Watermelon (Citrullus lanatus) cv. Zaojia was used for all experiments. Nicotiana benthamiana plants expressing a known nucleus-localized marker protein RFP-H2B (Chakrabarty et al., 2007) were used for subcellular localization and bimolecular fluorescence complementation (BiFC) assays. Plants were grown in a soil mix (clay: soil = 3:1) in a growth room under fluorescent light (200 μE m² s^–1) at 22–24°C with 70% relative humidity (RH) and a 14 h light/10 h dark cycle. Arabidopsis seeds were surface sterilized in 75% ethanol for 5 min and 4% sodium hypochlorite for 10 min, rinsed with sterile water for three times, sowed on 1/2 MS plates and vernalized for 2 days at 4°C. Arabidopsis seedlings were grown on 1/2 MS plates at 22°C with 75% RH with a 16 h light/8 h dark cycle for 7 days and then transplanted to a soil mix (clay: soil = 1:1) in a growth room at 22°C with 75% humidity under a 16 h light/8 h dark cycle for normal growth or under a 8 h light/16 h dark cycle for disease assays.

For analysis of tissue-specific expression, leaf, stem and root samples of 4-week-old watermelon plants were collected and stored at −80°C till use. For SA and MeJA treatment, 4-week-old watermelon plants were treated by foliar spraying with 1 mM SA, 100 μM MeJA or an equal volume of solution containing only 0.1% ethanol and 0.02% Tween-20 as controls, and leaf samples were collected at different time points after treatment.

For analysis of gene expression in response to Fon infection, pathogen inoculation was performed according to a previously reported method (Song et al., 2015). Briefly, mycelial plugs from 6-day-old culture of Fon race 1 strain ZJ1 were transferred into 200 mL mung bean liquid broth (mung bean 20 g/L, boiled for 20 min, pH7.0) and incubated with shaking (250 rpm) at 26°C for 2 days. Spores were collected and spore suspension was adjusted to 1 × 10⁷ spores/mL for inoculation. Three-week-old watermelon plants were uprooted, washed in tap water, the main roots were cut up of one-third, and then dipped for 15 min in Fon spore suspension or in mung bean liquid broth as mock-inoculated controls. The inoculated plants were replanted in soil and allowed to grow in the same growth room as described above. Root samples were collected, frozen in liquid nitrogen and stored at −80°C until use.

Db strain DBTL4 was grown at 26°C on PNA (potato 200 g/L, NH₄H₂PO₄ 2 g/L, agar 15 g/L, pH7.0) for 6–7 days in dark and then treated with a 12 h UV light/12 h dark cycle for 5 days to induce spore production. After induction, the mycelial plugs were picked into distilled water, spores were collected and the spore suspension was adjusted to 2 × 10⁶ spores/mL. Five-week-old watermelon plants were foliar sprayed with Db spore suspension containing 0.05% Tween-20 or with an equal volume of 0.05% Tween-20 solution as mock controls. The inoculated plants were placed in a 22°C chamber with 100% RH for 48 h. Leaf samples were collected, frozen in liquid nitrogen, and stored at −80°C until use.

Arabidopsis AtMBD protein sequences were obtained from TAIR¹ and were used as queries to search for putative MBD genes and proteins in watermelon, melon, cucumber, pumpkin, and zucchini genomes at Cucurbit Genomics Databases.² The obtained nucleotide and protein sequences were examined by domain analysis programs PFAM³ (PF01429) and SMART⁴ with the default cutoff parameters. The isoelectric points and molecular weights were predicted on the ExPASy Proteomics Server.⁵ Sequence alignment was carried out by the ClustalX program. Phylogenetic trees were constructed using the neighbor-joining method of the MEGA7 program with the p-distance and complete deletion option parameters.

The reliability of the obtained trees was tested using a bootstrapping method with 1,000 replicates. The MCScanX algorithm with default parameters (Wang et al., 2012) was used to scan orthologous regions containing the watermelon ClMBD genes. The corresponding plot was created by Dual Synteny Plot for MCscanX in TBtools software (Chen et al., 2020). The chromosomal localization of ClMBDs in the C. lanatus genome was obtained by TBtools software (Chen et al., 2020) according to the annotation data of the C. lanatus genome. The genomic and annotation data of melon, cucumber, zucchini, and pumpkin were downloaded from the Cucurbit Genomics Database (see text footnote 2), and those of Arabidopsis were downloaded from TAIR (see text footnote 1). The synteny relationship of the orthologous MBD genes obtained between watermelon and other selected species was visualized by the Advance Circos package of TBtools (Chen et al., 2020). DnaSP software was used to calculate the non-synonymous (Ka)/synonymous (Ks) values of the duplicated ClMBD gene pairs (Librado and Rozas, 2009).

Total RNA was extracted using RNA Isolater reagent (Vazyme, Nanjing, China) according to the manufacturer’s instructions. RNA was treated with RNase-free DNase and then reverse-transcribed into cDNA using the HiScript QRT SuperMix kit (Vazyme, Nanjing, China). The obtained cDNAs were used for cloning, semi-RT-PCR and qRT-PCR. The coding sequences (CDs) of ClMBDs were amplified using gene-specific primers (Supplementary Table 1) and cloned into pCAMBIA1300s vector, yielding pCAMBIA1300s-ClMBDs-GFP. After confirmation by sequencing, these pCAMBIA1300s-ClMBDs-GFP plasmids were used as templates to amplify the target genes for further experiments.

