<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title>Frontiers in Plant Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Plant Sci.</abbrev-journal-title>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fpls.2023.1096239</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A molecular beacon real-time polymerase chain reaction assay for the identification of <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Anderson</surname>
<given-names>Scott D.</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/2118423"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Gleason</surname>
<given-names>Cynthia A.</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/98446"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Department of Plant Pathology, Washington State University</institution>, <addr-line>Pullman, WA</addr-line>, <country>United States</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Brent Sipes, University of Hawaii at Manoa, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Tariq Mukhtar, Pir Mehr Ali Shah Arid Agriculture University, Pakistan; Lee Robertson, National Institute of Agricultural and Food Research and Technology, Spain</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Cynthia A. Gleason, <email xlink:href="mailto:cynthia.gleason@wsu.edu">cynthia.gleason@wsu.edu</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Plant Pathogen Interactions, a section of the journal Frontiers in Plant Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>22</day>
<month>02</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1096239</elocation-id>
<history>
<date date-type="received">
<day>11</day>
<month>11</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>31</day>
<month>01</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Anderson and Gleason</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Anderson and Gleason</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Root-knot nematodes (<italic>Meloidogyne</italic> spp.) are major pests of many important crops around the world. In the Northwestern region of the United States of America (USA), <italic>Meloidogyne chitwoodi</italic> causes economic losses in potatoes because the nematodes can infect the tubers, which leads to potato galling and reductions in marketable yield. <italic>Meloidogyne chitwoodi</italic> is a quarantine pathogen in certain potato export markets, and there is little industry tolerance for the presence&#xa0;of this nematode. Recently, two <italic>Meloidogyne</italic> species that are not known to be present in agricultural fields in the USA were detected on golf turfgrasses in California and Washington. These species, <italic>M. fallax</italic> and <italic>M. minor</italic>, are morphologically similar to <italic>M. chitwoodi</italic> and can infect potatoes and cause tuber damage. Their detection in the USA means that they could potentially infest potato fields and become a problem in potato production. Additionally, <italic>M. fallax</italic> is a regulated plant pest in the USA, which makes the correct identification of potato-infecting root-knot nematodes important. Previously, there was no single-tube assay that could determine whether <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and/or <italic>M. minor</italic> were present in a sample. Thus, a molecular beacon real-time PCR assay which can reliably detect <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, or <italic>M. minor</italic> from crude nematode extracts was designed and characterized.</p>
</abstract>
<kwd-group>
<kwd>meloidogyne</kwd>
<kwd>nematode</kwd>
<kwd>diagnostic tool</kwd>
<kwd>RT-PCR</kwd>
<kwd>potato</kwd>
<kwd>pathogen detection</kwd>
</kwd-group>
<contract-sponsor id="cn001">Animal and Plant Health Inspection Service<named-content content-type="fundref-id">10.13039/100009168</named-content>
</contract-sponsor>
<counts>
<fig-count count="6"/>
<table-count count="3"/>
<equation-count count="1"/>
<ref-count count="61"/>
<page-count count="13"/>
<word-count count="5934"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Root-knot nematodes are obligate sedentary endoparasites of many important agricultural crops, causing upwards of $180 billion in global crop losses annually (<xref ref-type="bibr" rid="B37">Sasser and Freckman, 1987</xref>; <xref ref-type="bibr" rid="B24">Koenning et&#xa0;al., 1999</xref>). Root-knot nematodes are especially problematic in potato because the nematodes cause tuber galling and internal tuber defects (<xref ref-type="bibr" rid="B25">Lima et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B2">Bali et&#xa0;al., 2021a</xref>). In 2019, the United States had the 5th highest production of potatoes (<xref ref-type="bibr" rid="B11">FAO, 2017</xref>), with three states, Oregon, Washington, and Idaho, comprising over half of the country&#x2019;s entire production (<xref ref-type="bibr" rid="B55">Zasada et&#xa0;al., 2018</xref>). These states have the root-knot nematodes <italic>M. chitwoodi</italic> and <italic>M. hapla</italic>. However, <italic>M. chitwoodi</italic> is a larger threat in potato production because it hatches at lower temperatures, which allows its populations to expand rapidly in a single growing season. <italic>Meloidogyne chitwoodi</italic> also causes more visible galling on potatoes compared to <italic>M. hapla</italic> (<xref ref-type="bibr" rid="B33">Pinkerton et&#xa0;al., 1991</xref>; <xref ref-type="bibr" rid="B20">Ingham et&#xa0;al., 2000</xref>). The galling causes the tuber surface to look bumpy, and necrotic dark spots form in the tuber flesh around the <italic>M. chitwoodi</italic> females. These visual defects can significantly decrease the potato market value due to the near zero tolerance to tuber blemishes in the processing market. Although <italic>M. chitwoodi</italic> is endemic to the western region of the United States, its regulated status means there is a zero- tolerance policy in potatoes destined for export to several world markets (<xref ref-type="bibr" rid="B19">Ingham et&#xa0;al., 2007</xref>). There is currently no genetic resistance against root-knot nematodes in commercial potato cultivars.</p>
    <p>In Europe, root-knot nematodes that are commonly found in cooler climates include <italic>M. hapla, M. naasi, M. chitwoodi</italic> and <italic>M. fallax</italic> (<xref ref-type="bibr" rid="B52">Wesemael et&#xa0;al., 2011</xref>), and both <italic>M. chitwoodi</italic> and <italic>M. fallax</italic> are root-knot nematode species on the A2 EPPO alert list (<xref ref-type="bibr" rid="B52">Wesemael et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B46">Viaene, 2014</xref>; <xref ref-type="bibr" rid="B10">European and Mediterranean Plant Protection Organization [EPPO], 2022</xref>). <italic>Meloidogyne fallax</italic> was originally identified as <italic>M. chitwoodi</italic>, but subsequent morphological and biochemical investigations revealed that it was a distinct species (<xref ref-type="bibr" rid="B22">Karssen, 1996</xref>). <italic>Meloidogyne fallax</italic> and <italic>M. chitwoodi</italic> are difficult to distinguish morphologically. They also have some of the same hosts, such as potatoes and carrots, but they differ in their ability to infect some crops, such as corn (<xref ref-type="bibr" rid="B22">Karssen, 1996</xref>). Both <italic>M. chitwoodi</italic> and <italic>M. fallax</italic> can cause significant damage to potato tubers, and some data indicate that <italic>M. fallax</italic> is more aggressive on potato than <italic>M. chitwoodi</italic> (<xref ref-type="bibr" rid="B44">Van Meggelen et&#xa0;al., 1994</xref>; <xref ref-type="bibr" rid="B42">Van Der Beek et&#xa0;al., 1998</xref>; <xref ref-type="bibr" rid="B39">Suffert and Giltrap, 2012</xref>). Although <italic>M. fallax</italic> has not been reported on potato in the USA, it was detected during a survey of golf course greens in California (<xref ref-type="bibr" rid="B30">Nischwitz et&#xa0;al., 2013</xref>). Follow up surveys by APHIS in California did not detect <italic>M. fallax</italic>, so it is considered &#x201c;not present&#x201d; in the USA (<xref ref-type="bibr" rid="B21">Kantor et&#xa0;al., 2022</xref>), but there remains a threat of introduction.</p>
<p>In 2000&#xa0;a new species of root-knot nematode called <italic>M. minor</italic> was found on heavily infected potato plants from a potato field in Zeijerveld, The Netherlands (<xref ref-type="bibr" rid="B23">Karssen et&#xa0;al., 2004</xref>). The potato tubers exhibited pimple-like galling similar to the symptoms caused by <italic>M. chitwoodi</italic> and <italic>M. fallax</italic>. <italic>Meloidogyne minor</italic> was subsequently found on golf courses in the Netherlands, Belgium, United Kingdom, and Ireland (<xref ref-type="bibr" rid="B45">Vandenbossche et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B29">Morris et&#xa0;al., 2013</xref>). Interestingly, <italic>M. minor</italic> infections did not significantly impact tuber yield or quality in two potato cultivars (cvs Ast&#xe9;rix and Markies) in field plots in the Netherlands (<xref ref-type="bibr" rid="B41">Thoden et&#xa0;al., 2012</xref>). However, significant tuber damage was inflicted by <italic>M. minor</italic> on potatoes grown in greenhouses (<xref ref-type="bibr" rid="B41">Thoden et&#xa0;al., 2012</xref>), indicating that <italic>M. minor</italic> biology and pathogenicity at relatively warmer temperatures, such as those in greenhouses, are not fully understood. There is also limited information about <italic>M. minor</italic> infectivity on potato cultivars commonly used in the USA, such as the Russets. Recently <italic>M. minor</italic> was reported on turf grass in the USA (<xref ref-type="bibr" rid="B27">McClure et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B30">Nischwitz et&#xa0;al., 2013</xref>). It is possible that this nematode could be accidentally transmitted from golf courses to arable land <italic>via</italic> contaminated sports shoes or equipment (<xref ref-type="bibr" rid="B28">Morris et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B29">Morris et&#xa0;al., 2013</xref>). With the potential for <italic>M. minor</italic> to spread and cause damage to potatoes, it is prudent to monitor for <italic>M. minor</italic> to help mitigate the risk it poses to USA agriculture.</p>
