The materials used in the experiment were resistant variety ‘SN205’ and susceptible variety ‘SN742’ of Chinese cabbage, physiological race no.4 of P. brassicae, Colombian wild-type ‘WT’ of Arabidopsis thaliana and tobacco ‘Nicotiana Benthamiana’. All the above experimental materials were preserved by the Vegetable Genetics and Breeding Laboratory of Shenyang Agricultural University. The Arabidopsis mutant rpp1 (‘SALK_065253’) was purchased from ABRC (https://abrc.osu.edu/).

The reference sequence of BrRPP1 was obtained by searching from Brassica database (BRAD (brassicadb.cn)). Then the sequence validity was checked by Nucleic acid BLAST (http://www.ncbi.nlm.nih.gov/blast/) in the National Center of Biotechnology Information (NCBI). The gene conservative structure domain was predicted by NCBI protein conserved domain database (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi).

To obtain accurate cDNA sequences of BrRPP1 from the ‘SN205’ and ‘SN742’, three segmented primers (BrRPP1-1, BrRPP1-2 and BrRPP1-3) with Eco3II sites were designed using Primer 5 software ( Table 1 ). The three corrected amplified fragments from the cDNA of ‘SN205’ or ‘SN742’ were digested by Eco3II (Beijing NEB, China) respectively, and then ligated to pBWA(V)BS vector linearized by Eco3II using T4 ligase (Tiangen, Beijing, China). The connecting products pBWA(V)BS-SN205-BrRPP1 and pBWA(V)BS-SN742-BrRPP1 were transformed into the competent cells of Trans10 E. coli respectively. The correctness of recombinant clones were detected with primers (F: cagtGGTCCacacatgatttcgatcgattttttgaaaaaaaaa and R: cagtgGTCTCatacataacatgaggaggaggaggtttc) and the colony with the correct band position was sequenced (Sangon Inc, Shanghai, China). The three-dimensional structure of BrRPP1 protein in ‘SN205’ and ‘SN742’ was predicted using SWISS-MODEL online tool (https://swissmodel.expasy.org/interactive).

Promoter primers (BrRPP1pro-F: CTGTTCTCGTATCCTTCAC and BrRPP1pro-R: CTCATCTGCTTTCTCTTTTTC) were designed according the upstream 2 kb sequence of BrRPP1 from Brassica database (brassicadb.cn). The DNA of ‘SN205’ and ‘SN742’ were used as templates respectively to amplify the promoter sequences of BrRPP1. Promoter elements were analyzed using online software PlantCARE (http://bioinformatics.psb.ugent.be/webtools/PlantCARE/htmL/).

cDNA was obtained from ‘SN742’ roots on the 14^th day after inoculation of P. brassicae (at this time, P. brassicae spores were found in root hairs under the compound microscope) and on the 42^nd day after inoculation (at this time, obvious swelling appeared in the roots), respectively. In addition, the roots cDNA of uninoculated ‘SN742’ and ‘SN205’ at above same stage was used as control and then to analyze the difference of BrRPP1 expression between resistance and susceptible materials. Using Quantstudio6 (ThermoFisher, Waltham, MA, USA) and the fluorescence quantification kit UltraSYBR Mixture (Low ROX, Cwbio, Jiaosu, China), we analyzed the expression pattern of BrRPP1 in the roots of Chinese cabbage at two sampling stages after infection by P. brassicae by qRT-PCR. The specific primers were designed, and the BrActin gene (Gao et al., 2020) was used as the internal control (primers are shown in Table S1 ). The relative expression of BrRPP1 was analyzed using the 2^−ΔΔCt method (Livak and Schmittgen, 2001) and SigmaPlot 12.5 (Systat Software, Inc., San Jose, CA, USA). Three replications were performed for each different treatment. The difference significance test was analyzed using the program SPSS v.26 (IBM, Armonk, NY).

Seeds of Arabidopsis mutant rpp1 and wild-type ‘WT’ were vernalized at 4 °C low-temperature for 3-5 days and then evenly sowed in nutritious bowl. When seedlings grew to 10 true leaves, DNAs of rpp1 and ‘WT’ leaves were extracted by modified CTAB method (Springer, 2010). The ‘three-primer’ PCR was performed to select the homozygous mutants. The detection primers (LP: ACCATTCATTGTTCCTTGCAG; RP: ATGATAATGAAGGACCCCTCC; LB: ATTTTGCCGATTTCGGAAC) were obtained from the SIGnAL website (http://signal.salk.edu/tdnaprimers.2.htmL). The homozygous mutants were further cultured until offsprings were obtain.

