MM</td>
</tr>
<tr>
<td valign="bottom" align="left">3 mM maltose</td>
</tr>
<tr>
<td valign="bottom" align="left">&#x3b2;-limit dextrin +</td>
<td valign="middle" rowspan="2" align="center">14.2 &#xb1; 5.8</td>
<td valign="middle" rowspan="2" align="center">4.9 &#xb1; 0.1</td>
<td valign="middle" rowspan="2" align="center"/>
<td valign="middle" rowspan="2" align="center">659.8 &#xb1; 19</td>
<td valign="middle" rowspan="2" align="left">MM</td>
</tr>
<tr>
<td valign="bottom" align="left">1 mM maltotriose</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<sup>&#x1c2;</sup>Mechaelis-Menten model.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>When pullulan was used as substrate, the patterns of products released from both r<italic>Me</italic>PUL and a commercial pullulanase, <italic>Klebsiella pneumoniae</italic> pullulanase (<italic>Kp</italic>PUL), were as expected rather similar, as shown in the TLC image (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). At 0.5 hr of incubation, series of oligosaccharides harbouring masses of maltotriose building block were apparently released. Notably, at 3.5&#xa0;h onwards, maltotriose was apparently obtained as a main product (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). In addition, the product patterns were also confirmed by HPAEC-PAD and MALDI-TOF MS, where the main peaks corresponded to maltotriose and maltotriosyl-maltotriose (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Pullulan hydrolysis. <bold>(A)</bold> HPAEC-PAD analysis and <bold>(B)</bold> MALDI-TOF MS analyses of products synthesised from r<italic>Me</italic>PUL. The 0.2 U/mL of r<italic>Me</italic>PUL and <italic>Kp</italic>PUL were incubated with 5 mg/mL pullulan in 25 mM acetate buffer pH 6.0 at 25&#xb0;C for <italic>Kp</italic>PUL and at 50&#xb0;C for r<italic>Me</italic>PUL for 0.5 hr.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g005.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Prediction of a catalytically competent binding conformation</title>
<p>Determination of a catalytically competent binding conformation of the enzyme is important to describe how the enzyme acts on its specific substrate. Although r<italic>Me</italic>PUL exhibited the highest activity on pullulan (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>), this substrate is not found in plants but generally obtained from fungi such as <italic>Aureobasidium pullulans</italic> (<xref ref-type="bibr" rid="B33">Pandey et&#xa0;al., 2021</xref>). Additionally, the <italic>Me</italic>PUL active site could not be fully occupied by pullulan substrate since the pullulan structure lacks glucosyl branch point at the position of 0&#x2032; subsite in the active site. Thus, 6<sup>II</sup>-O-maltotriosylmaltotriose or branched maltohexaose which is an interior structure of &#x3b2;-limit dextrin, a more close-to-nature substrate, was chosen instead of pullulan to evaluate the interaction and conformation of mature <italic>Me</italic>PUL when binding to its substrate by using molecular dynamics (MD) simulation analysis. The RMSD plots showed that <italic>Me</italic>PUL was likely stable at 10&#x2009;ns of simulation, while branched maltohexaose was stable after 20 ns of simulation (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). High fluctuation of RMSD value was observed for branched maltohexaose due to its flexibility. Therefore, the last 10&#x2009;ns trajectories of simulations were selected for further analysis including H-bond network and binding free energy. The binding conformation and H-bond network of branched maltohexaose in <italic>Me</italic>PUL binding site were illustrated in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>. Branched maltohexaose substrate laid along the <italic>Me</italic>PUL binding track formed H-bonds with N368, D551, R554, D652, N653, and D708. The per-residue decomposition free energy of crucial residues within the substrate-binding track was calculated using the MM/GBSA method (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). The result revealed that W365, Y367, N368, H414, C449, V450, L484, W522, F524, D551, R554, F563, H651, D652, N653, D708, Y710, and K737 of <italic>Me</italic>PUL significantly interacted with branched oligosaccharides. Additionally, residue conservation analysis with searching 149 related sequences, such as pullulanases, &#x3b1;-1,6-glucosidases, etc. (<xref ref-type="supplementary-material" rid="SM2">
<bold>Supplementary data II</bold>
</xref>), with the ConSurf server (<xref ref-type="bibr" rid="B2">Ashkenazy et&#xa0;al., 2016</xref>) showed that the best predicted binding residues are highly conserved (&gt; 80%), except F563, D708, and K737 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S4</bold>
</xref>) which exhibited a lower cutoff (&lt;80%).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Molecular dynamics simulation analysis of mature <italic>Me</italic>PUL/branched maltohexaose complex. <bold>(A)</bold> Time evolution of all-atom RMSD. <bold>(B)</bold> The binding conformation and H-bond network of branched maltohexaose in <italic>Me</italic>PUL binding site. <bold>(C)</bold> The per-residue decomposition free energy of residues within the substrate-binding track. <bold>(D)</bold> The proposed oligosaccharide binding subsites of <italic>Me</italic>PUL.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g006.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Synergistic activity between <italic>Me</italic>PUL and <italic>Me</italic>ISA3</title>
<p>r<italic>Me</italic>PUL could release a broad range of maltooligosaccharides from &#x3b2;-limit dextrin with degree of polymerisation (DP) longer than 7, while products of r<italic>Me</italic>ISA3 were mainly short maltooligosaccharides (DP &lt;5) as shown by HPAEC-PAD (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>) and MALDI-TOF MS (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S5</bold>
</xref>). When r<italic>Me</italic>PUL and r<italic>Me</italic>ISA3 were co-incubated, the product pattern was similar to that of single r<italic>Me</italic>PUL, however, the peak areas of DP 2 - 4 were obviously greater (&gt;2 times) than a summary of the peak area obtained from each single r<italic>Me</italic>PUL and r<italic>Me</italic>ISA3 reaction (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S6</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Synergistic activity between r<italic>Me</italic>PUL and r<italic>Me</italic>ISA3 on &#x3b2;-limit dextrin. 0.2 U/mL of <bold>(A)</bold> r<italic>Me</italic>PUL or <bold>(B)</bold> r<italic>Me</italic>ISA3 as well as <bold>(C)</bold> mixture of 0.2 U/mL r<italic>Me</italic>PUL + 0.2 U/mL r<italic>Me</italic>ISA3 were incubated with 0.5% (w/v) &#x3b2;-limit dextrin in 25 mM acetate buffer pH 6.0 at 37&#xb0;C for 24 hr and products were analysed by HPAEC-PAD.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g007.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Subcellular localisation of <italic>Me</italic>PUL</title>