<p>To ensure proper monitoring of these <italic>Meloidogyne</italic> species, a rapid and reliable molecular test to identify these three species is necessary. Many molecular techniques have been established for identifying <italic>Meloidogyne</italic> species (<xref ref-type="bibr" rid="B4">Baum et&#xa0;al., 1994</xref>; <xref ref-type="bibr" rid="B47">Vrain and Petersen, 1996</xref>; <xref ref-type="bibr" rid="B5">Blok et&#xa0;al., 1997</xref>; <xref ref-type="bibr" rid="B32">Petersen et&#xa0;al., 1997</xref>; <xref ref-type="bibr" rid="B54">Williamson et&#xa0;al., 1997</xref>; <xref ref-type="bibr" rid="B58">Zijlstra, 1997</xref>; <xref ref-type="bibr" rid="B9">Castagnone-Sereno et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B8">Castagnone-Sereno, 2000</xref>; <xref ref-type="bibr" rid="B56">Zeng et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B57">Zhang and Gleason, 2019</xref>). These molecular techniques were often based on PCR using species specific primers that target the mitochondrial DNA, or they target the intergenic region or the internal transcribed spacer (ITS) regions of the ribosomal DNA (<xref ref-type="bibr" rid="B14">Giorgi et&#xa0;al., 1994</xref>; <xref ref-type="bibr" rid="B16">Hadziavdic et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B18">Harris et&#xa0;al., 1990</xref>; <xref ref-type="bibr" rid="B43">Van Megen et&#xa0;al., 2009</xref>). The technique called PCR-RFLP, which is PCR followed by restriction digestion of the amplicons to create unique restriction fragment lengths, can be used to identify several <italic>Meloidogyne</italic> species (<xref ref-type="bibr" rid="B18">Harris et&#xa0;al., 1990</xref>; <xref ref-type="bibr" rid="B48">Vrain et&#xa0;al., 1992</xref>; <xref ref-type="bibr" rid="B34">Powers and Harris, 1993</xref>; <xref ref-type="bibr" rid="B61">Zijlstra et&#xa0;al., 1995</xref>; <xref ref-type="bibr" rid="B35">Powers et&#xa0;al., 1997</xref>; <xref ref-type="bibr" rid="B31">Orui, 1998</xref>; <xref ref-type="bibr" rid="B49">Waeyenberge et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B17">Han et&#xa0;al., 2004</xref>; <xref ref-type="bibr" rid="B13">Gamel et&#xa0;al., 2014</xref>). The technique was found to be sensitive enough to detect a single juvenile of <italic>M. fallax</italic> or <italic>M. chitwoodi</italic>, but PCR-RFLP results can be difficult to interpret when there are mixtures of species in the reaction (<xref ref-type="bibr" rid="B13">Gamel et&#xa0;al., 2014</xref>). <xref ref-type="bibr" rid="B59">Zijlstra (2000)</xref> showed that primers designed to amplify sequence-characterized amplified regions (SCARs) could be used in SCAR-PCR to identify <italic>M. hapla</italic>, <italic>M. chitwoodi</italic> and <italic>M. fallax</italic>. The drawback to the SCAR-PCR is that it is not as sensitive as PCR-RFLP, and it requires at least two juveniles of <italic>M. chitwoodi</italic> or one juvenile of <italic>M. fallax</italic> as template (<xref ref-type="bibr" rid="B59">Zijlstra, 2000</xref>). Moreover, the previously designed SCAR-PCR primers for <italic>M. fallax</italic> were shown to cross-react with <italic>M. minor</italic> allowing for false-positives (<xref ref-type="bibr" rid="B30">Nischwitz et&#xa0;al., 2013</xref>). A multiplex real-time PCR (TaqMan) using primers designed for the ITS region was developed for the simultaneous detection of <italic>M. chitwoodi</italic> and <italic>M. fallax</italic> (<xref ref-type="bibr" rid="B60">Zijlstra and Van Hoof, 2006</xref>). The TaqMan PCR was a breakthrough in root-knot nematode identification in multiplexed reactions, but it did not include a third nematode of interest, <italic>M. minor</italic> (<xref ref-type="bibr" rid="B60">Zijlstra and Van Hoof, 2006</xref>; <xref ref-type="bibr" rid="B51">Wesemael et&#xa0;al., 2014</xref>).</p>
<p>There are no molecular techniques that can identify and distinguish <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> in a one tube assay. With this in mind, we have developed a new RT-PCR assay using molecular beacons to identify and distinguish <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> in a single reaction. This assay can be used by regulatory agencies and diagnosticians to monitor for the presence of these potato-infecting nematodes, two of which are of regulatory importance, using as little as a single juvenile isolated from samples.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>
<italic>In silico</italic> design of primers and beacons</title>
<p>Primers and beacons were designed using Beacon Designer 8 (Premier Biosoft, Palo Alto, CA). Alignments of <italic>HSP90</italic> gene sequences (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) were used to find universally conserved primer sequences surrounding polymorphic regions in <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> (<xref ref-type="bibr" rid="B38">Skantar and Carta, 2004</xref>). To ensure the beacon probes and primers were specific to their target organisms, the sequences were queried using the BLASTn search program and the non-redundant database (National Center for Biotechnology Information, NCBI). Primers and the beacons for the <italic>HSP90</italic> region were synthesized by Sigma-Aldrich (St. Louis, Mo) and are described in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. The <italic>M. chitwoodi</italic> beacon has 6-FAM, <italic>M. fallax</italic> beacon has HEX, and <italic>M. minor</italic> beacon has Cyan-5 as the reporters. For the quenchers, the Black Hole Quencher (BHQ-1 for 6-FAM and HEX, and BHQ- 3 for Cyan-5) was used.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>
<italic>Meloidogyne</italic> spp. <italic>HSP90</italic> regions used for beacon designs.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Species</th>
<th valign="top" align="center">Genebank ID</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="5" align="left"><italic>M. chitwoodi</italic></td>
<td valign="top" align="center">KC262220.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262221.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262222.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262223.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262224.1</td>
</tr>
<tr>
<td valign="top" rowspan="6" align="left"><italic>M. fallax</italic></td>
<td valign="top" align="center">KC262225.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262226.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262227.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262228.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262229.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262233.1</td>
</tr>
<tr>
<td valign="top" rowspan="13" align="left"><italic>M. minor</italic></td>
<td valign="top" align="center">KC262234.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262235.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262236.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262237.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262238.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262239.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262240.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262241.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262242.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262243.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262244.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262245.1</td>
</tr>
<tr>
<td valign="top" align="center">KC262246.1</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Primers and beacon probes used in the molecular beacon RT-PCR assays.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Name</th>
<th valign="top" align="center">Fluorophore</th>
<th valign="top" align="center">Sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Mc-complementary</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">AGGATGCAAGATTTAAGGCAAT</td>
</tr>
<tr>
<td valign="top" align="left">Mf-complementary</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">GTTGTGATAAGTAGAAGGCAAGA</td>
</tr>
<tr>
<td valign="top" align="left">Mm-complementary</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">AATTGACCCTCAACGCTC</td>
</tr>
<tr>
<td valign="top" align="left">&#x2003;Mc-SNP</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">TAGGATGCAAG<bold>T</bold>TTTAAGGCAAT</td>
</tr>
<tr>
<td valign="top" align="left">&#x2003;Mf-SNP</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">GTTGTGATAAGT<bold>T</bold>GAAGGCAAGA</td>
</tr>
<tr>
<td valign="top" align="left">&#x2003;Mm-SNP</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">AATTGACC<bold>T</bold>TCAACGCTC</td>
</tr>
<tr>
<td valign="top" align="left">&#x2003;F-HSP90</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">AGCTTGTCTAATGATTGG</td>
</tr>
<tr>
<td valign="top" align="left">&#x2003;R-HSP90</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">GGAACAAACAAAAGAGCT</td>
</tr>
<tr>
<td valign="top" align="left">C1-HSP90-FAM-6</td>
<td valign="top" align="center">FAM</td>
<td valign="top" align="center">GCGATCTAGGATGCAAGATTTAAGGCAATGATCGO</td>
</tr>
<tr>
<td valign="top" align="left">F1-HSP90-HEX-5</td>
<td valign="top" align="center">HEX</td>
<td valign="top" align="center">CGATCGTTGTGATAAGTAGAAGGCAAGAGATCG</td>
</tr>
<tr>
<td valign="top" align="left">M2-HSP90-Cyan-5</td>
<td valign="top" align="center">Cyan5</td>
<td valign="top" align="center">CGATAATTGACCCTCAACGCTCATCG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_2">
<title>Thermal denaturation curves</title>
<p>Three synthetic oligos complementary to each beacon&#x2019;s loop sequence and three off-target synthetic oligos containing a single nucleotide difference to the loop sequence were synthesized by Sigma-Aldrich (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>) and used for creating thermal denaturation curves. For each beacon, two 50 &#xb5;L reactions containing 200 nM molecular beacon probe in 3 mM MgCl2 and 10 mM Tris- HCl, pH = 8.0 were prepared with 600 nM of either the complementary or off-target synthetic oligo. A third reaction for each beacon was run containing Milli-Q water in place of the synthetic oligo as a control. Reactions were prepared in a 96-well clear qPCR plate and run on a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA) starting at 80&#xb0;C and decreasing to 30&#xb0;C at a rate of 1&#xb0;C/minute, with fluorescence measured every minute.</p>
</sec>
<sec id="s2_3">
<title>Nematode templates for PCR</title>
<p>For genomic DNA templates, the DNA was extracted from <italic>M. chitwoodi</italic> (Race 1, Race 2, and Roza) (<xref ref-type="bibr" rid="B3">Bali et&#xa0;al., 2021b</xref>; <xref ref-type="bibr" rid="B26">Mojtahedi et&#xa0;al., 2007</xref>), <italic>M. incognita, M. javanica, M. arenaria</italic>, and <italic>M. hapla</italic> eggs using a phenol/chloroform extraction protocol as described by <xref ref-type="bibr" rid="B15">Gross and Williamson (2011)</xref>. All three <italic>M. chitwoodi</italic> isolates (Race 1, Race 2, and Race 1 Roza) were originally provided by Dr. Charles Brown (USDA-ARS). The <italic>M. hapla</italic> isolate VW9, <italic>M. incognita</italic> isolate VW6, <italic>M. javanica</italic> isolate VW4, and <italic>M. arenaria</italic> isolate HarA were provided by Dr. Valerie Williamson (<xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>, UC-Davis). All <italic>Meloidogyne</italic> species were maintained on the susceptible tomato <italic>Solanum lycopersicum</italic> cv. Rutgers under greenhouse conditions. The identities of the <italic>M. chitwoodi, M. hapla</italic>, <italic>M. incognita</italic>, <italic>M. javanica</italic> and <italic>M. arenaria</italic> populations were confirmed using species-specific PCR (<xref ref-type="bibr" rid="B34">Powers and Harris, 1993</xref>; <xref ref-type="bibr" rid="B59">Zijlstra, 2000</xref>; <xref ref-type="bibr" rid="B53">Wishart et&#xa0;al., 2002</xref>).</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>
<italic>Meloidogyne</italic> spp. used for testing molecular beacon RT-PCR specificity.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Species</th>
<th valign="top" align="center">Race/Strain</th>
<th valign="top" align="center">Source</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>M. chitwoodi</italic>
</td>
<td valign="top" align="center">Race 1</td>
<td valign="top" align="center">WA, USA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. chitwoodi</italic>