The P. brassicae suspension with a concentration of 10⁷/mL was prepared according to Lv et al. (2021). The seeds of the rpp1 and ‘WT’ were sterilized and seeded in a petri dish containing moist filter paper to accelerate germination at 25 °C. After about 24 hours in darkness, the culture dishes were transfered into a light incubator at 25 °C, with 16 hours of light and 60% humidity. When two cotyledons were extended, P. brassicae suspension were sprayed on the roots of mutant rpp1 and ‘WT’ for inoculation. Five randomly selected plants were observed at 24 h intervals. The roots of seedlings were cut into 1 cm sections, dyed with 1% toluidine blue for 15 min, and decolorized with sterile water for 5 min, and then observed under a composite microscope (Eclipse 80i; Nikon, Tokyo, Japan).

To construct the 35S::pGPTVII.GFP-BrRPP1 expression vector, the BrRPP1 coding sequence with the termination codon removed was amplified from pBWA(V)BS-SN205-BrRPP1 using BrRPP1-GFP-F:CGCCACTAGTGGATCCatgagatttcgatcgtttttgaaaga; BrRPP1-GFP -R:GAGCGGTACCCTCGAGacatgagggagccaaggtttcc, and inserted into the pGPTVII.GFP vector using NovoRec homologous recombinase (Novprotein, Shanghai, China).

The plasmid of 35S::pGPTVII.GFP-BrRPP1 and 35S::pGPTVII.GFP (as a control) was introduced into Agrobacterium strain GV3101 respectively. The strains were injected into 4-week-old tobacco leaves as described previously (Sainsbury et al., 2009). After 48 hours in darkness, the tobacco leaves were stained with 4,6-diamidino-2-phenylindole (DAPI, Coolaber, Beijing, China), and observed under a Confocal laser microscope (TCS SP8-SE, Leica, Wetzlar, Germany).

To construct pGBKT7-BrRPP1 bait vector, the BrRPP1 coding sequence with the termination codon removed was amplified from pBWA(V)BS-SN205-BrRPP1 using BrRPP1-BD-F: CGCACTAGTGGATCCatgagatttcgatcgtttttgaaaga and BrRPP1-BD-R: AAGGAAAAAAGCGGCCGCacatgagggagccaaggtttcc, and the products and PGBKT7-T7 were respectively digested with BamHI and NotI (NEB, Beijing, China) and connected. The obtained pGBKT7-BrRPP1 bait vector was transferred into the freshly prepared competent cells of Y2H yeast. The self-activation and toxicity of positive colonies and yeast library screening was carried out by mating hybridization according to Xu et al. (2020). Functional annotation of candidate interaction proteins of BrRPP1 obtained from the screening library were analyzed by NCBI and Brassica database, and the expression pattern of those proteins with high detection rate was analyzed by qRT-PCR (primers are shown in Table S1 ).

The reference sequence of BrRPP1 gene (Bra019410) obtained from Brassica database contains an open reading frame (ORF) with a length of 3471 bp, which is located on chromosome A03. The accession number of Bra019410 in the NCBI database is XM_009138983.3. The conservative structure domain prediction of BrRPP1 showed that there are a TIR conserved domain in the region of 85-259 aa, and a LRR conserved domain in the region of 690-929 aa ( Figure 1A ). Therefore, BrRPP1 is a TIR-NBS-LRR-like protein.

The lengths of products amplified by BrRPP1-1, BrRPP1-2 and BrRPP1-3 were 1141 bp, 1654 bp and 617 bp, respectively, and the results were consistent in ‘SN205’ and ‘SN742’ ( Figure 1B ). The ligation products of the three cDNA fragments were both 3471 bp in ‘SN205’ and ‘SN742’ ( Figure 1C ). Comparing the cDNA sequences of BrRPP1 from ‘SN205’ and ‘SN742’ with the reference genome, it was found that the sequence in ‘SN742’ is consistent with the reference sequence. However, it is cDNA different between ‘SN205’ and reference sequence, with four single nucleotide polymorphisms (SNPs) (G to A, T to C, G to A and A to C) in the 3450-3471 bp region ( Figure 1D ). The change of base leads to the change of amino acid sequence and three-dimensional structure of BrRPP1 protein ( Figures 1E, F ).