<p>The pGWB5-<italic>Mepul</italic> and the silencing suppressor <italic>p19</italic> were co-expressed in <italic>Agrobacterium tumefaciens</italic> GV3101 infiltrated in 4-wk <italic>N. benthamiana</italic> leaves. The in-planta assay showed that GFP-tagged <italic>Me</italic>PUL fluorescence signals were detected in the chloroplasts (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>, bottom panel, inset). This corresponded to the presence of transit peptide sequence predicted <italic>in silico</italic>. Conversely, the eGFP protein, as control, was overexpressed and localised throughout the plant cells.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Subcellular GFP-tagged <italic>Me</italic>PUL localisation in <italic>Nicotiana benthamiana</italic> leaves. Confocal microscopic images of <italic>N. benthamiana</italic> leaf epidermal cells infiltrated with pGWB2-<italic>GFP</italic> (control; upper panel) and pGWB5-<italic>Mepul</italic> (lower panel). Chloroplast autofluorescence (chloroplast), GFP fluorescence (eGFP), and merged images are shown. Plastidial <italic>Me</italic>PUL-GFP localisation is shown as enlargements in the insets. Scale bars: 50&#x2009;&#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1114215-g008.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>The protein sequence of r<italic>Me</italic>PUL was identical to the cassava pullulanase in the Phytozome database [Manes.10G051700.1.p]. Comparison of the <italic>Me</italic>PUL to those of other plants and bacteria showed some sequecne similarity - around 37 &#x2013; 74%, including to <italic>Hordeum vulgare</italic> pullulanase (<italic>Hv</italic>LD; GenBank AAD04189.1, 65%), <italic>Oryza sativa</italic> pullulanase (<italic>Os</italic>PUL; GenBank BAA09167.1, 60%), <italic>Solanum tuberosum</italic> pullulanase (<italic>St</italic>PUL; GenBank XP_006361707.1, 71%), <italic>Arabidopsis thaliana</italic> pullulanase (<italic>At</italic>PUL; GenBank NP_196056.2, 72%) <italic>Zea mays</italic> pullanase <italic>(Zm</italic>PUL; GenBank NP_001104920.1, 74%), and <italic>Spinacia oleracea</italic> pullulanase (<italic>So</italic>PUL; GenBank CAA58803.1, 71%), and <italic>Klebsiella pneumoniae</italic> pullulanase, a bacterial pullulanase (<italic>Kp</italic>PUL: PDB 2FGZ, 37%). The sequence alignments are presented in <xref ref-type="supplementary-material" rid="SM1">
<bold>Figures S2, S7</bold>
</xref>. However, <italic>Me</italic>PUL showed very low similarity compared with other types of <italic>Manihot esculenta</italic> debranching enzymes (<italic>Me</italic>ISA1: GenBank AUZ20772.1, 23%; <italic>Me</italic>ISA2: GenBank AUZ20773.1, 24%; and <italic>Me</italic>ISA3: GenBank AUZ20774.1, 29%) shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S8</bold>
</xref>. Although they are members of the same Glycoside hydrolase (GH) 13 family, ISAs are subcategorised into subfamily 11. The <italic>Me</italic>PUL belongs to GH 13 subfamily 13 (pullulanase subfamily) based on sequence similarity (<xref ref-type="bibr" rid="B25">Machovi&#x10d; and Jane&#x10d;ek, 2008</xref>). The <italic>Me</italic>PUL also comprised 4 domains of N-terminal domain, CBM48, catalytic domain, and C-terminal domain similar to that of <italic>Hv</italic>PUL as shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S2</bold>
</xref> (<xref ref-type="bibr" rid="B45">Vester-Christensen et&#xa0;al., 2010b</xref>).</p>
<p>Fortunately, although the <italic>Me</italic>PUL comprised a total of 14 cysteine residues in the mature protein sequence, it was successfully expressed in soluble form in <italic>E. coli</italic> SoluBL (DE3) transformant. Noticeably, protein MW obtained from gel filtration chromatography under non-denaturing condition was ~ 2-fold higher than the MW shown by SDS-PAGE analysis (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>), which implied that <italic>Me</italic>PUL could be naturally present as a homodimer. Unlike other debranching enzymes from cassava, the <italic>Me</italic>ISA1 and <italic>Me</italic>ISA2 essentially exist as catalytically active hetermeric enzymes with various molar ratios (<xref ref-type="bibr" rid="B35">Panpetch et&#xa0;al., 2018b</xref>), while <italic>Me</italic>ISA3 is a monomeric enzyme (<xref ref-type="bibr" rid="B34">Panpetch et&#xa0;al., 2018a</xref>). Additionally, <italic>So</italic>PUL was reported as a monomeric protein (<xref ref-type="bibr" rid="B39">Renz et&#xa0;al., 1998</xref>) and partially purified <italic>St</italic>PUL from potato tuber present as a dimer analysed under nondenaturing condition however 3 protein bands were shown on SDS-PAGE gel (<xref ref-type="bibr" rid="B17">Ishizaki et&#xa0;al., 1983</xref>).</p>
<p>An <italic>in vitro</italic> biochemical assay of r<italic>Me</italic>PUL disclosed that r<italic>Me</italic>PUL has pH optimum in the slightly acidic pH range and is a metal ion-dependent enzyme (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Surprisingly, the optimum temperature of r<italic>Me</italic>PUL was at 50&#xb0;C (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>), while for r<italic>Me</italic>ISA3 it was at only at 37&#xb0;C (<xref ref-type="bibr" rid="B34">Panpetch et&#xa0;al., 2018a</xref>) even though they both originate from the same organism. r<italic>Me</italic>PUL exhibited the highest activity in acetate buffer pH at 6.0 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>) like r<italic>Me</italic>ISA3. The activity dropped by up to 50% at pH 5.0 and 7.0, with a sharp drop of activity below 5 or above 7, similar to the reported optimum pH of isoamylases from potato and maize (<xref ref-type="bibr" rid="B17">Ishizaki et&#xa0;al., 1983</xref>; <xref ref-type="bibr" rid="B11">Doehlert and Knutson, 1991</xref>; <xref ref-type="bibr" rid="B38">Rahman et&#xa0;al., 1998</xref>). Nevertheless, both optimal pH and temperature between <italic>Me</italic>PUL and <italic>St</italic>PUL were similarly (<xref ref-type="bibr" rid="B17">Ishizaki et&#xa0;al., 1983</xref>). Moreover, only Ca<sup>2+</sup> ion could promote the activity of r<italic>Me</italic>PUL (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>) corresponded to the presence of embedding of Ca<sup>2+</sup> in <italic>Hv</italic>PUL crystal structure (<xref ref-type="bibr" rid="B45">Vester-Christensen et&#xa0;al., 2010b</xref>), while the opposite was true for <italic>St</italic>PUL where Ca<sup>2+</sup> ion lowered the enzyme activity by around 40%. However, enzyme activity was completely inhibited by Cu<sup>2+</sup> and Zn<sup>2+</sup> (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>), correlating with previous work of Iwaki and Fuwa (1981) (<xref ref-type="bibr" rid="B18">Iwaki and Fuwa, 1981</xref>), which reported that 1 mM Cu<sup>2+</sup>, Zn<sup>2+</sup>, Ag<sup>2+</sup>, or Cd<sup>2+</sup> inhibited rice endosperm debranching enzyme. Moreover, we also found that r<italic>Me</italic>PUL activity could be enhanced after treating with EDTA. Possibly, there was contamination of some metal ion inhibitors in gene expression and protein purification processes</p>