The recombinant pCAMBIA1300s-ClMBDs-GFP plasmids were transformed into Agrobacterium tumefaciens strain GV3101. Agrobacteria carrying pCAMBIA1300s-ClMBDs-GFP or pCAMBIA1300s-GFP were separately infiltrated into leaves of Nicotiana benthamiana plants expressing a known nucleus-localized marker protein RFP-H2B (Chakrabarty et al., 2007). At 48 h after agroinfiltration, GFP fluorescence signals were excited at 488 nm and detected under a Zeiss LSM780 confocal laser scanning microscope (Zeiss, Oberkochen, Germany) using a 500–530 nm emission filter.

Putative interactions between ClMBDs and ClIDM2 or ClIDM3 were examined using the yeast two-hybrid (Y2H) System according to the manufacturer’s instructions (Clontech, Mountain View, CA, United States). The CDs of ClMBDs were amplified using gene-specific primers (Supplementary Table 1) from pCAMBIA1300s-ClMBDs-GFP and cloned into pGBKT7 vector, yielding pGBKT7-ClMBDs. ClIDM2 and ClIDM3 were obtained by homologous searching using Arabidopsis AtIDM2 and AtIDM3 as queries and the CDs of ClIDM2 and ClIDM3 were amplified with gene-specific primers (Supplementary Table 1) and cloned into pGADT7 vector, generating pGADT7-ClIDM2 and pGADT7-ClIDM3. The resultant pGBKT7-ClMBD plasmids were transformed with or without pGADT7-ClIDM2 or pGADT7-ClIDM3 into yeast strain Y2HGold by the LiAc/SS carrier DNA/PEG method and confirmed by colony PCR. The transformed yeasts were cultivated on DDO (SD/-Leu/-Trp) medium (Clontech, Mountain View, CA, United States) at 30°C for 3 days, followed by screening on QDO medium containing 40 μg/mL X-α-Gal (Clontech, Mountain View, CA, United States) and 125 ng/mL Aureobasidin A (Clontech, Mountain View, CA, United States). Interactions between ClMBDs and ClIDM2/3 were evaluated according to the growth performance of the transformed yeast cells on QDO and the production of blue pigments after the addition of X-α-Gal. Co-transformation of pGBKT7-53 or pGBKT7-Lam and pGADT7-T were used as positive and negative controls, respectively.

The CDs of ClMBD2 and ClMBD3 were amplified using gene-specific primers (Supplementary Table 1) and inserted into p2YN vector, yielding p2YN-ClMBD2 and p2YN-ClMBD3. Similarly, the CDs of ClIDM2 and ClIDM3 were inserted into p2YC vector, yielding p2YC-ClIDM2 and p2YC-ClIDM3. Agrobacteria harboring different indicated pairs of plasmids were infiltrated into leaves of N. benthamiana plants expressing a red nuclear marker protein RFP-H2B (Chakrabarty et al., 2007). At 48 h after agroinfiltration, YFP and RFP signals were detected and photographed under a Zeiss LSM780 confocal laser scanning microscope (Zeiss, Oberkochen, Germany).

The CDs of the ClMBD genes were amplified using gene-specific primers (Supplementary Table 1) and inserted into pGEX-4T-3 vector, generating pGEX-4T-3-GST-ClMBDs, followed by transforming into Escherichia coli strain BL21 (DE3), a widely used non-T7 expression strain that is suitable for transformation and protein expression (New England BioLabs, Beverly, MA, United States). To induce the expression of GST-ClMBD proteins, isopropyl-D-thiogalactoside was added to the bacterial cultures to a final concentration of 1 mM and incubated at 18°C for 20 h. The recombinant GST-ClMBD fusion proteins were purified using glutathione resin columns (Genscript, Shanghai, China) according to the manufacturer’s protocol. The following double-stranded DNA probes were synthesized and used in EMSA assay: 5mCG (GCTCGTAGCTAACGAGCTCGACTCGTTGACATAGGCCAT GGCGTAGACTC) (methylated nucleotides underlined) and its complementary strand with m5C at symmetrical positions, 5mCHG (GCTCTGAGCTAACAGGCTCAGC TCTGTGACATAGGCCATGGCTGAGACTC) (methylated nucleotides underlined) and its complementary strand with m5C at symmetrical positions, 5mCHH (GCTCTTAGCTAACA AGCTCAACTCTATGACATAGGCCATGGCTTAGACTC) (methylated nucleotides underlined) and its complementary strand (GAGTCTAAGCCATGGCCTA TGTCATAGAGGTGAGCTTGTTAGCTAAGAGC) (Ito et al., 2003). Equal volumes of single-stranded DNAs were mixed in annealing buffer (10 mM Tris-HCl, 1 mM EDTA, 100 mM NaCl, pH7.5) and incubated at 85°C for 5 min to form double-stranded DNAs. EMSA was performed as previously described (Yuan et al., 2019) using LightShift Chemiluminescent EMSA Kit (Thermo Fisher Scientific, Waltham, MA, United States). In brief, binding reactions (10 μL) contained 1 μL 10 × binding buffer, 2 μg GST-ClMBD protein or GST protein (as a negative control) and 1 μL biotin-labeled 5mCG, 5mCHG, or 5mCHH probe. In the competitive reactions, unlabeled 5mCG probe was added in excess of 500 times. The binding reactions were incubated at 28°C for 20 min and separated on 6% native PAGE gels. After electrophoresis, the gels were transferred onto Amersham Hybond-N⁺ nylon membrane (GE Healthcare, Buckinghamshire, United Kingdom), and signals from the biotin-labeled probes were detected using a Chemiluminescent Biotin-labeled Nucleic Acid Detection Kit (Beyotime Biotechnology, Haimen, China) according to the manufacturer’s recommendations.