</td>
<td valign="top" align="center">Race 2</td>
<td valign="top" align="center">WA, USA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. chitwoodi</italic>
</td>
<td valign="top" align="center">Roza</td>
<td valign="top" align="center">WA, USA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. fallax</italic>
</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">Netherlands</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. minor</italic>
</td>
<td valign="top" align="center">&#x2013;</td>
<td valign="top" align="center">Netherlands</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. hapla</italic>
</td>
<td valign="top" align="center">VW9</td>
<td valign="top" align="center">CA, USA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. incognita</italic>
</td>
<td valign="top" align="center">VW6</td>
<td valign="top" align="center">CA, USA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. javanica</italic>
</td>
<td valign="top" align="center">VW4</td>
<td valign="top" align="center">CA, USA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. arenaria</italic>
</td>
<td valign="top" align="center">EC2</td>
<td valign="top" align="center">CA, USA</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>To amplify and clone the <italic>HSP90</italic> amplicon from <italic>M. chitwoodi</italic> race 1, <italic>M. fallax</italic> and <italic>M. minor</italic>, F- HSP90 and R-HSP90 primers were used in a PCR with approximately 15 ng of <italic>M. chitwoodi, M. fallax</italic>, or <italic>M. minor</italic> DNA. Reactions were 50 &#xb5;L total volume and contained 1x AmpliTaq Gold 360 buffer, 3 mM MgCl2, 200 &#xb5;M dNTPs, 200 nM F-HSP90 and R-HSP90 primers, and 1.25 U of AmpliTaq Gold. The reactions were run on an Eppendorf Mastercycler Pro Thermal Cycler as follows: 94&#xb0;C for 10 minutes, then 30 cycles of 94&#xb0;C for 15 seconds, then 58&#xb0;C for 30 seconds, and 72&#xb0;C for 30 seconds, and then finally 72&#xb0;C for 5 minutes. Reactions were pooled and cleaned up using a ThermoFisher GeneJET PCR purification kit (Thermo Fisher, Waltham, MA) and the purified PCR products were ligated into pGEM-T vector. The 10 &#xb5;L ligation reaction contained 1x Rapid Ligation buffer, 3 Weiss Units of T4 ligase, purified PCR product, pGEM-T vector (Promega, Madison, WI), and Milli-Q water. Plasmids were cloned into TOP10 <italic>E. coli</italic> and extracted from the overnight bacterial cultures using a GenElute Plasmid Miniprep kit (Sigma-Aldrich, St. Louis, MO). The <italic>HSP90</italic> amplicons from <italic>M. chitwoodi, M. minor</italic>, and <italic>M. fallax</italic> in the pGEM-T vector will be referred to as plasmid <italic>HSP90.</italic>
</p>
</sec>
<sec id="s2_4">
<title>Optimizing the reactions</title>
<p>A standard curve using <italic>M. chitwoodi</italic> gDNA as template was prepared using 1:10 serial dilutions. Reactions were run at a volume of 50 &#xb5;L on a CFX96 Real-Time PCR Detection System in a 96-well clear qPCR plate. Reaction mixes contained 1x AmpliTaq Gold 360 buffer, 3 mM MgCl2, 200 &#xb5;M dNTPs, 200 nM F-HSP90 and R-HSP90 primers, 200 nM target beacon (C1-Hsp90-FAM-6) and 1.25 U of AmpliTaq Gold. The cycling conditions were as follows: 95&#xb0;C for 10 minutes, then 55 cycles of 95&#xb0;C for 15 seconds (sec), 54&#xb0;C for 30 sec, and 72&#xb0;C for 15 sec. The increase in fluorescent signal was registered during the annealing step of the reaction. The <italic>M. chitwoodi</italic> standard curve used 5 points, with template DNA concentrations ranging from 40 ng to 4 pg. Additional standard curves were made for <italic>M. chitwoodi, M. fallax</italic> (F1-Hsp90-HEX-5 beacon), and <italic>M. minor</italic> (M2-Hsp90-Cyan-5 beacon) using the same reaction conditions, but in which the plasmid <italic>HSP90</italic> templates for the reactions were serial dilutions of 0.4 ng &#x2013; 4 fg, 2 ng &#x2013; 2 fg, and 0.4 ng &#x2013; 0.04 fg respectively. Each concentration was run in triplicate. Non-template controls containing only water were included for all standard curves, and each curve was repeated with similar results. To calculate the PCR efficiency, the following equation was used</p>
<disp-formula>
<mml:math display="block" id="M1">
<mml:mrow>
<mml:mtext>PCR&#xa0;efficiency&#xa0;</mml:mtext>
<mml:mo>%</mml:mo>
<mml:mtext>&#xa0;</mml:mtext>
<mml:mo>=</mml:mo>
<mml:mtext>&#xa0;</mml:mtext>
<mml:mo stretchy="false">(</mml:mo>
<mml:mn>10</mml:mn>
<mml:mfrac>
<mml:mn>1</mml:mn>
<mml:mrow>
<mml:mover accent="true">
<mml:mi>s</mml:mi>
<mml:mo>&#xaf;</mml:mo>
</mml:mover>
<mml:mi>l</mml:mi>
<mml:mi>o</mml:mi>
<mml:mi>p</mml:mi>
<mml:mi>e</mml:mi>
</mml:mrow>
</mml:mfrac>
<mml:mtext>&#xa0;</mml:mtext>
<mml:mo>-</mml:mo>
<mml:mtext>&#xa0;</mml:mtext>
<mml:mn>1</mml:mn>
<mml:mo stretchy="false">)</mml:mo>
<mml:mo>&#x2217;</mml:mo>
<mml:mn>100</mml:mn>
</mml:mrow>
</mml:math>
</disp-formula>
</sec>
<sec id="s2_5">
<title>Molecular beacon RT-PCR</title>
<p>The second stage juveniles (J2s) of <italic>M. chitwoodi</italic> race 1 were hatched from eggs collected from Rutgers tomatoes grown in greenhouses at Washington State University. <italic>Meloidogyne fallax</italic> and <italic>M. minor</italic> J2s were provided by the Wageningen Nematode Collection (National Plant Protection Organization, the Netherlands) and stored in DESS at -20&#xb0;C. Second stage juveniles were digested using the protocol described in <xref ref-type="bibr" rid="B36">Qiu et&#xa0;al. (2006)</xref>. In brief, J2s were picked under a dissecting scope and transferred to 15 &#xb5;L droplets of Milli-Q water. The nematodes were crushed using a pipet tip; 10 &#xb5;L of the crushed nematode was transferred to a 10 &#xb5;L solution containing 2 &#xb5;L AmpliTaq Gold 360 buffer, 2 uL of 600 &#xb5;g/mL Proteinase K, and 6 &#xb5;L Milli-Q water. The reaction mixes were incubated at -20&#xb0;C for 20 minutes, heated for 1 hour at 65&#xb0;C, and then 95&#xb0;C for 10&#xa0;min before cooling to room temperature. The nematode samples were spun at 12,000 rpm for 2&#xa0;min before storing at -20&#xb0;C until used in PCR. Five &#xb5;L of these J2 samples were used as template for molecular beacon RT-PCR, and each sample was run in duplicate or triplicate. The 50 &#xb5;L reaction mixes contained 1x AmpliTaq Gold 360 buffer, 3 mM MgCl2, 200 &#xb5;M dNTPs, 200 nM F-HSP90 and R-HSP90 primers, 200 nM target beacon (C1-Hsp90-FAM-6, F1-Hsp90-HEX-5, or M2-Hsp90-Cyan-5) and 1.25 U of AmpliTaq Gold. The reaction conditions were the same as those used for the standard curves. All molecular beacon RT-PCR assays with these three species were repeated at least twice with similar results.</p>
<p>To ensure the specificity of this assay 40 ng of gDNA from <italic>M. incognita</italic>, <italic>M. javanica</italic>, <italic>M. arenaria</italic>, or <italic>M. hapla</italic> was used as template for molecular beacon RT-PCR assay using C1-Hsp90-FAM-6, F1-Hsp90-HEX-5, and M2-Hsp90-Cyan-5 beacons. Non-template controls containing only Milli- Q water were included as well as positive controls using 4 pg of plasmid <italic>HSP90</italic> for <italic>M. chitwoodi</italic>,</p>
<p>
<italic>M. fallax</italic>, or <italic>M. minor</italic>. The 50 &#xb5;L reaction mixes contained 1x AmpliTaq Gold 360 buffer, 3 mM MgCl2, 200 &#xb5;M dNTPs, 200 nM F-HSP90 and R-HSP90 primers, 200 nM target beacon (C1- Hsp90-FAM-6, F1-Hsp90-HEX-5, or M2-Hsp90-Cyan-5) and 1.25 U of AmpliTaq Gold. The reaction conditions were the same as those used for the standard curves. The molecular beacon RT-PCR assays with non-target species were repeated twice with similar results.</p>
<p>All PCR products in this paper were visualized as follows: 10 &#xb5;L of each PCR product was loaded onto a 1.5% agarose gel and separated for 45&#xa0;min at 100&#xa0;V before visualizing with ethidium bromide under UV light. The Invitrogen 1-kb plus DNA ladder was used as reference for size.</p>
</sec>
<sec id="s2_6">
<title>Multiplex molecular beacon RT-PCR</title>
<p>Initial multiplex molecular beacon RT-PCR assays were performed using equal template concentrations of each species. Each reaction tube contained the same amount of <italic>M. chitwoodi, M. minor</italic> and <italic>M. fallax</italic> template <italic>HSP90</italic> plasmid DNA (20 pg of each species). To the template DNAs, the reaction mix was added. The reaction mix contained 1x AmpliTaq Gold 360 buffer, 3 mM MgCl2, 200 &#xb5;M dNTPs, 200 nM F-HSP90 and R-HSP90 primers, 200 nM of each of the three target beacons (C1-Hsp90-FAM-6, F1-Hsp90-HEX-5, and M2-Hsp90-Cyan-5) and 1.25 U of AmpliTaq Gold polymerase. The amount of fluorescence for each reaction at different template concentrations with the three different probes was measured at each cycle on the CFX96 Real- Time PCR Detection System.</p>
<p>Varying ratios of plasmid <italic>HSP90</italic> templates were used to test the validity of multiplexing. One template was kept at 20 pg while the other two were loaded ten times more concentrated at 200 pg each. Reaction mixes contained 1x AmpliTaq Gold 360 buffer, 3 mM MgCl2, 200 &#xb5;M dNTPs, 200 nM F-HSP90 and R-HSP90 primers, 200 nM of each beacon (C1-Hsp90-FAM-6, F1-Hsp90-HEX-5, M2-Hsp90-Cyan-5) and 1.25 U of AmpliTaq Gold. The reaction conditions were the same as those used for the standard curves.</p>
<p>Multiplex with proteinase K digested J2s were tested with 1 J2 or 5 J2 of each species present in the reaction mix. A single J2 from <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> were picked under a dissecting microscope and placed into a single 15 &#xb5;L droplet of Milli-Q water and digested as described above and used as template for qPCR. Similarly, for the 5 J2 multiplexing, 5 J2s from <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> were picked under a dissecting microscope and placed into a single 15 &#xb5;L droplet of Milli-Q water and digested and used as template for qPCR. Reaction mixes contained 1x AmpliTaq Gold 360 buffer, 3 mM MgCl2, 200 &#xb5;M dNTPs, 200 nM F-HSP90 and R-HSP90 primers, 200 nM of each beacon (C1-Hsp90-FAM-6, F1-Hsp90-HEX-5, M2- Hsp90-Cyan-5) and 1.25 U of AmpliTaq Gold. The reaction conditions were the same as those used for the standard curves.</p>
<p>All molecular beacon RT-PCR multiplex samples were run in duplicate, or triplicate and the assays were repeated at least once with similar results.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Design and optimization of PCR primers and molecular beacon probes</title>