<p>To evaluate the substrate specificity of r<italic>Me</italic>PUL, the enzyme was incubated with various substrates (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). r<italic>Me</italic>PUL exhibited the highest activity toward pullulan (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). This confirmed that this debranching enzyme was pullulanase-type, while isoamylase-type debranching enzyme clearly showed no activity on pullulan at all (<xref ref-type="bibr" rid="B35">Panpetch et&#xa0;al., 2018b</xref>; <xref ref-type="bibr" rid="B34">Panpetch et&#xa0;al., 2018a</xref>). Notably, r<italic>Me</italic>PUL was unable to cleave substrates harbouring highly branched structures, especially amylopectin, cassava starch, and glycogen. However, compared to no activity on cassava starch, r<italic>Me</italic>PUL could digest potato starch weakly, with ~20% of its activity on pullulan. This possibly resulted from less complexity of the intrinsic structure of potato starch than that of cassava. Hence, <italic>in vitro</italic> results could support the trimming model hypothesis of starch granule synthesis, proposing that PUL could partially substitute for ISA1 activity (<xref ref-type="bibr" rid="B10">Dinges et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B49">Wattebled et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B13">Fujita et&#xa0;al., 2009</xref>). Importantly, r<italic>Me</italic>PUL also preferentially digested &#x3b2;-limit dextrin at a high level as shown in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>. This might be because its structure is rather similar to that of &#x3b1;-limit dextrin or pullulan-like polymers found in plants, which are both produced by amylase action in starch degradation. Moreover, the results from protein localisation indicated that <italic>Me</italic>PUL was specifically localised to the plastid organelles (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>) such as chloroplast and amyloplast, where starch degradation occurs in plant cells (<xref ref-type="bibr" rid="B52">Zeeman et&#xa0;al., 2010</xref>). Taken together, these data along with some previous reports on target localisation to plastid organelles support the notion that <italic>Me</italic>PUL principally participates in starch degradation processes (<xref ref-type="bibr" rid="B52">Zeeman et&#xa0;al., 2010</xref>). Additionally, unlike other PULs from cereals, such as rice (<xref ref-type="bibr" rid="B51">Yamasaki et&#xa0;al., 2008</xref>) and barley (<xref ref-type="bibr" rid="B26">Mcdougall et&#xa0;al., 2004</xref>), transglycosylation activity could not be observed in r<italic>Me</italic>PUL.</p>
<p>Enzyme kinetic analysis with r<italic>Me</italic>PUL acting on pullulan and &#x3b2;-limit dextrin was fitted with Hill plots, indicating the cooperative manner of the enzyme. Conversely, it was still unclear why addition of some maltooligosaccharides such as maltose and maltotriose could obviously change the kinetic pattern of r<italic>Me</italic>PUL (from Hill to Michaleis-Menten). Notably, maltotriose, the main product of pullulan hydrolysis, was a potential positive effector of the r<italic>Me</italic>PUL action, since it could clearly promote binding affinity (<italic>k</italic> or <italic>K<sub>m</sub>
</italic>) of the enzyme to pullulan substrate. However, maltose and maltotriose could also increase <italic>k<sub>cat</sub>
</italic> around 1.2 - 1.7 folds for &#x3b2;-limit dextrin hydrolysis (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S3</bold>
</xref>, and <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). It might be that these maltooligosaccharides produced during starch degradation (<xref ref-type="bibr" rid="B52">Zeeman et&#xa0;al., 2010</xref>) act as allosteric modulators to some enzymes participating in the starch degradation process.</p>
<p>Although <italic>Me</italic>PUL exhibited very low sequence similarity to <italic>Kp</italic>PUL (<xref ref-type="bibr" rid="B27">Mikami et&#xa0;al., 2006</xref>) (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S7</bold>
</xref>), their product patterns of on pullulan degradation were rather similar, mainly reflecting the release of maltotriose and maltotriose-containing oligosaccharides (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). However, pullulan does not entirely consist of maltotriose building blocks (<xref ref-type="bibr" rid="B7">Catley and Whelan, 1971</xref>; <xref ref-type="bibr" rid="B5">Carolan et&#xa0;al., 1983</xref>); it also contains maltooligosaccharides with different DPs, such as maltose (DP2) and maltotetraose (DP4), which could also be detected in HPAEC analysis from r<italic>Me</italic>PUL and <italic>Kp</italic>PUL reactions. r<italic>Me</italic>PUL specifically hydrolysed &#x3b1;-1,6 linkage between maltoriose units but no hydrolytic activity on linear &#x3b1;-1,4-linked oligosaccharides was observed (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>), strongly indicating that <italic>Me</italic>PUL is a pullulanase type I (<xref ref-type="bibr" rid="B23">M&#xf8;ller et&#xa0;al., 2016</xref>). Cyclic oligosaccharides such as &#x3b2;-cyclodextrin (&#x3b2;-CD) and &#x3b1;-1,6 branched &#x3b2;-cyclodextrins (&#x3b2;-CD-G1 and &#x3b2;-CD-G2) were not cleaved by r<italic>Me</italic>PUL. Furthermore, the pullulan cleavage was almost completely inhibited by &#x3b2;-CD as judged by DNS assay. This corresponded to the competitive inhibition of debranching activities of <italic>Kp</italic>PUL and <italic>Hv</italic>LD by CDs, where the cyclic structure of cyclic oligosaccharides can productively bind at subsites +1, +2, and 0&#x2032;, as shown in superimposition structures of <italic>Me</italic>PUL and <italic>Hv</italic>LD (<xref ref-type="bibr" rid="B44">Vester-Christensen et&#xa0;al., 2010a</xref>; <xref ref-type="bibr" rid="B24">M&#xf8;ller et&#xa0;al., 2015</xref>) (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S9</bold>
</xref>). Although &#x3b2;-CD-G1 and &#x3b2;-CD-G2 contained an &#x3b1;-1,6 branch, the glucosyl and maltosyl branches were not appropriately positioned at catalytic cleavage site (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S9</bold>
</xref>), corresponding to complex structure of <italic>Hv</italic>LD with 6-S-(&#x3b1;-D-maltosyl)-6-deoxy-6-thiocyclomaltoheptaose (<xref ref-type="bibr" rid="B24">M&#xf8;ller et&#xa0;al., 2015</xref>). Therefore, &#x3b2;-CD-G1 and &#x3b2;-CD-G2 could not be hydrolysed by r<italic>Me</italic>PUL. Interestingly, r<italic>Me</italic>PUL could not digest the &#x3b1;-1,6 linkage of glucosyl-maltotriose (G1G3), panose or isopanose. The experimental data demonstrated that the active site of r<italic>Me</italic>PUL required longer substrates in order to make productive contacts with the longer binding site. This information acorrelated with computational analysis, which showed that the <italic>Me</italic>PUL-branched maltohexaose complex exhibited high binding energy at +2, +1, -1, -2, and -3 sites (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). The computational and bioinformatic data revealed that the residues W365, Y367, N368, H414, C449, V450, L484, W522, F524, D551, R554, F563, H651, D652, N653, D708, Y710, and K737 were potentially essential for substrate binding based on the results of the MM/GBSA method and conserved sequence analysis. Most of these residues, which bound with ligands (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>), were highly conserved at the same positions in the 3D-structures of <italic>Me</italic>PUL, <italic>Hv</italic>LD, (<xref ref-type="bibr" rid="B24">M&#xf8;ller et&#xa0;al., 2015</xref>), and <italic>Kp</italic>PUL (<xref ref-type="bibr" rid="B27">Mikami et&#xa0;al., 2006</xref>) even though they did not show high similarity of overall protein sequences. Notably, two out of those residues, F563 and D708 located near the branch point of branched maltohexaose, showed 80% lower score of the cutoff conservation. Perhaps these variable residues might play a role in imposing the substrate specificity. Proposed oligosaccharide binding subsites of <italic>Me</italic>PUL are shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>.</p>