The upstream 1167 bp promoter region of coding sequence of BrRPP1 were cloned from ‘SN205’ and ‘SN742’. Sequences alignment found that there are two additional insert fragments (IF-1, IF-2) and multiple SNPs in the promoter region of BrRPP1 in the ‘SN205’ compared with in the ‘SN742’. The prediction of promoter elements found that the BrRPP1 promoter region amplified form ‘SN742’ or ‘SN205’ contains basic elements, light-responsive elements and corresponding elements of biotic and abiotic stress ( Table 2 ). However, the number of cis-acting elements was different in the two materials. Analyzing the difference of biotic and abiotic stress elements in BrRPP1 promoter between ‘SN205’ and ‘SN742’, it was found that there was a MYC transcription factor binding site in one of inserted segments (IF-1) in BrRPP1 promoter of ‘SN205’, and a MYB binding site was truncated by the inserted segment IF-1. In addition, compared with BrRPP1 promoter of ‘SN742’, an ARE element was missing and an ARBE element was adding in that of ‘SN205’ ( Figure 2 ).

In order to analyze the expression pattern of BrRPP1 gene, qRT-PCR showed that there was no significant difference between the expression level of BrRPP1 in ‘SN742’ roots of 14^th and 42^nd days after inoculation of P. brassicae and that in uninfected roots of Chinese cabbage ( Figure 3A ). However, the comparative analysis of the expression of BrRPP1 between ‘SN742’ and ‘SN205’ showed that it was significantly higher in ‘SN205’ than in ‘SN742’ at both sampling dates ( Figure 3B ).

Identification of Arabidopsis mutants by ‘three-primers’ showed that a fragment of about 1280 bp was amplified in No.1 and No.3 by LP+RP, and a fragment of about 720 bp was amplified in No.2, 3, 4, 5 and 6 by LB + RP ( Figure 4A ). In theory, LP and RP are located on both ends of T-DNA insertion site, and LB is located at T-DNA insertion site, the length of LP + RP amplification products should be 1280 bp, and the length of LB + RP amplification products should be 594-894 bp.

There was only a band of 1280 bp in No. 1, so it was a wild-type mutant without T-DNA insertion, while two bands of 1280 bp and 720 bp was amplified in No.3, so it was a heterozygous mutant with unilateral T-DNA insertion. There was only a band of 720 bp in No. 2, 4 and 6, so they were homozygous mutants.

After infection with P. brassicae, the roots of ‘rpp1’ and ‘WT’ were both not be infected within 24 h. After 48 h, primary spores appeared in the root hairs of the ‘rpp1’ mutants, while zoospores only attached to the surface of root hair of ‘WT’. After 72 h, the root hair of ‘rpp1’ was more severely infected by spores, and the primary spores appeared in the root hairs of ‘WT’ ( Figure 4B ). The results indicated that the absence of RPP1 could accelerate the infection process of P. brassicae.

After A. tumefaciens infection solution containing pGPTVII.GFP-BrRPP1 plasmid was injected into tobacco leaves, observation under Confocal laser microscope found that pGPTVII.GFP-BrRPP1 carrier only produced fluorescence signal in the nucleus, and the fluorescence signal overlapped with DAPI nuclear dye ( Figure 5 ).

The toxicity test results of pGBKT7-BrRPP1 showed that the yeast strains containing pGBKT7-BrRPP1 could grow normally on SD/-Trp medium plate, and there was no significant difference in colony size and number between the strains containing pGBKT7-BrRPP1 and those containing pGBKT7-T, which indicated that BrRPP1 is not toxic to yeast growth ( Figure 6A ).

To avoid the false positive interaction proteins caused by the self-activation of pGBKT7-BrRPP1, self-activation analysis found that the yeast colonies co-transfected with pGBKT7-BrRPP1 and pGADT7-T could grow normally on DDO deficient medium, indicating that pGBKT7-BrRPP1 and pGADT7-T were successfully co-transfected into yeast cells. On the QDO/X/A medium, the positive control group (pGBKT7-53 + pGADT7-T) grew normally, activated the reporter genes and showed blue colonies. However, the negative control group (pGBKT7-Lam + pGADT7-T) could not grow on the QDO/X/A medium. The experimental group (pGBKT7-BrRPP1 + pGADT7-T) also could not grow on the QDO/X/A medium, indicating that the bait vector pGBKT7-BrRPP1 had no self-activation effect and could be used for yeast two-hybrid library screening ( Figure 6B ). Through Y2H library screening, 35 positive colonies were screened on QDO/X/A medium, which may interact with BrRPP1. The length of the inserted fragments of these clones ranged from 750-1000 bp ( Figure 6C ).