<p>The molecular beacon probes were based on the heat shock protein 90 (<italic>HSP90)</italic> sequence information in Genbank for <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). This gene was chosen because the sequence is polymorphic between the three species, and the gene had been previously used in a PCR-based nematode identification assay (<xref ref-type="bibr" rid="B30">Nischwitz et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B38">Skantar and Carta, 2004</xref>). Primers were designed that were specific for the conserved <italic>HSP90</italic> sequence in <italic>M. chitwoodi, M. fallax</italic>, and <italic>M. minor</italic>, but span the polymorphic regions between these species within the gene (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). The <italic>HSP90</italic> gene was amplified using the genomic DNA (gDNA) of <italic>M. chitwoodi race 1, M. fallax</italic>, and <italic>M. minor</italic> as the PCR templates. Sequencing the amplicons confirmed that the predicted polymorphic regions were present in the <italic>HSP90</italic> sequence of each species.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Alignment of partial <italic>HSP90</italic> gene sequences for <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic>. Universal primer sequences are highlighted in gray. Variable regions targeted by the beacons are highlighted in teal for <italic>M. minor</italic>, magenta for <italic>M. chitwoodi</italic>, and yellow for <italic>M. fallax</italic>. Asterisks indicate conserved regions between all three species, gaps indicate missing nucleotides according to the alignment.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1096239-g001.tif"/>
</fig>
<p>Molecular beacons were designed to target the polymorphic regions in each species, with the beacons hybridizing to the complementary sequences shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. To determine the optimal annealing temperature for each molecular beacon probe, a melting curve analysis was performed using oligonucleotides complementary to the molecular beacon probe sequence and oligonucleotides with a single nucleotide substitution (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>, <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). The optimal annealing temperature for <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> molecular beacon probes was 54&#xb0;C.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Denaturation curves of molecular beacon probes <bold>(A)</bold> <italic>M. chitwoodi</italic> beacon C1-Hsp90- FAM-6 in the presence of excess complementary template, SNP template, or no template <bold>(B)</bold> <italic>M. fallax</italic> beacon F1-Hsp90-HEX-5 in the presence of excess complementary template, SNP template, or no template. <bold>(C)</bold> <italic>M. minor</italic> beacon M2-Hsp90-Cyan-5 in the presence of excess complementary template, SNP template, or no template.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1096239-g002.tif"/>
</fig>
<p>To measure the amplification efficiency of the molecular beacon RT-PCRs, the cycle threshold (Ct) values were obtained over a range of template concentrations for all three nematode species. This information was used to generate standard curves at an annealing temperature of 54&#xb0;C. First, <italic>M. chitwoodi</italic> race 1 genomic DNA was used as the PCR template with DNA concentrations ranging from 40 ng to 4 pg. When using <italic>M. chitwoodi</italic> race 1 DNA template, the molecular beacon RT-PCR assay had an efficiency of 89% and an R<sup>2</sup> = 0.9984 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). The commonly occurring <italic>M. chitwoodi</italic> Race 1 (<xref ref-type="bibr" rid="B7">Brown et&#xa0;al., 2009</xref>) was used as the template for subsequent PCRs and molecular beacon RT-PCR assays (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). DNA from Race 2 and the pathotype Race 1 Roza of <italic>M. chitwoodi</italic> generated similar standard curves (<xref ref-type="supplementary-material" rid="SF1">
<bold>Figure S1</bold>
</xref>), indicating that the molecular beacon RT-PCR assay could detect <italic>M. chitwoodi</italic>, including isolates of the species common in Washington (<xref ref-type="bibr" rid="B2">Bali et&#xa0;al., 2021a</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Standard curves of known concentrations of templates from <italic>M. chitwoodi, M, fallax</italic>, and <italic>M. minor</italic> with 95% confidence intervals <bold>(A)</bold> The relationship between Ct values and the natural log of <italic>M. chitwoodi</italic> race 1 gDNA from 40 ng to 4 pg (n = 3). <bold>(B)</bold> <italic>M. chitwoodi HSP90</italic> plasmid DNA template from 2 ng to 20 fg (n = 3). <bold>(C)</bold> <italic>M. fallax HSP90</italic> plasmid DNA template from 0.2 ng to 20 fg (n = 2). <bold>(D)</bold> <italic>M. minor HSP90</italic> plasmid DNA template from 0.4 ng to 0.04 fg (n = 3).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1096239-g003.tif"/>
</fig>
<p>Next, a fragment of the <italic>M. chitwoodi HSP90</italic> gene was amplified using the F-HSP90 and R-HSP90 primers. This amplicon was cloned to generate the &#x201c;<italic>M. chitwoodi HSP90</italic> plasmid,&#x201d; which was used as the PCR template for further reactions. The efficiency of the molecular beacon RT-PCR using the <italic>M. chitwoodi HSP90</italic> plasmid as the PCR template was compared to using genomic DNA as the reaction template. By calculating the slope of the standard curve, the PCR efficiency for <italic>M. chitwoodi HSP90</italic> plasmid was 101% with an R<sup>2</sup> = 0.9980 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). This was better, but comparable to the reaction efficiencies using <italic>M. chitwoodi</italic> genomic DNA as the reaction template (efficiency of 89% and an R<sup>2</sup> = 0.9984).</p>
<p>Cloned <italic>HSP90</italic> fragments from <italic>M. fallax</italic> and <italic>M. minor</italic> were also used as template for the molecular beacon RT-PCR assays. The <italic>M. minor</italic> molecular beacon RT-PCR had an efficiency of 90% and an R2 = 0.9994 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>), and the <italic>M. fallax</italic> molecular beacon RT-PCR had an efficiency of 83% with an R<sup>2</sup> = 0.9984 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>).</p>
</sec>
<sec id="s3_2">
<title>The molecular beacon probes are specific for the target nematode</title>
<p>The <italic>M. chitwoodi</italic> molecular beacon probe could detect the <italic>M. chitwoodi</italic> amplicon, but not the amplicons from <italic>M. fallax</italic> and <italic>M. minor</italic> in a molecular beacon RT-PCR (<xref ref-type="supplementary-material" rid="SF2">
<bold>Figure S2A</bold>
</xref>). The same was true for the other molecular beacon probes; the <italic>M. fallax</italic> probe could only hybridize to the <italic>M. fallax</italic> amplicon (<xref ref-type="supplementary-material" rid="SF2">
<bold>Figure S2B</bold>
</xref>) and the <italic>M. minor</italic> probe could only hybridize to the <italic>M. minor</italic> amplicon (<xref ref-type="supplementary-material" rid="SF2">
<bold>Figure S2C</bold>
</xref>).</p>
<p>
<italic>Meloidogyne hapla, M. incognita</italic>, <italic>M. javanica</italic>, and <italic>M. arenaria</italic> are the four major species of root- knot nematodes found worldwide. When the <italic>HSP90</italic> sequences of <italic>M. hapla</italic>, <italic>M. incognita</italic>, <italic>M. javanica</italic>, or <italic>M. arenaria</italic> were aligned with the <italic>HSP90</italic> sequences from <italic>M. chitwoodi, M. fallax</italic> and <italic>M. minor</italic>, the probes were specific to their respective nematode (<xref ref-type="supplementary-material" rid="SF3">
<bold>Figure S3</bold>
</xref>). When qPCR was run using gDNA from <italic>M. hapla</italic>, <italic>M. incognita</italic>, <italic>M. javanica</italic>, or <italic>M. arenaria</italic> none of the molecular beacon probes produced fluorescence (<xref ref-type="supplementary-material" rid="SF4">
<bold>Figure S4</bold>
</xref>), indicating that there is no off-target binding to these other root-knot nematode species.</p>
</sec>
<sec id="s3_3">
<title>
<italic>HSP90</italic> molecular beacon probes detect the presence of a single juvenile <italic>of M. chitwoodi</italic>, <italic>M. fallax</italic>, or <italic>M. minor</italic>
</title>
<p>To validate whether the molecular beacon RT-PCR assays could detect <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, or <italic>M. minor</italic> using DNA isolated directly from juveniles, crude extracts from 1 or 5 J2s of each species was used as the template for molecular beacon RT-PCR. The <italic>M. minor</italic> assay was the most sensitive with an average Ct of 35.7 (standard error of means (SEM) = 0.22, n = 7) for a single J2, and an average Ct of 32.7 for 5 J2s (SEM = 0.46, n = 2) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>). The <italic>M. fallax</italic> assay was the least sensitive, with a single J2 sample having an average Ct of 43.6 (SEM = 1.16, n = 8) and 5 J2s having an average Ct of 39.8 (SEM = 1.04, n = 2) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). Finally, the molecular beacon RT- PCR for <italic>M. chitwoodi</italic> produced an average Ct for a single J2 of 38.9 (SEM = 0.64, n = 10) and a Ct of 34.7 for 5 J2s (SEM = 0.83, n = 2) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). All J2s digests were positive for all three species satisfying the 95% positive replicate criterion suggested by <xref ref-type="bibr" rid="B12">Forootan et&#xa0;al. (2017)</xref> for qPCR limit of detection. In the negative controls, no significant fluorescence was observed. These results demonstrate the sensitivity of the molecular beacon probes and their ability to detect the presence of <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, or <italic>M. minor</italic> from the crude extract of a single juvenile.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Molecular beacon RT-PCR amplification curves using crude extracts from 1 or 5 J2s of <bold>(A)</bold> <italic>M. chitwoodi</italic> <bold>(B)</bold> <italic>M. fallax</italic>, or <bold>(C)</bold> <italic>M. minor</italic> as the reaction template.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1096239-g004.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Multiplex PCR with the molecular beacon probes</title>
<p>Further investigation was carried out to see if the molecular beacon RT-PCR assay could detect the nematode of interest when there is a mixture of nematodes in the reaction. When 20 pg of <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor HSP90</italic> templates were mixed in a single reaction containing all three beacon probes, it was possible to detect each species (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). Detection of all three species was also possible using crude extracts from digested J2s when all 3 species were mixed, either as single J2s or as 5 J2s each (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Multiplexed molecular beacon RT-PCR assays containing equal or unequal parts <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> plasmid template. <bold>(A)</bold> Amplification curves from 20 pg of <italic>M. chitwoodi</italic> (average Ct = 31.3, SEM = 0.11, n = 6), <italic>M. fallax</italic> (average Ct = 30.9, SEM = 0.20, n = 6), and <italic>M. minor</italic> (average Ct = 30.1, SEM = 0.09, n = 6) in a single reaction <bold>(B)</bold> Amplification curves from 20 pg of <italic>M. chitwoodi</italic> (no amplification, n = 6), 200 pg <italic>M. fallax</italic> (average Ct = 26.8, SEM = 0.62, n = 6), and 200 pg <italic>M. minor</italic> (average Ct = 26.3, SEM = 0.39, n = 6) in a single reaction <bold>(C)</bold> Amplification curves from 20 pg of <italic>M. fallax</italic> (no amplification, n = 6), 200 pg <italic>M. chitwoodi</italic> (average Ct = 27.0, SEM = 0.50, n = 6), and 200 pg <italic>M. minor</italic> (average Ct = 25.1, SEM = 0.13, n = 6) in a single reaction. <bold>(D)</bold> Amplification curves from 20 pg of <italic>M. minor</italic> (no amplification, n = 6), 200 pg <italic>M. chitwoodi</italic> (average Ct = 26.6, SEM = 0.24, n = 6), and 200 pg <italic>M. fallax</italic> (average Ct = 26.6, SEM = 0.20, n = 6) in a single reaction.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1096239-g005.tif"/>