Arabidopsis transformation was performed using the floral dip method as previously described (Clough and Bent, 1998). In brief, flowers of 5-week-old Arabidopsis plants were dipped in a suspension of agrobacteria carrying pCAMBIA1300s-ClMBD-GFP plasmids for 1 min. The infected plants were placed in dark for 12 h under 100% RH, returned to the growth room with normal conditions and allowed to grow until the silique maturation. T0 seeds were surface sterilized and then plated on 1/2 MS plates containing 50 μg/mL hygromycin. After treatment at 4°C for 2 days, the plates were transferred to 22°C under a 16 h light/8 h dark cycle, seedlings showing hygromycin resistance, regarded as positive transgenic plants, were transferred in the mixed nutrient soil and allowed for growth for 5–6 weeks to collect seeds. Putative single-copy transgenic lines and homozygous lines were obtained by screening for a 3:1 segregation ratio of hygromycin-resistant (Hgr^R) character and 100% Hgr^R phenotype in T2 and T3 generations on 1/2 MS medium supplemented with 50 μg/mL hygromycin, respectively. The transcript levels of the ClMBD genes in the transgenic Arabidopsis lines were analyzed by semi-PCR and qRT-PCR. Two homozygous transgenic Arabidopsis lines with single-copy for each of the ClMBD genes (T3 generation) and similar expression levels of the transgenes were chosen for further experiments.

Disease assays with B. cinerea were performed as previously described (Wang et al., 2009). Briefly, spores were collected from 8∼10-day-old culture of B. cinerea strain BO5.10 grown on 2 × V₈ plates and resuspended in 4% maltose and 1% peptone buffer to a final concentration of 2 × 10⁵ spores/mL. Four-week-old Arabidopsis plants were inoculated by foliar spraying with the spore suspension containing 0.05% Tween-20 or with an equal volume of 0.05% Tween-20 solution as mock controls. The inoculated plants were placed in a 22°C chamber with 100% RH for 48 h, and disease development was continuously observed. Measurement of in planta fungal growth was performed by analyzing the transcript level of B. cinerea BcActin gene and comparing with the transcript level of an Arabidopsis Actin gene as an internal control according to a previously reported protocol (Wang et al., 2009).

Disease assays with Pst DC3000 were carried out as previously described (Zhang et al., 2016). Pst DC3000 was grown on King’s B (KB) broth and bacteria were collected and re-suspended in 10 mM MgCl₂ solution to OD₆₀₀ = 0.002. The bacterial inoculation was performed by hand infiltration using 1-mL syringes without needle into rosette leaves of 4-week-old Arabidopsis plants and the inoculated plants were kept in sealed containers 22°C for 72 h. For quantification of in planta bacterial growth, leaf discs from inoculated leaves were collected and homogenized in 10 mM MgCl₂. After a series of gradient dilutions, the homogenate was plated on KB plates supplemented with 25 μg/mL rifampicin and bacterial colonies were counted at 3 days after incubation at 28°C.

Detection of H₂O₂ was performed using the DAB staining method (Thordal-Christensen et al., 1997). Leaf samples were collected from Arabidopsis plants with or without infection of B. cinerea at 24 h post inoculation (hpi) and dipped into DAB solution (1 mg/mL) in 10 mM Na₂HPO₄ (pH7.0). After incubation for 5 h in dark with shaking (80 rpm) at room temperature, the DAB-treated leaves were transferred into acetic acid/glycerol/ethanol (1:1:1, vol/vol/vol) and boiled for 5 min, followed by several washes with the same solution. The DAB-stained leaves were photographed using a digital camera.

Leaf samples were collected from 4-week-old Col-0 and ClMBD2-OE2 Arabidopsis plants, frozen in liquid nitrogen and stored at −80°C. RNA-seq was performed by BioMarker Technologies (Beijing, China) on Hiseq 2500 platform (Illumina). Raw data were filtered to get clean data, sequence comparison with the GCF_000001735.4_TAIR10.1. FPKM (Fragments Per Kilobase of transcript Per Million Fragments Mapped) was used to analyze the level of gene expression (Florea et al., 2013). The expression changes of differentially expressed genes (DEGs) ≥ 1.5-fold and P-value < 0.05. Gene Ontology (GO) enrichment analysis of DEGs was implemented by the GOseq R packages based Wallenius non-central hyper-geometric distribution (Young et al., 2010). KOBAS (Mao et al., 2005) software were used to test the statistical enrichment of differential expression genes in KEGG pathways (Kanehisa et al., 2008).