<p>To analyse the relationship between <italic>Me</italic>PUL and <italic>Me</italic>ISA3 debranching activities in starch degradation, mixed-enzyme reaction was performed on &#x3b2;-limit dextrin substrate (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). The results suggested that r<italic>Me</italic>PUL preferentially cleave longer chains in broad ranges of maltooligosaccharides and meanwhile r<italic>Me</italic>ISA3 liberated only short-chain maltooligosaccharides (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S4</bold>
</xref>). This suggested that <italic>Me</italic>PUL might play a major role in starch debranching of cassava starch catabolism. Interestingly, when r<italic>Me</italic>ISA3 and r<italic>Me</italic>PUL were present together in the same reaction, the debranching activity of short-chain oligosaccharides (DP 2 - 4) was apparently increased (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S6</bold>
</xref>). This result implied that <italic>Me</italic>ISA3 and <italic>Me</italic>PUL worked synergistically, possibly by providing favourable substrates for each other by removal of some unfavourable branched points due to their different substrate preferences. Importantly, considering the prospect of an heterocomplex between r<italic>Me</italic>ISA3 and r<italic>Me</italic>PUL, no multimeric r<italic>Me</italic>ISA3/r<italic>Me</italic>PUL complex was observed by gel filtration chromatography (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S10</bold>
</xref>). This demonstrated that they should work separately for their debranching activities.</p>
<p>Some previous studies <italic>in vivo</italic> revealed that deficiency of PUL in rice (<xref ref-type="bibr" rid="B13">Fujita et&#xa0;al., 2009</xref>) and maize (<xref ref-type="bibr" rid="B50">Wong et&#xa0;al., 2003</xref>) slightly effected on an accumulation of water-soluble glucan. Although <italic>Me</italic>ISA3 and <italic>Me</italic>PUL seemed to exhibit overlapping activities in debranching processes, cassava starch catabolism may not be efficient when only either PUL or ISA3 are present, which contrasts with some previous reports from other plant species (<xref ref-type="bibr" rid="B50">Wong et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B9">Delatte et&#xa0;al., 2006</xref>; <xref ref-type="bibr" rid="B13">Fujita et&#xa0;al., 2009</xref>). Importantly, both PUL and ISA3 have been conserved in most plants. Previous <italic>in vivo</italic> studies showed the relationship between these two enzymes, but they did not clearly unravel the reason for the conservation of both enzymes. Nevertheless, our results show that both PUL and ISA3 are necessary for efficient starch degradation <italic>in vitro</italic>: their synergistic action may account for why these two types of debranching enzymes are typically present in plant cells.</p>
</sec>
<sec id="s5" sec-type="conclusion">
<label>5</label>
<title>Conclusion</title>
<p>Pullulanase from <italic>Manihot esculenta</italic> Crantz &#x2018;KU50&#x2019; was successfully cloned, expressed, and biochemically characterised. This debranching enzyme was clearly categorised as pullulanase type I due to its preference for cleaving &#x3b1;-1,6 linkages of pullulan and &#x3b2;-limit dextrin. The debranching action of PUL is conserved in most plants, both mono- and di-cotyledons, and is located in plastids. The present work demonstrates the synergistic action between <italic>Me</italic>PUL and <italic>Me</italic>ISA3, which is important for efficient starch degradation in cassava and which may have implications for biotechnology innovation in relation to harnessing starch for food and materials applications.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>KW, TC, and PP: conceptualization. KW, TC, MK, and PP: methodology. KW, TC, and PP: formal analysis. KW, TC, MK, RF, and PP: investigation. TC and PP: resources. TC and PP: data curation. KW, TC, and MK: writing - original draft. KW, TC, RF, and PP: writing - review &amp; editing. KW, TC, MK, and PP: visualization. KW and PP: supervision. PP: funding acquisition. PP: Project Administration. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This research was supported by Thailand Science research and Innovation Fund Chulalongkorn University [BCG66230003 to PP]. KW received a Second Century Fund (C2F) Postdoctoral Fellowship of Chulalongkorn University. This work [Grant No. RGNS 64-014] is also supported by Office of the Permanent Secretary, Ministry of Higher Education, Science, Research and Innovation (OPS MHESI), Thailand Science Research and Innovation (TSRI) and Chulalongkorn University. This research project is supported by grants for development of new faculty Staff, Ratchadaphiseksomphot Fund, Chulalongkorn University&#x201d;.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We would like to thank Mr. Prasert Thala from National Research Centre of Millet and Corn (Suwan Farm) in Nakhon Ratchasima province for kindly providing cassava &#x2018;KU50&#x2019; tubers. The <italic>N. benthamiana</italic> plants were kindly provided by Ms. Poorichaya Singcha. We also thanks to Assist. Prof. Dr. Rath Pichyangkura, Assoc. Prof. Dr. Kuakarun Krusong, and Assoc. Prof. Dr. Supaart Sirikantaramas, Department of Biochemistry, Faculty of Science, Chulalongkorn University for some chemicals supports.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2023.1114215/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2023.1114215/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="DataSheet_2.docx" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aguilar</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Anandakrishnan</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Onufriev</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>H++ 3.0: automating pK prediction and the preparation of biomolecular structures for atomistic molecular modeling and simulations</article-title>. <source>Nucleic Acids Res.</source> <volume>40</volume>, <fpage>W537</fpage>&#x2013;<lpage>W541</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gks375</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ashkenazy</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Abadi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Martz</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Chay</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Mayrose</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Pupko</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>ConSurf 2016: an improved methodology to estimate and visualize evolutionary conservation in macromolecules</article-title>. <source>Nucleic Acids Res.</source> <volume>44</volume>, <fpage>W344</fpage>&#x2013;<lpage>W350</lpage>. doi: <pub-id pub-id-type="doi">10.1093/nar/gkw408</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aslanidis</surname> <given-names>C.</given-names>
</name>
<name>
<surname>De Jong</surname> <given-names>P. J.</given-names>
</name>