</fig>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Multiplexed molecular beacon RT-PCR assays containing an equal mix of 1 or 5 J2s from <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> as template. <bold>(A)</bold> Amplification curves from 1 J2 of <italic>M. chitwoodi</italic> (average Ct = 42.3, SEM = 0.43, n = 10), <italic>M. fallax</italic> (average Ct = 43.7, SEM = 0.78, n = 10), and <italic>M. minor</italic> (average Ct = 41.1, SEM = 0.69, n = 10) in a single reaction. <bold>(B)</bold> Amplification curves from 5 J2s of <italic>M. chitwoodi</italic> (average Ct = 42.4, SEM = 0.63, n = 4), <italic>M. fallax</italic> (average Ct = 42.7, SEM = 0.92, n = 4), and <italic>M. minor</italic> (average Ct = 42.7, SEM = 0.62, n = 4) in a single reaction.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fpls-14-1096239-g006.tif"/>
</fig>
<p>To investigate how the assay performed when templates were not present in equal parts, mixes of <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor HSP90</italic> plasmid templates were made that had one species present at 20 pg, and the other two species present at 200 pg. The templates present at 200 pg were reliably detected, but the template at 20 pg could not be detected in these reactions (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5B&#x2013;D</bold>
</xref>).</p>
<p>Overall, the data suggests that the molecular beacon RT-PCR assay can detect each species in a multiplexed reaction. However, an important caveat is that the sample detection is inhibited for the target species if the other two species are in relative excess in concentration.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Nematode identification is a critical component for biosecurity, particularly when dealing with regulated nematodes. <italic>Meloidogyne minor, M. chitwoodi</italic> and <italic>M. fallax</italic> juveniles can be difficult to distinguish from each other, making morphological-based identification challenging. We designed a molecular beacon RT-PCR assay to detect <italic>M. chitwoodi, M. minor</italic>, and <italic>M. fallax</italic>. The assay is species-specific, easy to perform, rapid, and reliable. It is also able to detect small amounts of DNA and could identify the species using a single J2 as the reaction template. This means it can be adapted for identifying J2s extracted from soil or from J2s hatched from eggs (<xref ref-type="bibr" rid="B1">Adam et&#xa0;al., 2007</xref>). This assay can be very useful because individual J2s can be picked and then used directly to identify if it is one of three species. If all three beacons are used on a single J2, a positive or negative identification of either <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, or <italic>M. minor</italic> can be obtained in a reaction time under 2 hours. This assay will help to determine the distribution of these nematodes and prevent their spread to new potato growing regions.</p>
<p>A previous comparison between TaqMan and molecular beacon probes for analyzing single nucleotide polymorphisms (SNPs) in human DNA found that molecular beacon probes are better in detecting sequence variants; in a panel of DNA samples, the molecular beacon probes were more reliable in detecting GC-rich targets compared to the TaqMan probes designed for that region (<xref ref-type="bibr" rid="B40">T&#xe4;pp et&#xa0;al., 2000</xref>). In addition, the data showed that the molecular beacon probes could better detect minority sequence variants over a wider range of template concentrations compared to the TaqMan assay, suggesting that the molecular beacon probes offer advantages in sensitivity and robustness over TaqMan assays (<xref ref-type="bibr" rid="B40">T&#xe4;pp et&#xa0;al., 2000</xref>). Our results indicate that the molecular beacon probes we developed for <italic>M. chitwoodi</italic> and <italic>M. fallax</italic> are more sensitive than the previously developed TaqMan assay for these two species (<xref ref-type="bibr" rid="B60">Zijlstra and Van Hoof, 2006</xref>). Our molecular beacon RT-PCR assays could detect DNA concentrations as low as 0.04 fg for <italic>M. minor</italic> and 4 fg and 2 fg for <italic>M. chitwoodi</italic> and <italic>M. fallax</italic>, respectively, which is better than or comparable to previous TaqMan molecular beacon RT-PCR assays (<xref ref-type="bibr" rid="B6">Braun-Kiewnick and Kiewnick, 2018</xref>; <xref ref-type="bibr" rid="B60">Zijlstra and Van Hoof, 2006</xref>; <xref ref-type="bibr" rid="B50">Weerdt et&#xa0;al., 2011</xref>). The <italic>M. chitwoodi</italic> and <italic>M. minor</italic> assays both had PCR efficiencies of &#x2265; 90%. This is an improvement in efficiency for <italic>M. minor</italic> (<xref ref-type="bibr" rid="B50">Weerdt et&#xa0;al., 2011</xref>) and a similar efficiency for <italic>M. chitwoodi</italic> compared to the previously published TaqMan assays (<xref ref-type="bibr" rid="B60">Zijlstra and Van Hoof, 2006</xref>). The <italic>M. fallax</italic> assay had the lowest PCR efficiency of the three at 83%. However, 83% is still a relatively good efficiency compared to previously published PCR assays for root-knot nematodes. For example, the TaqMan assay for <italic>M. minor</italic> had an efficiency of 62% (<xref ref-type="bibr" rid="B50">Weerdt et&#xa0;al., 2011</xref>). The performance of the molecular beacon RT-PCR assays indicate that the assay has a high sensitivity, specificity (the probes only detect the target species) and reproducibility over multiple experiments. While this assay is species-specific, standard curves using Race 1, Race 2, or Race 1 Roza gDNA from <italic>M. chitwoodi</italic> showed that this assay cannot distinguish between the <italic>M. chitwoodi</italic> isolates. Therefore, this the assay would be suitable for general <italic>M. chitwoodi</italic> detection despite the fact that the known races in Washington differ genetically (<xref ref-type="bibr" rid="B3">Bali et&#xa0;al., 2021b</xref>).</p>
<p>Multiplexing would allow for the simultaneous detection of the three species in one tube. The multiplexing experiments showed that we could detect each species of nematode when similar quantities of template of the three species were present. Because the PCR efficiencies were high and because the PCR primers are targeting the same sequences in all three species, when all three species are present in similar amounts, the amount of target amplicons produced from each species should be similar, resulting in detectable amplicons. However, we found that our ability to detect a species was compromised if its DNA template was present at relatively low ratios (&#x2265;1:10) compared to the other species. Although the sensitivity of multiplexing is limited by the relative quantities of DNA template from each of the three species, it is still a useful tool for the sensitive detection and identification of <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic>.</p>
<p>This assay provides a simple and rapid molecular protocol for distinguishing <italic>M. chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. minor</italic> from one another using as little as a single J2 as the reaction template. The assays described here use DNA isolated from juvenile(s) since they are commonly found in soil samples, but DNA could be isolated from eggs and adult nematodes and used as the reaction template. This is the first molecular method that reliably identifies these three species of potato-infecting root-knot nematodes. It could be used by diagnosticians and extension agents as a tool for tracking the spread of <italic>M. chitwoodi</italic>, <italic>M. fallax</italic> and <italic>M. minor</italic> in the USA.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>SA performed the experiments and statistical analyses. SA and&#xa0;CG designed the experiments and wrote the manuscript text. Both authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>Funding was provided by the Animal and Plant Health Inspection Service #AP18PPQS&amp;T00C148. This work was supported in part by the USDA National Institute of Food and Agriculture, Hatch umbrella project #1015621 and Hatch project W4186.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors wish to thank Dr. Gerrit Karssen of the Wageningen Nematode Collection for providing the <italic>M. fallax</italic> and <italic>M. minor</italic>, and Dr. Sapinder Bali for help with nematode DNA extraction.</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fpls.2023.1096239/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fpls.2023.1096239/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image_1.tiff" id="SF1" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_2.tiff" id="SF2" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_3.tiff" id="SF3" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image_4.tiff" id="SF4" mimetype="image/tiff"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Adam</surname> <given-names>M. A. M.</given-names>
</name>
<name>
<surname>Phillips</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Blok</surname> <given-names>V. C.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Molecular diagnostic key for identification of single juveniles of seven common and economically important species of root-knot nematode (<italic>Meloidogyne</italic> spp.)</article-title>. <source>Plant Pathol.</source> <volume>56</volume>, <fpage>190</fpage>&#x2013;<lpage>197</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-3059.2006.01455.x</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bali</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Vining</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Mojtahedi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>a). <article-title>Nematode genome announcement: Draft genome of <italic>Meloidogyne chitwoodi</italic>, an economically important pest of potato in the pacific Northwest</article-title>. <source>Mol. Plant Microbe Interact.</source> <volume>34</volume>, <fpage>981</fpage>&#x2013;<lpage>986</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/MPMI-12-20-0337-A</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bali</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Franco</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gleason</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2021</year>b). <article-title>Biotechnological advances with applicability in potatoes for resistance against root-knot nematodes</article-title>. <source>Curr. Opin. Biotechnol.</source> <volume>70</volume>, <fpage>226</fpage>&#x2013;<lpage>233</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.copbio.2021.06.010</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baum</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Gresshoff</surname> <given-names>P. M.</given-names>
</name>
<name>