Extraction and treatment of total RNA were performed as mentioned above. Semiquantitative RT-PCR reactions contained 0.5 μL Phanta Max Super-Fidelity DNA Polymerase (Vazyme, Nanjing, China), 0.5 μL dNTP Mix, 12.5 μL 2 × Phanta Max Buffer, 0.1 μg cDNA, 7.5 pmol of each of gene-specific primers (Supplementary Table 1), and 8.5 μL ddH₂O in a final volume of 25 μL. Arabidopsis AtActin was used as the control. Each qPCR reaction contained 10 μL 2 × AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China), 0.1 mg cDNA and 7.5 pmol of each of gene-specific primers (Supplementary Table 1) in a final volume of 20 mL, and had two independent biological replicates. The qPCR was performed in a CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, United States). Watermelon ClGAPDH or Arabidopsis AtActin were used as internal controls to normalize the data. Relative gene expression level was calculated using 2^–△△CT method as described.

All experiments were independently repeated three times and the obtained data were subjected to statistical analysis according to the Student’s t-test. The probability values of p < 0.05 were considered as significant difference between the treatments and corresponding controls.

To identify putative ClMBD genes in watermelon, BLASTp searches were performed against the watermelon genome database using the Arabidopsis AtMBDs as queries and 10 non-redundant sequences that are putative ClMBD genes were identified (Table 1). For convenience, unique identities to each of the identified ClMBD genes were assigned as ClMBD1–10 according to their chromosomal locations (Table 1). The CDs of ClMBD1–10 were confirmed by cloning of the full-length cDNAs using primers designed according to their predicted cDNA sequences. The sizes of the ClMBD open reading frames (ORF) ranged from 798 bp (ClMBD2) to 6,636 bp (ClMBD8) and the sizes of the encoded proteins varied from 265 amino acids (ClMBD2) to 2,211 amino acids (ClMBD8), with molecular weight of 23.34∼244.99 kDa and pI of 4.80∼9.49 (Table 1). Similarly, the MBD families in other cucurbit plants were also characterized and 9, 10, 15, and 16 MBD genes in melon, cucumber, zucchini, and pumpkin, respectively, were identified (Supplementary Table 2).

The 10 ClMBD genes are unevenly distributed on eight chromosomes in the watermelon genome and chromosomes 2, 4, and 8 do not host any ClMBD gene (Table 1 and Supplementary Figure 1). Chromosomes 9 and 11 harbor two ClMBD genes while each of the other chromosomes 1, 3, 5, 6, 7, and 10 carry one ClMBD gene (Table 1 and Supplementary Figure 1). Phylogenetic tree analysis revealed that the watermelon ClMBD proteins were divided into two clades: Clade I contained six ClMBD proteins (ClMBD1, 3, 4, 5, 6, and 9) while Clade II contained four ClMBD proteins (ClMBD2, 7, 8, and 10) (Figure 1A). Phylogenetic tree analysis of the MBD proteins from cucurbit plants showed that the MBD proteins from watermelon, melon, cucumber, pumpkin, and zucchini have a high level of similarity in the amino acid sequences (Supplementary Figure 2).

The structure of the ClMBD genes in the CDs is highly divergent in terms of the exon and intron numbers, with two (ClMBD9) to 11 (ClMBD8) exons and one (ClMBD9) to 10 (ClMBD8) introns (Figure 1B). A similar diverse exon-intron structure was also observed in the MBD genes in other cucurbit plants such as melon, cucumber, zucchini, and pumpkin (Supplementary Figure 3). The divergent gene structure may imply that the MBD genes in cucurbit plants possess divergent functions during their evolution.

The ClMBD proteins contain a characteristic conserved MBD domain (Figure 1C), ranging from 60 to 125 aa in size. The MBD domains in ClMBDs show 13∼43% of sequence identity and harbor some conserved amino acids, e.g., 15W/F, 35Y/F, 38P, and 54L/V (Supplementary Figure 4). Notably, ClMBD1 and ClMBD3 have two MBD domains while the other ClMBDs contain a single MBD domain (Figure 1C). Except for ClMBD7 whose MBD domain locates at the C-terminal, the MBD domains are generally located as the N-terminals in the ClMBD proteins (Figure 1C). ClMBD1, 2, 3, 4, 6, and 9 harbor the sole conserved MBD domains, while ClMBD5, 7, 8, and 10 contain other conserved domains in addition to the MBD domain (Figure 1C). For example, ClMBD5 has a Glycoside Hydrolase Family 17 domain; ClMBD10 has a zf-CW domain; ClMBD7 has a SPARK domain, a PKINase domain, a zf-CW domain; ClMBD8 has a Bromo Domain, a WHIM1 domains and 2 PHD domains (Figure 1C). Similar features in the presence of conserved amino acids in MBD domains (Supplementary Figure 4) and of the additional conserved domains in MBD proteins from melon, cucumber, zucchini, and pumpkin (Supplementary Figure 5) were also detected. The divergence of conserved domains between watermelon and other cucurbit plants may result in the diversity of functions and complexity of the biochemical and molecular mechanisms of the MBD proteins in plants.