</person-group> (<year>1990</year>). <article-title>Ligation-independent cloning of PCR products (LIC-PCR)</article-title>. <source>Nucleic Acids Res.</source> <volume>18</volume>, <fpage>6069</fpage>&#x2013;<lpage>6074</lpage>. doi: <pub-id pub-id-type="doi">10.1093/nar/18.20.6069</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ball</surname> <given-names>S. G.</given-names>
</name>
<name>
<surname>Morell</surname> <given-names>M. K.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>From bacterial glycogen to starch: understanding the biogenesis of the plant starch granule</article-title>. <source>Annu. Rev. Plant Biol.</source> <volume>54</volume>, <fpage>207</fpage>&#x2013;<lpage>233</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev.arplant.54.031902.134927</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carolan</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Catley</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Mcdougal</surname> <given-names>F. J.</given-names>
</name>
</person-group> (<year>1983</year>). <article-title>The location of tetrasaccharide units in pullulan</article-title>. <source>Carbohydr. Res.</source> <volume>114</volume>, <fpage>237</fpage>&#x2013;<lpage>243</lpage>. doi: <pub-id pub-id-type="doi">10.1016/0008-6215(83)88190-7</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caspar</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>T.-P.</given-names>
</name>
<name>
<surname>Kakefuda</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Benbow</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Preiss</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Somerville</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Mutants of arabidopsis with altered regulation of starch degradation</article-title>. <source>Plant Physiol.</source> <volume>95</volume>, <fpage>1181</fpage>&#x2013;<lpage>1188</lpage>. doi: <pub-id pub-id-type="doi">10.1104/pp.95.4.1181</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Catley</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Whelan</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>1971</year>). <article-title>Observations on the structure of pullulan</article-title>. <source>Arch. Biochem. biophysics</source> <volume>143</volume>, <fpage>138</fpage>&#x2013;<lpage>142</lpage>. doi: <pub-id pub-id-type="doi">10.1016/0003-9861(71)90193-7</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Delatte</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Trevisan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Parker</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Zeeman</surname> <given-names>S. C.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Arabidopsis mutants Atisa1 and Atisa2 have identical phenotypes and lack the same multimeric isoamylase, which influences the branch point distribution of amylopectin during starch synthesis</article-title>. <source>Plant J.</source> <volume>41</volume>, <fpage>815</fpage>&#x2013;<lpage>830</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1365-313X.2005.02348.x</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Delatte</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Umhang</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Trevisan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Eicke</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Thorneycroft</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>S. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2006</year>). <article-title>Evidence for distinct mechanisms of starch granule breakdown in plants</article-title>. <source>J. Biol. Chem.</source> <volume>281</volume>, <fpage>12050</fpage>&#x2013;<lpage>12059</lpage>. doi: <pub-id pub-id-type="doi">10.1074/jbc.M513661200</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dinges</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Colleoni</surname> <given-names>C.</given-names>
</name>
<name>
<surname>James</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Myers</surname> <given-names>A. M.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Mutational analysis of the pullulanase-type debranching enzyme of maize indicates multiple functions in starch metabolism</article-title>. <source>Plant Cell</source> <volume>15</volume>, <fpage>666</fpage>&#x2013;<lpage>680</lpage>. doi: <pub-id pub-id-type="doi">10.1105/tpc.007575</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Doehlert</surname> <given-names>D. C.</given-names>
</name>
<name>
<surname>Knutson</surname> <given-names>C. A.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Two classes of starch debranching enzymes from developing maize kernels</article-title>. <source>Journal of Plant Physiology</source> <volume>138</volume>(<issue>5</issue>), <fpage>566</fpage>&#x2013;<lpage>572</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0176-1617(11)80242-7</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Drula</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Garron</surname> <given-names>M.-L.</given-names>
</name>
<name>
<surname>Dogan</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lombard</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Henrissat</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Terrapon</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>The carbohydrate-active enzyme database: functions and literature</article-title>. <source>Nucleic Acids Res.</source> <volume>50</volume>, <fpage>D571</fpage>&#x2013;<lpage>D577</lpage>. doi: <pub-id pub-id-type="doi">10.1093/nar/gkab1045</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fujita</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Toyosawa</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Utsumi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Higuchi</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hanashiro</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Ikegami</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>Characterization of pullulanase (PUL)-deficient mutants of rice (Oryza sativa l.) and the function of PUL on starch biosynthesis in the developing rice endosperm</article-title>. <source>J. Exp. Bot.</source> <volume>60</volume>, <fpage>1009</fpage>&#x2013;<lpage>1023</lpage>. doi: <pub-id pub-id-type="doi">10.1093/jxb/ern349</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Genheden</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kuhn</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Mikulskis</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Hoffmann</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Ryde</surname> <given-names>U.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The normal-mode entropy in the MM/GBSA method: effect of system truncation, buffer region, and dielectric constant</article-title>. <source>J. Chem. Inf. modeling</source> <volume>52</volume>, <fpage>2079</fpage>&#x2013;<lpage>2088</lpage>. doi: <pub-id pub-id-type="doi">10.1021/ci3001919</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gordon</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Myers</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Folta</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Shoja</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Heath</surname> <given-names>L. S.</given-names>
</name>
<name>