<surname>Lewis</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Dean</surname> <given-names>R. A.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>Characterization and phylogenetic analysis of four root-knot nematode species using DNA amplification fingerprinting and automated polyacrylamide gel electrophoresis</article-title>. <source>Mol. Plant Microbe Interact.</source> <volume>7</volume>, <fpage>39</fpage>&#x2013;<lpage>47</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/MPMI-7-0039</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Blok</surname> <given-names>V. C.</given-names>
</name>
<name>
<surname>Phillips</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Fargette</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Comparison of sequences from the ribosomal DNA intergenic region of <italic>Meloidogyne mayaguensis</italic> and other major tropical root-knot nematodes</article-title>. <source>J. Nematol.</source> <volume>29</volume>, <fpage>16</fpage>&#x2013;<lpage>22</lpage>.</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Braun-Kiewnick</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kiewnick</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Real-time PCR, a great tool for fast identification, sensitive detection and quantification of important plant-parasitic nematodes</article-title>. <source>Eur. J. Plant Pathol.</source> <volume>152</volume>, <fpage>271</fpage>&#x2013;<lpage>283</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10658-018-1487-7</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brown</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Mojtahedi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L. H.</given-names>
</name>
<name>
<surname>Riga</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Independent resistant reactions expressed in root and tuber of potato breeding lines with introgressed resistance to <italic>Meloidogyne chitwoodi</italic>
</article-title>. <source>Phytopathology</source> <volume>99</volume>, <fpage>1085</fpage>&#x2013;<lpage>1089</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO-99-9-1085</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castagnone-Sereno</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Use of satellite DNA for specific diagnosis of the quarantine root- knot nematodes <italic>Meloidogyne chitwoodi</italic> and <italic>M. fallax</italic>
</article-title>. <source>Bull. OEPP</source> <volume>30</volume>, <fpage>581</fpage>&#x2013;<lpage>584</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-2338.2000.tb00951.x</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castagnone-Sereno</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Leroy</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Bongiovanni</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zijlstra</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Abad</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Specific diagnosis of two root-knot nematodes, <italic>Meloidogyne chitwoodi</italic> and <italic>M. fallax</italic>, with satellite DNA probes</article-title>. <source>Phytopathology</source> <volume>89</volume>, <fpage>380</fpage>&#x2013;<lpage>384</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO.1999.89.5.380</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>European and Mediterranean Plant Protection Organization [EPPO]</collab>
</person-group> (<year>2022</year>) <article-title>
<italic>Meloidogyne fallax.</italic> EPPO datasheets on pests recommended for regulation</article-title>. Available at: <uri xlink:href="https://gd.eppo.int">https://gd.eppo.int</uri> (Accessed <access-date>December 23, 2022</access-date>).</citation>
</ref>
<ref id="B11">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>FAO</collab>
</person-group>. (<year>2017</year>). <source>Crops and livestock products</source>. Available at: <uri xlink:href="https://www.fao.org/faostat/en/#data/QCL">https://www.fao.org/faostat/en/#data/QCL</uri> (Accessed <access-date>04-05-2021</access-date>).</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Forootan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sj&#xf6;back</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Bj&#xf6;rkman</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Sj&#xf6;green</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Linz</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Kubista</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Methods to determine limit of detection and limit of quantification in quantitative real-time PCR (qPCR)</article-title>. <source>Biomol. Detect. Quantif.</source> <volume>12</volume>, <fpage>1</fpage>&#x2013;<lpage>6</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bdq.2017.04.001</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gamel</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Huchet</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Le Roux-Nio</surname> <given-names>A.-C.</given-names>
</name>
<name>
<surname>Anthoine</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Assessment of PCR-based tools for the specific identification of some temperate <italic>Meloidogyne</italic> species including <italic>M. chitwoodi</italic>, <italic>M. fallax</italic> and <italic>M. minor</italic>
</article-title>. <source>Eur. J. Plant Pathol.</source> <volume>138</volume>, <fpage>807</fpage>&#x2013;<lpage>817</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10658-013-0355-8</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Giorgi</surname> <given-names>C. D.</given-names>
</name>
<name>
<surname>Sialer</surname> <given-names>M. F.</given-names>
</name>
<name>
<surname>Vito</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Lamberti</surname> <given-names>F.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>Identification of plant-parasitic nematodes by PCR amplification of DNA fragments</article-title>. <source>Bull. OEPP</source> <volume>24</volume>, <fpage>447</fpage>&#x2013;<lpage>451</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-2338.1994.tb01403.x</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gross</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Williamson</surname> <given-names>V. M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Tm1: A mutator/foldback transposable element family in root-knot nematodes</article-title>. <source>PloS One</source> <volume>6</volume>, <fpage>9</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0024534</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hadziavdic</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Lekang</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Lanzen</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Jonassen</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Thompson</surname> <given-names>E. M.</given-names>
</name>
<name>
<surname>Troedsson</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Characterization of the 18S rRNA gene for designing universal eukaryote specific primers</article-title>. <source>PLoS One</source> <volume>9</volume>, <fpage>2</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0087624</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Han</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Cho</surname> <given-names>M.-R.</given-names>
</name>
<name>
<surname>Jeon</surname> <given-names>H.-Y.</given-names>
</name>
<name>
<surname>Lim</surname> <given-names>C.-K.</given-names>
</name>
<name>
<surname>Jang</surname> <given-names>H.-I.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>PCR-RFLP identification of three major <italic>Meloidogyne</italic> species in Korea</article-title>. <source>J. Asia Pac. Entomol.</source> <volume>7</volume>, <fpage>171</fpage>&#x2013;<lpage>175</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1226-8615(08)60212-5</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harris</surname> <given-names>T. S.</given-names>
</name>
<name>
<surname>Sandall</surname> <given-names>L. J.</given-names>
</name>
<name>
<surname>Powers</surname> <given-names>T. O.</given-names>
</name>
</person-group> (<year>1990</year>). <article-title>Identification of single <italic>Meloidogyne</italic> juveniles by polymerase chain reaction amplification of mitochondrial DNA</article-title>. <source>J. Nematol.</source> <volume>22</volume>, <fpage>518</fpage>&#x2013;<lpage>524</lpage>.</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ingham</surname> <given-names>R. E.</given-names>
</name>
<name>
<surname>Hamm</surname> <given-names>P. B.</given-names>
</name>
<name>
<surname>Baune</surname> <given-names>M.</given-names>
</name>
<name>
<surname>David</surname> <given-names>N. L.</given-names>
</name>
<name>
<surname>Wade</surname> <given-names>N. M.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Control of <italic>Meloidogyne chitwoodi</italic> in potato with shank-injected metam sodium and other nematicides</article-title>. <source>J. Nematol.</source> <volume>39</volume>, <fpage>161</fpage>&#x2013;<lpage>168</lpage>.</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ingham</surname> <given-names>R. E.</given-names>
</name>
<name>
<surname>Hamm</surname> <given-names>P. B.</given-names>
</name>
<name>
<surname>Williams</surname> <given-names>R. E.</given-names>
</name>
<name>
<surname>Swanson</surname> <given-names>W. H.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Control of <italic>Meloidogyne chitwoodi</italic> in potato with fumigant and nonfumigant nematicides</article-title>. <source>J. Nematol.</source> <volume>32</volume>, <fpage>556</fpage>&#x2013;<lpage>565</lpage>.</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kantor</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Handoo</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Kantor</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Carta</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Top ten most important U.S.-regulated and emerging plant-parasitic nematodes</article-title>. <source>Horticulturae</source> <volume>8</volume>, <elocation-id>208</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/horticulturae8030208</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karssen</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>Description of <italic>Meloidogyne fallax</italic> n. sp. (Nematoda: Heteroderidae), a root- knot nematode from the Netherlands</article-title>. <source>Fundam. Appl. Nematol.</source> <volume>19</volume>, <fpage>593</fpage>&#x2013;<lpage>599</lpage>.</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karssen</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Bolk</surname> <given-names>R. J.</given-names>
</name>
<name>
<surname>van Aelst</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>van den Beld</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Kox</surname> <given-names>L. F. F.</given-names>
</name>
<name>
<surname>Korthals</surname> <given-names>G. W.</given-names>
</name>
<etal/>
</person-group>. (<year>2004</year>). <article-title>Description of <italic>Meloidogyne minor</italic> n. sp. (Nematoda: Meloidogynidae), a root-knot nematode associated with yellow patch disease in golf courses</article-title>. <source>Nematology</source> <volume>6</volume>, <fpage>59</fpage>&#x2013;<lpage>72</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/156854104323072937</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koenning</surname> <given-names>S. R.</given-names>
</name>
<name>
<surname>Overstreet</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Noling</surname> <given-names>J. W.</given-names>
</name>
<name>