Gene duplication events in ClMBDs in the watermelon genome were detected and seven gene pairs, ClMBD1/3, ClMBD4/5, ClMBD4/6, ClMBD4/9, ClMBD5/6, ClMBD5/9, and ClMBD6/9, were localized in duplicated genomic regions (Figure 1D), implying the occurrence of gene duplication during the evolution of the ClMBD gene family in watermelon. The Ka/Ks ratios of ClMBD1/3, ClMBD4/6, ClMBD4/9, ClMBD5/6, ClMBD5/9, and ClMBD6/9 were < 1 (Supplementary Table 3), indicating that these gene pairs evolved through purifying selection. Interspecific collinearity analyses identified 9, 15, 20, 19, and 26 collinear gene pairs between watermelon and other tested plant species Arabidopsis, melon, cucumber, zucchini, and pumpkin, respectively (Figure 2 and Supplementary Table 4). Some ClMBD genes, e.g., ClMBD4 and ClMBD6, were found to be associated with at least 15 collinear gene pairs identified between watermelon and other tested plant species (Supplementary Table 4), indicating that ClMBD4 and ClMBD6 may play essential roles during evolution of the ClMBD genes. ClMBD2, 4, 6, 8, and 9 showed syntenic relationships with corresponding MBD genes in Arabidopsis and other cucurbit crops (Figure 2 and Supplementary Table 4), implying that these pairs of collinear genes may already exist before the ancestral divergence. Particularly, a total of 19,252 collinear gene pairs were identified between watermelon and melon, and 8 watermelon ClMBD genes on 6 chromosomes (Chr03, Chr06, Chr07, Chr09, Chr10, and Chr11) and 8 melon CmMBD genes on 6 chromosomes (Chr01, Chr02, Chr04, Chr05, Chr07, and Chr12) constituted 15 collinear gene pairs (Figure 2 and Supplementary Table 4). Four colinear gene pairs of watermelon ClMBDs distributed on each of Chr06, Chro9, and Chr11, while one colinear gene pair existed on each of Chr03, Chr07, and Chr10 (Figure 2 and Supplementary Table 4). These genes may originate from the same ancestors. Overall, there are more collinear gene pairs between watermelon and other cucurbit plants, indicating that these species were associated with the phylogenetic relationship and that the ClMBD gene family may be considered as marker genes in plant evolutionary.

To explore the subcellular localization of the ClMBD proteins, agrobacteria carrying ClMBD1–10-GFP or GFP was infiltrated into leaves of N. benthamiana plants expressing a red nuclear marker RFP-H2B protein (Chakrabarty et al., 2007). The ClMBD1–10-GFP protein was solely localized to the nucleus, which was co-localized with the known nucleus marker RFP-H2B protein (Figure 3A). By contrast, GFP alone distributed ubiquitously throughout the cell without specific compartmental localization (Figure 3A). These results indicate that ClMBD1-ClMBD10 are nucleus-localized proteins.

The Arabidopsis AtMBD7 interacts with AtIDM2 and AtIDM3 to activate ROS1 to function in demethylation (Lang et al., 2015). To examine whether the ClMBD proteins have similar properties, the interactions of ClMBDs with ClIDM2 and ClIDM3 were examined. In Y2H assays, ClMBD2 and ClMBD3 interacted with ClIDM2 and ClIDM3, but the remaining ClMBDs did not (Supplementary Figure 6). Due to self-activation of ClMBD2 and ClIDM3 in Y2H, the interactions of ClMBD2 and ClMBD3 with ClIDM2 and ClIDM3 were further confirmed using the BiFC assays. YFP signal was not detected in N. benthamiana leaves co-infiltrated with agrobacteria harboring p2YN-ClMBD2 + p2YC, p2YN + p2YC-ClIDM2, p2YN-ClMBD3 + p2YC, or p2YN + p2YC-ClIDM3; by contrast, like that in the positive control, significant YFP fluorescence was clearly observed in leaves co-infiltrated with agrobacteria carrying p2YN-ClMBD2 + p2YC-ClIDM2, p2YN-ClMBD3 + p2YC-ClIDM2, p2YN-ClMBD2 + p2YC-ClIDM3, or p2YN-ClMBD3 + p2YC-ClIDM3 (Figure 3B). These results confirmed the interactions of ClMBD2 and ClMBD3 with ClIDM2 and ClIDM3.

It is well known that MBD proteins have the capability to bind methylated DNA (Ito et al., 2003; Zemach and Grafi, 2003; Grafi et al., 2007). To explore the biochemical activity of the watermelon ClMBDs, recombinant GST-tagged ClMBD1–7, 9, 10 proteins were purified (Supplementary Figure 7) and their binding activity to methylated CG DNA was examined by EMSA. Two complementary single-stranded DNA probes with 5 methylated CG sites (5mCG) were synthesized and the double-stranded 5mCG DNA was generated (Figure 4A). In repeated EMSA, only ClMBD2 bound to labeled double-stranded 5mCG DNA, and the binding of ClMBD2 to labeled double-stranded 5mCG DNAs was specific as this binding was completely suppressed by the excessive unlabeled double-stranded 5mCG DNA in the competition binding assay (Figure 4A). The remaining ClMBDs did not show binding activity to the labeled double-stranded 5mCG DNA (Figure 4A). However, ClMBD2 did not bind to DNA harboring mCHG or mCHH sites (Figure 4B). These results indicate that ClMBD2 specifically binds to mCG DNA, but not to mCHG DNA or mCHH DNA.