Functional analysis of these candidate interacting proteins shows that they participate in six pathways, including programmed cell death, JA pathway, plant cell wall synthesis, plant photosynthesis, nitrogen metabolism and transcriptional regulation. XM_009125371.3 (cytochrome c6, Cytc) involved in programmed cell death, the detection rate was 17.14%; XM_009112750.3 (Phospholipase A1, PLA1) involved in the synthesis of jasmonic acid (JA), the detection rate was 14.28%; XM_013801607.2 (galacturonosyltransferase 8-like, GT8) involved in cell wall modification, the detection rate was 11.42%; XM_009151660.3 (HNH endonuclease, HNH), XM_018654018.2 (phosphoribulokinase, PRK) and XM_009132313.1 (oxygen enhancing protein, OEE) involved in photosynthesis, the detection rate were 17.14%, 14.28% and 11.42% respectively. The detection rate of other candidate proteins is lower than 3%. In addition, there were two other unknown functional proteins ( Table 3 ).

In order to further analyze whether the expression of these candidate interacting proteins were influenced by P. brassicae infection, qRT-PCR results showed that the gene expression of all of these proteins were significantly changed after infection with P. brassicae. After inoculation treatment by P. brassicae, XM_009132313.1 and XM_018654018.2 were only significantly down-regulated expressed at the early stage of infection, and the expression of XM_009125371.3 and XM_009151660.3 were significantly up-regulated at both sampling dates, and XM_013801607.2 was significantly down-regulated at both sampling dates, while the expression of XM_009112750.3 was significantly down-regulated on the 14^th day, and significantly up-regulated on the 42^nd day ( Figure 7A ). In addition, expression differences of these genes were also happened between ‘SN205’ and ‘SN742’ ( Figure 7B ).

The clubroot disease caused by the P. brassicae has seriously affected the economic value of cruciferous crops. At present, many R genes to clubroot disease have been mapped in Chinese cabbage. As a common candidate gene for Rcr1 and Rcr2 (Chu et al., 2014; Yu et al., 2016; Huang et al., 2017), Bra019410 was a highly homology protein with RPP1 in Arabidopsis, so it was named BrRPP1. Through the analysis of the conservative domain, we found that the protein contains TIR and LRR and other conservative domains, belonging to TIR-NBS-LRR proteins ( Figure 1A ). The LRR domain of TIR-NBS-LRR has the function of identifying pathogens and can trigger the ETI resistance of plants (Ghelder and Esmenjaud, 2016). Previous studies have confirmed the LRR domain of RPP1-NdA (allele of RPP1) of hyaloperospora Arabidopsidis can recognize the effector protein ATR1 of the oomycete pathogen, but the LRR domain alone cannot activate the hypersensitivity of plants, which indicates that other domains of RPP1 have signal transduction functions (Steinbrenner, 2015).

After cloning and sequencing of cDNA sequence of BrRPP1 in ‘SN205’ and ‘SN742’, it was found that the cDNA sequence was different between ‘SN205’ and ‘SN742’, and the difference mainly occured after the LRR conservative domain ( Figure 1 ). In addition, sequence and elements number of BrRPP1 promoter were significantly differences between resistant and susceptible materials ( Figure 2 ). The analysis of gene expression pattern showed that the expression of BrRPP1 was not affected by the infection of P. brassicae, while the expression of BrRPP1 in ‘SN205’ was significantly higher than that in ‘SN742’ ( Figure 3 ). Therefore, it can be inferred that the sequence and the expression difference of BrRPP1 leads to resistance difference between resistant and susceptible materials.

Arabidopsis thaliana can also be infected by P. brassicae, so it can be used as a useful model host for studying the clubroot disease (Koch et al., 1991; Mithen and Magrath, 1992; Ludwig-Müller et al., 2009). In order to confirm the disease resistance of BrRPP1, the disease resistance of the Arabidopsis mutant rpp1 was identified. The results showed that the deficiency of RPP1 accelerated the infection of P. brassicae, which indicated that BrRPP1 should play a role in disease resistance to P. brassicae ( Figure 4 ).