<surname>Onufriev</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>H++: a server for estimating pKas and adding missing hydrogens to macromolecules</article-title>. <source>Nucleic Acids Res.</source> <volume>33</volume>, <fpage>368</fpage>&#x2013;<lpage>371</lpage>. doi: <pub-id pub-id-type="doi">10.1093/nar/gki464</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hussain</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Mant</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Seale</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Zeeman</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Hinchliffe</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Edwards</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Three isoforms of isoamylase contribute different catalytic properties for the debranching of potato glucans</article-title>. <source>Plant Cell</source> <volume>15</volume>, <fpage>133</fpage>&#x2013;<lpage>149</lpage>. doi: <pub-id pub-id-type="doi">10.1105/tpc.006635</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ishizaki</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Taniguchi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Maruyama</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>1983</year>). <article-title>Debranching enzymes of potato tubers (Solanum tuberosum l.) II. purification of a pullulanase (R-enzyme) from potato tubers and comparison of its properties with those of the potato isoamylase</article-title>. <source>J. Japanese Soc. Starch Sci.</source> <volume>30</volume>, <fpage>19</fpage>&#x2013;<lpage>29</lpage>. doi: <pub-id pub-id-type="doi">10.5458/jag1972.30.19</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Iwaki</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Fuwa</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>1981</year>). <article-title>Purification and some properties of debranching enzyme of germinating rice endosperm</article-title>. <source>Agricultural and Biological Chemistry</source> <volume>45</volume>(<issue>12</issue>), <fpage>2683</fpage>&#x2013;<lpage>2688</lpage>. doi: <pub-id pub-id-type="doi">10.1271/bbb1961.45.2683</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jorgensen</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Chandrasekhar</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Madura</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>1983</year>). <article-title>Lmpey, RW; Klein, ML</article-title>. <source>J. Chem. Phys.</source> <volume>79</volume>, <fpage>926</fpage>. doi: <pub-id pub-id-type="doi">10.1063/1.445869</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Klaewkla</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Charoenwongpaiboon</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Mahalapbutr</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Molecular basis of the new COVID-19 target neuropilin-1 in complex with SARS-CoV-2 S1 c-end rule peptide and small-molecule antagonists</article-title>. <source>J. Mol. Liquids</source> <volume>335</volume>, <fpage>116537</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.molliq.2021.116537</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Hasjim</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gilding</surname> <given-names>E. K.</given-names>
</name>
<name>
<surname>Godwin</surname> <given-names>I. D.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Gilbert</surname> <given-names>R. G.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The role of pullulanase in starch biosynthesis, structure, and thermal properties by studying sorghum with increased pullulanase activity</article-title>. <source>Starch-St&#xe4;rke</source> <volume>71</volume>, <fpage>1900072</fpage>. doi: <pub-id pub-id-type="doi">10.1002/star.201900072</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lindbo</surname> <given-names>J. A.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>High-efficiency protein expression in plants from agroinfection-compatible tobacco mosaic virusexpression vectors</article-title>. <source>BMC Biotechnol.</source> <volume>7</volume>, <fpage>1</fpage>&#x2013;<lpage>11</lpage>. doi: <pub-id pub-id-type="doi">10.1186/1472-6750-7-52</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>M&#xf8;ller</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Henriksen</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Svensson</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Structure and function of &#x3b1;-glucan debranching enzymes</article-title>. <source>Cell. Mol. Life Sci.</source> <volume>73</volume>, <fpage>2619</fpage>&#x2013;<lpage>2641</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00018-016-2241-y</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>M&#xf8;ller</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Windahl</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Sim</surname> <given-names>L.</given-names>
</name>
<name>
<surname>B&#xf8;jstrup</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Abou Hachem</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Hindsgaul</surname> <given-names>O.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Oligosaccharide and substrate binding in the starch debranching enzyme barley limit dextrinase</article-title>. <source>J. Mol. Biol.</source> <volume>427</volume>, <fpage>1263</fpage>&#x2013;<lpage>1277</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jmb.2014.12.019</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Machovi&#x10d;</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Jane&#x10d;ek</surname> <given-names>&#x160;.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Domain evolution in the GH13 pullulanase subfamily with focus on the carbohydrate-binding module family 48</article-title>. <source>Biologia</source> <volume>63</volume>, <fpage>1057</fpage>&#x2013;<lpage>1068</lpage>. doi: <pub-id pub-id-type="doi">10.2478/s11756-008-0162-4</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mcdougall</surname> <given-names>G. J.</given-names>
</name>
<name>
<surname>Ross</surname> <given-names>H. A.</given-names>
</name>
<name>
<surname>Swanston</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>Davies</surname> <given-names>H. V.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Limit dextrinase from germinating barley has endotransglycosylase activity, which explains its activation by maltodextrins</article-title>. <source>Planta</source> <volume>218</volume>, <fpage>542</fpage>&#x2013;<lpage>551</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00425-003-1141-1</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mikami</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Iwamoto</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Malle</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Yoon</surname> <given-names>H.-J.</given-names>
</name>
<name>
<surname>Demirkan-Sarikaya</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Mezaki</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2006</year>). <article-title>Crystal structure of pullulanase: evidence for parallel binding of oligosaccharides in the active site</article-title>. <source>J. Mol. Biol.</source> <volume>359</volume>, <fpage>690</fpage>&#x2013;<lpage>707</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jmb.2006.03.058</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miller</surname> <given-names>G. L.</given-names>