The expression patterns of the ClMBD gene in root, stem and leaf tissues of 4-week-old watermelon plants were analyzed and the qRT-PCR results showed that the ClMBD genes have similar expression patterns: highest expression in leaves, moderate in stems, and lowest in root (Supplementary Figure 8).

To explore the possible involvement of the ClMBD genes in disease resistance, expression changes of the ClMBD genes were analyzed in watermelon plants after treatment with SA and MeJA. After foliar spraying with 1 mM SA, the expression of ClNPR1 and ClPR1, the marker genes of SA signaling pathway, was significantly up-regulated. Particularly, the expression of ClPR1 significantly up-regulated at 6 h after treatment and peaked at 12 h, showing a > 59-fold increase, as compared with that in mock control (Figure 5A). After SA treatment, the expression of most of the ClMBD genes were up-regulated with distinct patterns: ClMBD2, 3, 6, 7, 8, 9, and 10 were up-regulated at 6 h; ClMBD1, 4, 5, 7, and 10 were up-regulated at 12 h; while ClMBD1, 6, and 8 were markedly up-regulated at 24 h, as compared with those in the mock controls (Figure 5A). Notably, ClMBD2, 3, 9, and 10 showed similar expression patterns after SA treatment, implying that these ClMBD genes may have similar functions. These data indicate that the ClMBD genes can respond to SA and thus may be involved in disease resistance in watermelon.

After foliar spraying with 100 μM MeJA, the expression of ClJAZ1 and ClPDF1.2, the marker genes of the JA signaling pathway (Yang et al., 2019), was significantly up-regulated and peaked at 24 h (Figure 5B). After MeJA treatment, ClMBD2, 6, 7, 8, and 10 were highly up-regulated, while ClMBD5 and ClMBD9 were significantly down-regulated, as compared with those in the mock controls (Figure 5B). ClMBD4 was up-regulated at 12 h but down-regulated at 24 h, as compared with those in the mock controls (Figure 5B). Notably, ClMBD8/ClMBD10 and ClMBD1/ClMBD4 exhibited similar expression patterns in response to exogenous MeJA, indicating these two pairs of the ClMBD genes may have similar biological functions. These data indicate that the ClMBD genes differentially respond to MeJA and thus may play different roles in disease resistance in watermelon.

To explore the possible involvement of ClMBDs in watermelon disease resistance, the expression changes of the ClMBD genes in watermelon plants after infection with different fungal pathogens were analyzed. Fon is the most important soilborne vascular pathogen that causes Fusarium wilt, one of the most devastating fungal diseases in watermelon (Michielse and Rep, 2009). Fon infects watermelon plants through root system and proliferation within the xylem vessels (Michielse and Rep, 2009). Therefore, the expression changes of the ClMBD genes in root tissues of watermelon plants after Fon infection were analyzed. The qRT-PCR results showed that the expression level of ClPR1 started to increase at 3 days post inoculation (dpi), peaked at 6 days, leading to 65.5-fold higher over that in mock-inoculated plants, and then decreased (Figure 5C). The expression of ClMBD1 and ClMBD10 in root tissues of the Fon-infected watermelon plants were up-regulated, as compared with those in the mock-inoculated plants, at 3 dpi (Figure 5C). As compared with those in the mock-inoculated plants, the expression of ClMBD2, 6, and 9 was up-regulated at 6 dpi, while the expression of the ClMBD genes, except for ClMBD3, 5, and 10, was up-regulated at 9 dpi (Figure 5C). Overall, the expression changes of the ClMBD genes exhibited similar significant up-regulation patterns in root tissue at 3, 6, or 9 dpi; for example, the expression level of ClMBD7 in root tissue was markedly up-regulated with a > 639-fold increase than that in mock-inoculated plants at the 9 dpi (Figure 5C). Notably, the expression changes of ClMBD8, 9, and 10, and of ClMBD1, 2, 4, 5, 6, and 7 showed similar patterns in response to Fon, implying that these two groups of the ClMBD genes may be involved in resistance with similar functions. The results suggest that the ClMBD genes are responsive to Fon infection during the relative late stage of the pathogenesis and thus may play roles in the process of regulating watermelon resistance to vascular Fusarium wilt disease.