In order to analyze the expression site of BrRPP1 in cells, we constructed the expression vector pGPTVII.GFP-BrRPP1 for subcellular localization analysis. In previous subcellular localization studies, the RPP1-WsA fragment was located in the endoplasmic reticulum and Golgi apparatus, RPP1-WsB fragments are located in the plasma membrane, and RPP4 and RPP8 fragments are located in the nucleus (Takemoto et al., 2012). However, the localization result of the N-terminal fragment alone cannot completely determine the expression pattern of the full-length protein. GhTIR-NBS-LRR1 containing the structure of TIR-NBS-LRR was a homologous protein of BrRPP1, which localized in the nucleus (Li et al., 2019). This result provided a reference for our prediction results. In this experiment, Confocal laser microscope observation showed that pGPTVII.GFP-BrRPP1 appeared fluorescence signal in the nucleus, which confirmed BrRPP1 was expressed in the nucleus ( Figure 5 ). Therefore, yeast two-hybrid screening can be carried out using nuclear library.

The RPP1 (Recognition of Peronospora parasitica1) was first found in Arabidopsis ‘Wassilewskija’ (Botella, 1998). The current research about RPP1 is mostly in its interaction with effector proteins, intramolecular interactions and the process of inducing plant cell death. The Arabidopsis RPP1 is a typical TIR-NBS-LRR gene, RPP1 has been shown to be able to directly recognize pathogens in Arabidopsis thaliana, and it also has an indirect recognition function by recognizing the target proteins of pathogenic effector proteins (Renier et al., 2008). TIR domain in RPP1 has been confirmed to have a self-binding effect, which plays an important role in inducing cell death (Wan et al., 2019). In this study, 35 interacting proteins of BrRPP1 were screened by yeast-two hybrid. Among them, Cytochrome C (Cytc) is widely present in the mitochondria of plants and organisms, and is considered to be related to the programmed cell death. The release of Cytc from mitochondria is common in the process of programmed cell death in plant cells (Vacca et al., 2006; Qi et al., 2018; Matilla, 2021). Wang et al. (2016) also found that rice NBS-LRR disease-resistant protein Pik-h interacts with Cytochrome c oxidase assembly protein (COX11). In our study, it was found that the expression of Cytc was significantly up-regulated after infection by P. brassicae, and its expression was significantly different between resistant and susceptible materials ( Figure 7 ). Therefore, we can speculate that BrRPP1 as a TIR-NBS-LRR gene may regulate the programmed death of plant cells by promoting the release of cytochromes.

Jasmonic acid (JA) defense response is necessary for defense against biotic stress (Wasternack, 2007). AtPLAs family is involved in the transduction of auxin and pathogen signals (Holk et al., 2002). PLA2 can be strongly induced when tobacco is infected by bacterium Erwinia carovora or the fungus Botrytis cinerea, and accumulate large amounts of JA and 12-oxo-phytodienoic acid (Dhondt et al., 2010). We also found that a lipoyl hydrolase phospholipase A1 (PLA1) interacts with BrRPP1, which is homologous to Arabidopsis AtPLAIIα ( Table 3 ).

There is a conflict between the understanding of relationship of JA pathway and the infection of P. brassicae. Eight genes related to JA biosynthesis and signaling were down-regulated in Brassica rapa ‘CR BJN3-2’ at early defense response induced by P. brassicae infection (Chen et al., 2016). Jubault et al. (2013) also reported the occurrence of a suppressed JA/ET signaling pathway in Arabidopsis on the 7^th day after infection by P. brassicae. However, in the transcriptome experiment of Luo et al. (2018), the JA pathway was significantly up-regulated after infection by P. brassicae. Lemarié et al. (2015) demonstrated that both the SA and JA pathways contribute to resistance against P. brassicae in Arabidopsis.

In our research, the relative expression of PLA1 was significantly down-regulated on the 14^th day after infection by P. brassicae, while the expression was significantly up-regulated on the 42nd day after infection, and its expression was significantly different between resistant and susceptible materials ( Figure 7 ). Therefore, we speculate that BrRPP1 may interact with PLA1 to mediate the regulation of JA, but the process of JA pathway is complex in response to infection of P. brassicae. The confliction of JA pathway responsing to infection of P. brassicae should be from the different detection stage after infecting by P. brassicae.