<surname>Donald</surname> <given-names>P. A.</given-names>
</name>
<name>
<surname>Becker</surname> <given-names>J. O.</given-names>
</name>
<name>
<surname>Fortnum</surname> <given-names>B. A.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Survey of crop losses in response to phytoparasitic nematodes in the united states for 1994</article-title>. <source>J. Nematol.</source> <volume>31</volume>, <fpage>587</fpage>&#x2013;<lpage>618</lpage>.</citation>
</ref>
<ref id="B25">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Lima</surname> <given-names>F. S. O.</given-names>
</name>
<name>
<surname>Mattos</surname> <given-names>V. S.</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>E. S.</given-names>
</name>
<name>
<surname>Carvalho</surname> <given-names>M. A. S.</given-names>
</name>
<name>
<surname>Teixeira</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>J. C.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). &#x201c;<article-title>Nematodes affecting potato and sustainable practices for their management</article-title>,&#x201d; in <source>Potato - from incas to all over the world</source>. Ed. <person-group person-group-type="editor">
<name>
<surname>Yildiz</surname> <given-names>M.</given-names>
</name>
</person-group> (<publisher-loc>London</publisher-loc>: <publisher-name>IntechOpen</publisher-name>). doi:&#xa0;<pub-id pub-id-type="doi">10.5772/intechopen.73056</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mojtahedi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Riga</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L. H.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>A new pathotype of <italic>Meloidogyne chitwoodi</italic> race 1 from Washington state</article-title>. <source>Plant Dis.</source> <volume>91</volume>, <fpage>1051</fpage>.</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McClure</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Nischwitz</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Skantar</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Schmitt</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Subbotin</surname> <given-names>S. A.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Root- knot nematodes in golf course greens of the Western united states</article-title>. <source>Plant Dis.</source> <volume>96</volume>, <fpage>635</fpage>&#x2013;<lpage>647</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PDIS-09-11-0808</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morris</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Horgan</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Downes</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Griffin</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>The effect of temperature on hatch and activity of second-stage juveniles of the root-knot nematode, <italic>Meloidogyne minor</italic>, an emerging pest in north-west Europe</article-title>. <source>Nematology</source> <volume>13</volume>, <fpage>985</fpage>&#x2013;<lpage>993</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/138855411X571902</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morris</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Horgan</surname> <given-names>F. G.</given-names>
</name>
<name>
<surname>Griffin</surname> <given-names>C. T.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Spatial and temporal dynamics of <italic>Meloidogyne minor</italic> on creeping bentgrass in golf greens</article-title>. <source>Plant Pathol.</source> <volume>62</volume>, <fpage>1166</fpage>&#x2013;<lpage>1172</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/ppa.12025</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nischwitz</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Skantar</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Handoo</surname> <given-names>Z. A.</given-names>
</name>
<name>
<surname>Hult</surname> <given-names>M. N.</given-names>
</name>
<name>
<surname>Schmitt</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>McClure</surname> <given-names>M. A.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Occurrence of <italic>Meloidogyne fallax</italic> in north America, and molecular characterization of <italic>M. fallax</italic> and <italic>M. minor</italic> from U.S. golf course greens</article-title>. <source>Plant Dis.</source> <volume>97</volume>, <fpage>1424</fpage>&#x2013;<lpage>1430</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PDIS-03-13-0263-RE</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Orui</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Identification of Japanese species of the genus <italic>Meloidogyne</italic> (Nematoda: Meloidogynidae) by PCR-RFLP analysis</article-title>. <source>Appl. Entomol. Zool.</source> <volume>33</volume>, <fpage>43</fpage>&#x2013;<lpage>51</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1303/aez.33.43</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Petersen</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Zijlstra</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Wishart</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Specific probes efficiently distinguish root-knot nematode species using signature sequences in the ribosomal intergenic spacer</article-title>. <source>Fundam. Appl. Nematol.</source> <volume>20</volume>, <fpage>619</fpage>&#x2013;<lpage>626</lpage>.</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pinkerton</surname> <given-names>J. N.</given-names>
</name>
<name>
<surname>Santo</surname> <given-names>G. S.</given-names>
</name>
<name>
<surname>Mojtahedi</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Population dynamics of <italic>Meloidogyne chitwoodi</italic> on russet Burbank potatoes in relation to degree-day accumulation</article-title>. <source>J. Nematol.</source> <volume>23</volume>, <fpage>283</fpage>&#x2013;<lpage>290</lpage>.</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Powers</surname> <given-names>T. O.</given-names>
</name>
<name>
<surname>Harris</surname> <given-names>T. S.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>A polymerase chain reaction method for identification of five major <italic>Meloidogyne</italic> species</article-title>. <source>J. Nematol.</source> <volume>25</volume>, <fpage>1</fpage>&#x2013;<lpage>6</lpage>.</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Powers</surname> <given-names>T. O.</given-names>
</name>
<name>
<surname>Todd</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Burnell</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Murray</surname> <given-names>P. C. B.</given-names>
</name>
<name>
<surname>Fleming</surname> <given-names>C. C.</given-names>
</name>
<name>
<surname>Szalanski</surname> <given-names>A. L.</given-names>
</name>
<etal/>
</person-group>. (<year>1997</year>). <article-title>The rDNA internal transcribed spacer region as a taxonomic marker for nematodes</article-title>. <source>J. Nematol.</source> <volume>29</volume>, <fpage>441</fpage>&#x2013;<lpage>450</lpage>.</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qiu</surname> <given-names>J. J.</given-names>
</name>
<name>
<surname>Westerdahl</surname> <given-names>B. B.</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Williamson</surname> <given-names>V. M.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Sensitive PCR detection of <italic>Meloidogyne arenaria</italic>, <italic>M. incognita</italic>, and <italic>M. javanica</italic> extracted from soil</article-title>. <source>J. Nematol.</source> <volume>38</volume>, <fpage>434</fpage>&#x2013;<lpage>441</lpage>.</citation>
</ref>
<ref id="B37">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Sasser</surname> <given-names>J. N.</given-names>
</name>
<name>
<surname>Freckman</surname> <given-names>D. W.</given-names>
</name>
</person-group> (<year>1987</year>). &#x201c;<article-title>A world perspective on nematology: The role of the society</article-title>,&#x201d; in <source>Vistas on nematology</source>. Eds. <person-group person-group-type="editor">
<name>
<surname>Veech</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Dickson</surname> <given-names>D. W.</given-names>
</name>
</person-group> (<publisher-loc>Hyattsville, MD</publisher-loc>: <publisher-name>Society of Nematologists, Inc</publisher-name>) <fpage>7</fpage>&#x2013;<lpage>20</lpage>.</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Skantar</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Carta</surname> <given-names>L. K.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Molecular characterization and phylogenetic evaluation of the hsp90 gene from selected nematodes</article-title>. <source>J. Nematol.</source> <volume>36</volume>, <fpage>466</fpage>&#x2013;<lpage>480</lpage>.</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suffert</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Giltrap</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>EPPO workshop on <italic>Meloidogyne chitwoodi</italic> and meloidogyne fallax, (2011-03-08): Importance for potato production and experience of management in EPPO countries</article-title>. <source>Bull. OEPP</source> <volume>42</volume>, <fpage>117</fpage>&#x2013;<lpage>121</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-2338.2012.02528.x</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>T&#xe4;pp</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Malmberg</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Rennel</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Wik</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Syv&#xe4;nen</surname> <given-names>A. C.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Homogeneous scoring of single-nucleotide polymorphisms: Comparison of the 5&#x2019;-nuclease TaqMan assay and molecular beacon probes</article-title>. <source>BioTechniques</source> <volume>28</volume>, <fpage>732</fpage>&#x2013;<lpage>738</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2144/00284rr02</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thoden</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Korthals</surname> <given-names>G. W.</given-names>
</name>
<name>
<surname>Visser</surname> <given-names>J.</given-names>
</name>
<name>
<surname>van Gastel-Topper</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>A field study on the host status of different crops for <italic>Meloidogyne minor</italic> and its damage potential on potatoes</article-title>. <source>Nematology</source> <volume>14</volume>, <fpage>277</fpage>&#x2013;<lpage>284</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/156854111X594965</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Der Beek</surname> <given-names>J. G.</given-names>
</name>
<name>
<surname>Vereijken</surname> <given-names>P. F. G.</given-names>
</name>
<name>
<surname>Poleij</surname> <given-names>L. M.</given-names>
</name>
<name>
<surname>Silfhout</surname> <given-names>C. H. V.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Isolate-by- cultivar interaction in root-knot nematodes <italic>Meloidogyne hapla</italic>, <italic>M. chitwoodi</italic>, and <italic>M. fallax</italic> on potato</article-title>. <source>Can. J. Bot.</source> <volume>76</volume>, <fpage>75</fpage>&#x2013;<lpage>82</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1139/b97-161</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Megen</surname> <given-names>H.</given-names>