</name>
</person-group> (<year>1959</year>). <article-title>Use of dinitrosalicylic acid reagent for determination of reducing sugar</article-title>. <source>Analytical Chem.</source> <volume>31</volume>, <fpage>426</fpage>&#x2013;<lpage>428</lpage>. doi: <pub-id pub-id-type="doi">10.1021/ac60147a030</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Myers</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Grothaus</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Narayanan</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Onufriev</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>A simple clustering algorithm can be accurate enough for use in calculations of pKs in macromolecules</article-title>. <source>Proteins: Structure Function Bioinf.</source> <volume>63</volume>, <fpage>928</fpage>&#x2013;<lpage>938</lpage>. doi: <pub-id pub-id-type="doi">10.1002/prot.20922</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Myers</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Morell</surname> <given-names>M. K.</given-names>
</name>
<name>
<surname>James</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Ball</surname> <given-names>S. G.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Recent progress toward understanding biosynthesis of the amylopectin crystal</article-title>. <source>Plant Physiol.</source> <volume>122</volume>, <fpage>989</fpage>&#x2013;<lpage>998</lpage>. doi: <pub-id pub-id-type="doi">10.1104/pp.122.4.989</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakagawa</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Kurose</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hino</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Tanaka</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Kawamukai</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Niwa</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2007</year>). <article-title>Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation</article-title>. <source>J. bioscience bioengineering</source> <volume>104</volume>, <fpage>34</fpage>&#x2013;<lpage>41</lpage>. doi: <pub-id pub-id-type="doi">10.1263/jbb.104.34</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakamura</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Towards a better understanding of the metabolic system for amylopectin biosynthesis in plants: rice endosperm as a model tissue</article-title>. <source>Plant Cell Physiol.</source> <volume>43</volume>, <fpage>718</fpage>&#x2013;<lpage>725</lpage>. doi: <pub-id pub-id-type="doi">10.1093/pcp/pcf091</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Pandey</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shreshtha</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Sachan</surname> <given-names>S. G.</given-names>
</name>
</person-group> (<year>2021</year>). &#x201c;<article-title>Pullulan: Biosynthesis, production and applications</article-title>,&#x201d; in <source>Microbial exopolysaccharides as novel and significant biomaterials</source> (<publisher-loc>Cham, Switzerland</publisher-loc>: <publisher-name>Springer</publisher-name>), <fpage>121</fpage>&#x2013;<lpage>141</lpage>.</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Panpetch</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Field</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Limpaseni</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2018</year>a). <article-title>Cloning of the full-length isoamylase3 gene from cassava manihot esculenta crantz &#x2018;KU50&#x2019;and its heterologous expression in e. coli</article-title>. <source>Plant Physiol. Biochem.</source> <volume>132</volume>, <fpage>281</fpage>&#x2013;<lpage>286</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.plaphy.2018.09.010</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Panpetch</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Field</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Limpaseni</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2018</year>b). <article-title>Heterologous co-expression in e. coli of isoamylase genes from cassava manihot esculenta crantz &#x2018;KU50&#x2019;achieves enzyme-active heteromeric complex formation</article-title>. <source>Plant Mol. Biol.</source> <volume>96</volume>, <fpage>417</fpage>&#x2013;<lpage>427</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s11103-018-0707-z</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Panpetch</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Sirikantaramas</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Fruit ripening-associated leucylaminopeptidase with cysteinylglycine dipeptidase activity from durian suggests its involvement in glutathione recycling</article-title>. <source>BMC Plant Biol.</source> <volume>21</volume>, <fpage>1</fpage>&#x2013;<lpage>14</lpage>. doi: <pub-id pub-id-type="doi">10.1186/s12870-021-02845-6</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quan</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Circular polymerase extension cloning for high-throughput cloning of complex and combinatorial DNA libraries</article-title>. <source>Nat. Protoc.</source> <volume>6</volume>, <fpage>242</fpage>&#x2013;<lpage>251</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nprot.2010.181</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rahman</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>K. S.</given-names>
</name>
<name>
<surname>Jane</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Myers</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>James</surname> <given-names>M. G.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Characterization of SU1 isoamylase, a determinant of storage starch structure in maize</article-title>. <source>Plant Physiology</source> <volume>117</volume>(<issue>2</issue>), <fpage>425</fpage>&#x2013;<lpage>435</lpage>. doi: <pub-id pub-id-type="doi">10.1104/pp.117.2.425</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Renz</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Schikora</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Schmid</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Kossmann</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Beck</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>cDNA sequence and heterologous expression of monomeric spinach pullulanase: multiple isomeric forms arise from the same polypeptide</article-title>. <source>Biochem. J.</source> <volume>331</volume>, <fpage>937</fpage>&#x2013;<lpage>945</lpage>. doi: <pub-id pub-id-type="doi">10.1042/bj3310937</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roe</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Cheatham</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>PTRAJ and CPPTRAJ: Software for processing and analysis of molecular</article-title>. <source>Dynamics Trajectory Data</source> <volume>9</volume>, <page-range>3084&#x2013;3095</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/ct400341p</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stam</surname> <given-names>M. R.</given-names>
</name>
<name>
<surname>Danchin</surname> <given-names>E. G.</given-names>
</name>
<name>
<surname>Rancurel</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Coutinho</surname> <given-names>P. M.</given-names>