Db is another devasting fungal pathogen that infects leaf and stem tissues and causes gummy stem blight, which is a very common fungal disease on cucurbitaceous crops including watermelon (Keinath, 2011). The responsiveness of the ClMBD genes to Db infection was also analyzed in leaf tissues of watermelon plants after foliar spraying with a fungal spore suspension. After Db inoculation, the expression of ClPR1 in leaf tissues started to increase at 12 hpi, gradually increased and peaked at 48 h, leading to a 55-fold increase over that in mock-inoculated plants (Figure 5D). The expression of the ClMBD genes in leaf tissues exhibited distinct patterns in response to Db infection. The expression levels of ClMBD3, 4, 7, and 9 in Db-infected leaves were significantly up-regulated at 12, 24, or 48 hpi, as compared with those in mock-inoculated leaves (Figure 5D). By contrast, the expression levels of ClMBD2, 6, 8, and 10 in Db-infected leaves were highly down-regulated at 12, 24, or 48 hpi, as compared with those in mock-inoculated leaves (Figure 5D). The expression of ClMBD1 and ClMBD5 in leaf tissues was not significantly affected by Db infection during a 48 h period of the experiments (Figure 5D). Notably, the expression changes of ClMBD3, 5, and 7 exhibited similar patterns in response to Db, indicating similar involvement for these three ClMBD genes in Db resistance. These results indicate that the expression of the ClMBD genes in leaf tissues exhibited distinct patterns in response to Db infection and therefore may play different roles in the process of regulating watermelon resistance against Db.

To investigate the functions of the ClMBD genes, transgenic Arabidopsis lines with overexpression of an individual ClMBD gene were generated. The ClMBD genes were transcribed normally in their own transgenic Arabidopsis lines (Supplementary Figures 9A,B). The ClMBD-overexpressing Arabidopsis plants showed no significant defect in growth and development, including plant height and size, in comparison to WT plants, when grown in a greenhouse (Supplementary Figure 10).

To explore the possible functions of the ClMBD genes in plant immunity, disease resistance phenotype of the ClMBD-overexpressing Arabidopsis lines and the wild-type (WT) Col-0 plants after infection with B. cinerea, a necrotrophic fungus causing grey mold disease, was assessed. In repeated detached leaf punch inoculation assays, B. cinerea-caused necrotic lesions on leaves detached from the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants were significantly larger than those on leaves of WT plants, resulting in increases of approximately 88.9, 55.6, and 66.7% in lesion length, respectively, as compared with those on WT leaves (Supplementary Figure 11). By contrast, B. cinerea-caused necrotic lesions on leaves detached from the ClMBD1-OE, ClMBD4-OE, ClMBD6-OE ClMBD7-OE, ClMBD8-OE, ClMBD9-OE, and ClMBD10-OE plants were comparable to those on leaves of WT plants (Supplementary Figure 11). To confirm these results, the ClMBD-overexpressing plants were inoculated by foliar spraying with B. cinerea spore suspension and disease severity and fungal growth were compared with those in WT plants. After infection, typical B. cinerea-caused disease symptom was seen at 3 dpi. Much severe diseases were observed on leaves of the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants, especially the B. cinerea-infected ClMBD2-OE plants decayed and died at 3 dpi (Figure 6A). By contrast, disease severity on leaves of the B. cinerea-infected ClMBD1-OE, ClMBD4-OE, ClMBD6-OE, ClMBD7-OE, ClMBD8-OE, ClMBD9-OE, and ClMBD10-OE plants were similar to that in WT plants (Supplementary Figure 12A). Accordingly, the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants supported more in planta fungal growth, leading to increases of 57.5–851.3% over that in WT plants (Figure 6B), while the ClMBD1-OE, ClMBD4-OE, ClMBD6-OE, ClMBD7-OE, ClMBD8-OE, ClMBD9-OE, and ClMBD10-OE plants supported similar amounts of in planta fungal growth (Supplementary Figure 12B). These data from detached leaf punch inoculation and whole plant inoculation assays indicate that overexpression of ClMBD2, 3, and 5 attenuates the resistance of transgenic Arabidopsis plants against B. cinerea, while overexpression of each of the remaining ClMBD genes does not affect the resistance against B. cinerea.

To get insights in the possible mechanism of the attenuated B. cinerea resistance, the expression of a marker defense gene AtPDF1.2 and accumulation of reactive oxygen species (ROS) were analyzed and compared between the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants and WT plants after infection by B. cinerea. In mock-inoculated plants, the expression level of AtPDF1.2 in the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants was similar to that in WT plants (Figure 6C). At 24 hpi with B. cinerea, the expression level of AtPDF1.2 in the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants and WT plants were markedly up-regulated, as compared with those in the mock-inoculated plants; however, the expression level of AtPDF1.2 in the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants were significantly suppressed, resulting in a decrease of 73–81, 80–84, and 59–63%, respectively, as compared with that in Col-0 plants (Figure 6C). Similarly, no difference in accumulation of H₂O₂, as revealed by in situ DAB staining, was observed among the WT, ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants without B. cinerea challenge (Figure 6D). At 24 hpi with B. cinerea, accumulation of H₂O₂ increased markedly in B. cinerea-infected leaves of the WT, ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants, as compared with those in mock-inoculated controls (Figure 6D). However, more staining for H₂O₂ in B. cinerea-infected leaves of the ClMBD2-OE, ClMBD3-OE, and ClMBD5-OE plants was detected, as compared to that in WT plants (Figure 6D). These data indicate that overexpression of ClMBD2, 3, and 5 in transgenic Arabidopsis plants attenuates the B. cinerea-induced expression of defense genes but promotes the B. cinerea-induced ROS accumulation.