</name>
<name>
<surname>van den Elsen</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Holterman</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Karssen</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Mooyman</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Bongers</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences</article-title>. <source>Nematology</source> <volume>11</volume>, <fpage>927</fpage>&#x2013;<lpage>950</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/156854109X456862</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Meggelen</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Karssen</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Janssen</surname> <given-names>G. J. W.</given-names>
</name>
<name>
<surname>Verkerk-Bakker</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Janssen</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>New race of <italic>Meloidogyne chitwoodi</italic> golden, O&#x2019;Bannon, Santo &amp; Finley 1980</article-title>? <source>Fundam. Appl. Nematol.</source> <volume>17</volume>, <fpage>93</fpage>&#x2013;<lpage>96</lpage>.</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vandenbossche</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Viaene</surname> <given-names>N.</given-names>
</name>
<name>
<surname>de Sutter</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Maes</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Karssen</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Bert</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Diversity and incidence of plant-parasitic nematodes in Belgian turf grass</article-title>. <source>Nematology</source> <volume>13</volume>, <fpage>245</fpage>&#x2013;<lpage>256</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/138855410X517084</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Viaene</surname> <given-names>N.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Nematodes: An increasing threat for the potato crop in Europe</article-title>? <source>Potato Res.</source> <volume>57</volume>, <fpage>335</fpage>&#x2013;<lpage>338</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11540-015-9284-6</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vrain</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Petersen</surname> <given-names>D. J.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>Rapid identification of <italic>Meloidogyne chitwoodi</italic>, <italic>M. hapla</italic>, and <italic>M. fallax</italic> using PCR primers to amplify their ribosomal intergenic spacer</article-title>. <source>Fundam. Appl. Nematol.</source> <volume>19</volume>, <fpage>601</fpage>&#x2013;<lpage>605</lpage>.</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vrain</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Wakarchuk</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Levesque</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Hamilton</surname> <given-names>R. L.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Intraspecific rDNA restriction fragment length polymorphism in the <italic>Xiphinema americanum</italic> group</article-title>. <source>Fundam. Appl. Nematol.</source> <volume>15</volume>, <fpage>563</fpage>&#x2013;<lpage>573</lpage>.</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Waeyenberge</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ryss</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Moens</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Pinochet</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Vrain</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Molecular characterisation of 18 <italic>Pratylenchus</italic> species using rDNA restriction fragment length polymorphism</article-title>. <source>Nematology</source> <volume>2</volume>, <fpage>135</fpage>&#x2013;<lpage>142</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/156854100509024</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weerdt</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Kox</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Waeyenberge</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Viaene</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Zijlstra</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>A real-time PCR assay to identify <italic>Meloidogyne minor</italic>
</article-title>. <source>J. Phytopathol.</source> <volume>159</volume>, <fpage>80</fpage>&#x2013;<lpage>84</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1439-0434.2010.01717.x</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wesemael</surname> <given-names>W. M. L.</given-names>
</name>
<name>
<surname>Taning</surname> <given-names>L. M.</given-names>
</name>
<name>
<surname>Viaene</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Moens</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Life cycle and damage of the root-knot nematode <italic>Meloidogyne minor</italic> on potato, solanum tuberosum</article-title>. <source>Nematology</source> <volume>16</volume>, <fpage>185</fpage>&#x2013;<lpage>192</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/15685411-00002756</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wesemael</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Viaene</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Moens</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Root-knot nematodes (<italic>Meloidogyne</italic> spp.) in Europe</article-title>. <source>Nematology</source> <volume>13</volume>, <fpage>3</fpage>&#x2013;<lpage>16</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1163/138855410X526831</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wishart</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Phillips</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Blok</surname> <given-names>V. C.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Ribosomal intergenic spacer: a polymerase chain reaction diagnostic for <italic>Meloidogyne chitwoodi</italic>, <italic>M. fallax</italic>, and <italic>M. hapla</italic>
</article-title>. <source>Phytopathology</source> <volume>92</volume>, <fpage>884</fpage>&#x2013;<lpage>892</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO.2002.92.8.884</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Williamson</surname> <given-names>V. M.</given-names>
</name>
<name>
<surname>Caswell-Chen</surname> <given-names>E. P.</given-names>
</name>
<name>
<surname>Westerdahl</surname> <given-names>B. B.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>F. F.</given-names>
</name>
<name>
<surname>Caryl</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>A PCR assay to identify and distinguish single juveniles of <italic>Meloidogyne hapla</italic> and <italic>M. chitwoodi</italic>
</article-title>. <source>J. Nematol.</source> <volume>29</volume>, <fpage>9</fpage>&#x2013;<lpage>15</lpage>.</citation>
</ref>
<ref id="B55">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Zasada</surname> <given-names>I. A.</given-names>
</name>
<name>
<surname>Dandurand</surname> <given-names>L.-M.</given-names>
</name>
<name>
<surname>Gleason</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Hagerty</surname> <given-names>C. H.</given-names>
</name>
<name>
<surname>Ingham</surname> <given-names>R. E.</given-names>
</name>
</person-group> (<year>2018</year>). &#x201c;<article-title>Plant parasitic nematodes of the pacific Northwest: Idaho, Oregon and Washington</article-title>,&#x201d; in <source>Plant parasitic nematodes in sustainable agriculture of north America</source>. Eds. <person-group person-group-type="editor">
<name>
<surname>Subbotin</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Chitambar</surname> <given-names>J. J.</given-names>
</name>
</person-group> (<publisher-loc>Cham, Switzerland</publisher-loc>: <publisher-name>Springer International Publishing</publisher-name>), <fpage>211</fpage>&#x2013;<lpage>239</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-3-319-99585-4_8</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zeng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Kerns</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Tredway</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Martin</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Molecular characterization and phylogenetic relationships of plant-parasitic nematodes associated with turfgrasses in north Carolina and south Carolina, united states</article-title>. <source>Plant Dis.</source> <volume>99</volume>, <fpage>982</fpage>&#x2013;<lpage>993</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PDIS-10-14-1060-RE</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Gleason</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Loop-mediated isothermal amplification for the diagnostic detection of <italic>Meloidogyne chitwoodi</italic> and <italic>M. fallax</italic>
</article-title>. <source>Plant Dis.</source> <volume>103</volume>, <fpage>12</fpage>&#x2013;<lpage>18</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PDIS-01-18-0093-RE</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zijlstra</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>A fast PCR assay to identify <italic>Meloidogyne hapla</italic>, <italic>M. chitwoodi</italic>, and <italic>M. fallax</italic>, and to sensitively differentiate them from each other and from <italic>M. incognita</italic> in mixtures</article-title>. <source>Fundam. Appl. Nematol.</source> <volume>20</volume>, <fpage>505</fpage>&#x2013;<lpage>511</lpage>.</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zijlstra</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Identification of <italic>Meloidogyne chitwoodi</italic>, <italic>M. fallax</italic> and <italic>M. hapla</italic> based on SCAR-PCR: A powerful way of enabling reliable identification of populations or individuals that share common traits</article-title>. <source>Eur. J. Plant Pathol.</source> <volume>106</volume>, <fpage>283</fpage>&#x2013;<lpage>290</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1023/A:1008765303364</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zijlstra</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Van Hoof</surname> <given-names>R. A.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>A multiplex real-time polymerase chain reaction (TaqMan) assay for the simultaneous detection of <italic>Meloidogyne chitwoodi</italic> and <italic>M. fallax</italic>
</article-title>. <source>Phytopathology</source> <volume>96</volume>, <fpage>1255</fpage>&#x2013;<lpage>1262</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO-96-1255</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zijlstra</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Lever</surname> <given-names>A. E. M.</given-names>
</name>
<name>
<surname>Uenk</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>van Silfhout</surname> <given-names>C. H.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>Differences between ITS regions of isolates of the root-knot nematodes <italic>Meloidogyne hapla</italic> and <italic>M. chitwoodi</italic>
</article-title>. <source>Phytopathology</source> <volume>85</volume>, <fpage>1231</fpage>&#x2013;<lpage>1237</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/Phyto-85-1231</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>