In addition, one of the screened interacting proteins of BrRPP1, XM_013801607.2, belongs to the glycosyltransferase family 8 (GT8), which has high homology with Arabidopsis AtGAUT8 (At3g25140). It has been proved that alpha-galacturonosyltransferase (GAUT) can synthesize pectin with UDP-GalA as substrate to participate in the synthesis of plant cell wall (Sterling et al., 2006). Plant cell walls provide a structural framework to support plant growth and act as the first line of defense when plants encounter pathogens (Houston et al., 2016). The changes of cell wall components affect the downstream functions of cells as storage units, structural networks and solute transporters. In many cases, it also affects the ability of cells to respond to stress caused by pathogens and the environment (Tucker et al., 2018). Genes encoding enzymes that can synthesize or hydrolyze plant cell wall components show different expressions under different pressures, indicating that they may promote stress tolerance by changing cell wall components (Seki et al., 2002). The arabinogalactan protein (Unigenes40439), a cell wall component, was changed significantly after infection by P. brassicae (Luo et al., 2018). In this study, the relative expression of GT8 was significantly down-regulated after infection by P. brassicae, and its expression was significantly different between resistant and susceptible materials ( Figure 7 ). Therefore, it can be speculated that BrRPP1 may modify the plant cell wall to respond to the infection of P. brassicae by regulating glycosyltransferase.

Among these interacting proteins, some proteins related to plant photosynthesis have been found, including oxygen-evolving enhancer protein (OEE), phosphoribulokinase (PRK) and His-Asn-His endonuclease (HNH) ( Table 3 ).

OEE is the peripheral protein of photosystem II and plays an important role in the oxygen releasing activity of photosystem II (Seidler et al., 1996). Studies have found that Arabidopsis oxygen enhanced protein AtOEE2 may participate in the generation of reactive oxygen species in the ETI reaction of plants by acting as the downstream signal of WAK1 (Yang et al., 2003). Oxygen enhancing protein has been proved to be involved in the transduction of disease resistance signals. The Phytophthora capsici Effect Factor RxLR19781 can regulate its zoospore infection by combining with the oxygen enhancing NbOEE2, which is the target protein of the effector protein of pathogenic bacteria (Liang et al., 2019). In this study, it was found that the expression of OEE was significantly down-regulated on the 14^th day after inoculation of P. brassicae, and its expression level in resistant and susceptible materials was significantly different ( Figure 7 ), so we speculated that OEE, as a peripheral protein of photosystem II, may be the target protein of effector protein of P. brassicae, and participate in the indirect recognition of BrRPP1 to P. brassicae.

The PRK is a part of the Calvin cycle of plant dark reaction, which exists in chloroplasts, and is responsible for the fixation of CO₂ in photosynthetic organisms by catalyzing ribulose 5-phosphate to form the CO₂ receptor ribulose 1, 5-diphosphate (Hariharan and Cattolico, 1998). Although people usually focus on the role of PRK in carbon assimilation and in the light environment, PRK also plays a role in biological and abiotic stresses. For example, OsPRK gene may participate in the induced defense response of rice to pests (Chen et al., 2020), and PRK in wheat responded to the infection of Puccina striiformis (Liang et al., 2007). In this study, it was found that the expression of PRK was significantly down-regulated after inoculation with P. brassicae, and its expression was significantly different between resistant and susceptible materials ( Figure 7 ). This suggests that PRK, as a part of the Calvin cycle of plant dark reaction, may respond to the infection of P. brassicae.by interacting with BrRPP1,

The HNH nuclease domain contains three of the most conserved His and Asn amino acid residues and has DNA cleaving activity (Zhang et al., 2016). The role of proteins containing HNH nuclease motif has been rarely reported in plants. A recent study showed that a White Stripe Leaf 9 (WSL9) protein containing HNH domain plays a crucial role in the early development of chloroplasts (Zhu et al., 2020). There is no report on the role of HNH in disease resistance. In this study, it was found that HNH interacted with BrRPP1, and its expression was significantly down-regulated after being infected by P. brassicae. The expression of HNN was significantly different between resistant and susceptible materials ( Figure 7 ). This result suggests that HNH plays a crucial role in the early development of chloroplasts, and may respond to the infection of P. brassicae.

Above all, OEE, PRK and HNH all participate in plant photosynthesis, and respond to the infection of P. brassicae by interacting with BrRPP1.