</name>
<name>
<surname>Henrissat</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Dividing the large glycoside hydrolase family 13 into subfamilies: towards improved functional annotations of &#x3b1;-amylase-related proteins</article-title>. <source>Protein Engineering Design Selection</source> <volume>19</volume>, <fpage>555</fpage>&#x2013;<lpage>562</lpage>. doi: <pub-id pub-id-type="doi">10.1093/protein/gzl044</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tantanarat</surname> <given-names>K.</given-names>
</name>
<name>
<surname>O&#x2019;neill</surname> <given-names>E. C.</given-names>
</name>
<name>
<surname>Rejzek</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Field</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Limpaseni</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Expression and characterization of 4-&#x3b1;-glucanotransferase genes from manihot esculenta crantz and arabidopsis thaliana and their use for the production of cycloamyloses</article-title>. <source>Process Biochem.</source> <volume>49</volume>, <fpage>84</fpage>&#x2013;<lpage>89</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.procbio.2013.10.009</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tappiban</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>D. R.</given-names>
</name>
<name>
<surname>Triwitayakorn</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Bao</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Recent understanding of starch biosynthesis in cassava for quality improvement: A review</article-title>. <source>Trends Food Sci. Technol.</source> <volume>83</volume>, <fpage>167</fpage>&#x2013;<lpage>180</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.tifs.2018.11.019</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vester-Christensen</surname> <given-names>M. B.</given-names>
</name>
<name>
<surname>Abou Hachem</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Naested</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Svensson</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2010</year>a). <article-title>Secretory expression of functional barley limit dextrinase by pichia pastoris using high cell-density fermentation</article-title>. <source>Protein Expression purification</source> <volume>69</volume>, <fpage>112</fpage>&#x2013;<lpage>119</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.pep.2009.08.016</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vester-Christensen</surname> <given-names>M. B.</given-names>
</name>
<name>
<surname>Abou Hachem</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Svensson</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Henriksen</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2010</year>b). <article-title>Crystal structure of an essential enzyme in seed starch degradation: barley limit dextrinase in complex with cyclodextrins</article-title>. <source>J. Mol. Biol.</source> <volume>403</volume>, <fpage>739</fpage>&#x2013;<lpage>750</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jmb.2010.09.031</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Waksmundzka-Hajnos</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sherma</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kowalska</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2008</year>). <source>Thin layer chromatography in phytochemistry</source> (<publisher-loc>Boca Raton, Florida</publisher-loc>: <publisher-name>CRC Press</publisher-name>).</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wangpaiboon</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Klaewkla</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Charoenwongpaiboon</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Vongkusolkit</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Panpetch</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Kuttiyawong</surname> <given-names>K.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Synergistic enzyme cocktail between levansucrase and inulosucrase for superb levan-type fructooligosaccharide synthesis</article-title>. <source>Enzyme Microbial Technol.</source> <volume>154</volume>, <fpage>109960</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.enzmictec.2021.109960</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wangpaiboon</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Laohawuttichai</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>S.-Y.</given-names>
</name>
<name>
<surname>Mori</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Nakapong</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Pichyangkura</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>A GH13 &#x3b1;-glucosidase from weissella cibaria uncommonly acts on short-chain maltooligosaccharides</article-title>. <source>Acta Crystallographica Section D: Struct. Biol.</source> <volume>77</volume>, <fpage>1064</fpage>&#x2013;<lpage>1076</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1107/S205979832100677X</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wattebled</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Dumez</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Delvall&#xe9;</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Planchot</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Berbezy</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Mutants of arabidopsis lacking a chloroplastic isoamylase accumulate phytoglycogen and an abnormal form of amylopectin</article-title>. <source>Plant Physiol.</source> <volume>138</volume>, <fpage>184</fpage>&#x2013;<lpage>195</lpage>. doi: <pub-id pub-id-type="doi">10.1104/pp.105.059295</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wong</surname> <given-names>K.-S.</given-names>
</name>
<name>
<surname>Kubo</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Jane</surname> <given-names>J.-L.</given-names>
</name>
<name>
<surname>Harada</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Satoh</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Structures and properties of amylopectin and phytoglycogen in the endosperm of sugary-1 mutants of rice</article-title>. <source>J. Cereal Sci.</source> <volume>37</volume>, <fpage>139</fpage>&#x2013;<lpage>149</lpage>. doi: <pub-id pub-id-type="doi">10.1006/jcrs.2002.0485</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamasaki</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Nakashima</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Konno</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Pullulanase from rice endosperm</article-title>. <source>Acta Biochim. Polonica</source> <volume>55</volume>, <fpage>507</fpage>&#x2013;<lpage>510</lpage>. doi: <pub-id pub-id-type="doi">10.18388/abp.2008_3056</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zeeman</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Kossmann</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>A. M.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Starch: its metabolism, evolution, and biotechnological modification in plants</article-title>. <source>Annu. Rev. Plant Biol.</source> <volume>61</volume>, <fpage>209</fpage>&#x2013;<lpage>234</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev-arplant-042809-112301</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>