The possible involvement of the ClMBD genes in resistance against Pst DC3000, a hemibiotrophic pathogen that causes bacterial spot disease, was also investigated. At 3 dpi, typical Pst DC3000-provoked symptom with chlorotic lesions was seen in WT plants and the ClMBD-overexpressing plants (Figure 7A and Supplementary Figure 13A). The ClMBD1-OE and ClMBD2-OE plants displayed much severe disease with extensive chlorotic lesion while the ClMBD5-OE plants showed less severe disease (Figure 7A). Accordingly, the bacterial growth in the ClMBD1-OE and ClMBD2-OE plants was 0.43–0.69 order of magnitude higher while the growth in the ClMBD5-OE plants was ∼1.0 order of magnitude lower, as compared to that in WT at 3 dpi (Figure 7B). Disease severity and bacterial growth in the ClMBD3-OE, ClMBD4-OE, ClMBD6-OE, ClMBD7-OE, ClMBD8-OE, ClMBD9-OE, and ClMBD10-OE plants were indistinguishable to those in WT plants (Supplementary Figure 13B). These data indicate that overexpression of ClMBD1 and ClMBD2 leads to attenuated resistance while overexpression of ClMBD5 results in increased resistance against Pst DC3000.

To gain insights in the possible mechanism of the altered Pst DC3000 resistance, the expression of a marker defense gene AtPR1 was analyzed and compared between the ClMBD1-OE, ClMBD2-OE, and ClMBD5-OE plants and WT plants after infection by Pst DC3000. In mock-inoculated plants, the expression level of AtPR1 in the ClMBD1-OE, ClMBD2-OE, and ClMBD5-OE plants was not significantly affected, as compared with that in WT plants (Figure 7C). At 24 hpi with Pst DC3000, the expression level of AtPR1 in the ClMBD1-OE, ClMBD2-OE, and ClMBD5-OE plants and WT plants were markedly up-regulated, as compared with those in the mock-inoculated plants (Figure 7C). However, the Pst DC3000-induced expression of AtPR1 in the ClMBD1-OE and ClMBD2-OE plants was significantly suppressed, resulting in a decrease of 51–55 and 39–47%, respectively, while the Pst DC3000-induced expression of AtPR1 in the ClMBD5-OE plants was markedly increased by ∼21-folds (Figure 7C). These data indicate that overexpression of ClMBD1 and ClMBD2 in transgenic Arabidopsis plants attenuates while overexpression of ClMBD5 strengthens the Pst DC3000-induced expression of defense genes.

Considering that overexpression of ClMBD2 led to attenuated resistance against B. cinerea and Pst DC3000 (Figures 6, 7), transcriptome profiling of the ClMBD2-OE2 and WT plants grown under normal growth conditions was performed to gain insights into the possible molecular mechanisms of ClMBD2 in regulating resistance against the two pathogens. With criteria of expression change > 1.5-folds and P < 0.05, a total of 70 genes (52 up-regulated and 18 down-regulated) were found to be differentially expressed genes (DEGs) in the ClMBD2-OE2 plants as compared with WT plants (Supplementary Tables 5, 6). The DEGs in the ClMBD2-OE2 plants grown under normal condition were categorized into functional groups based on Gene Ontology (GO). DEGs that were up-regulated (Supplementary Table 5) or down-regulated (Supplementary Table 6) in the ClMBD2-OE2 plants were clustered into 31 (Supplementary Table 7) and 22 categories (Supplementary Table 8), respectively. Some overrepresented categories include genes involved in DNA binding, molecular transducer activity, and transcriptional factor activity in molecular function category, and response to stimulus, immune system process, signaling, and biological regulation in biological processes category (Figures 8A,B), implying that overexpression of ClMBD2 in transgenic Arabidopsis plants may affect the immune signaling and response. Among the DEGs (Supplementary Tables 5, 6), some genes have been previously reported to be involved in Arabidopsis immunity, including AtWRKY18 (Xu et al., 2006), AtWRKY30 (Zou et al., 2019), AtWRKY54 (Chen et al., 2021), AtANAC019 (Zheng et al., 2012), AtMLO6 (Acevedo-Garcia et al., 2017; Kuhn et al., 2017), and AtNATA1 (Lou et al., 2016). The expression patterns of 10 selected genes were further validated by qRT-PCR in ClMBD2-OE and WT plants before and after the infection of B. cinerea and Pst DC3000. In the ClMBD2-OE plants without pathogen infection, the expression levels of AtWRKY18, AtWRKY30, AtANAC019, AtARCK1, AtMLO6, and AtERF54 were significantly up-regulated while the expression levels of AtMAF5, AtBEE1, AtbZIP34, and AT5G52190 were markedly down-regulated (Figure 8C). After infection of B. cinerea, the expression of AtbZIP34 was down-regulated, while the expression of other genes was up-regulated in ClMBD2-OE and WT plants (Figure 8C). The expression levels of AtWRKY18 and AtbZIP34 were significantly increased, while the expression levels of AtANAC019 and AtBEE1 were significantly suppressed in ClMBD2-OE plants after infection of B. cinerea, as compared with those in WT plants (Figure 8C). After infection of Pst DC3000, the expression of AtWRKY18, AtWRKY30, AtANAC019, AtARCK1, AtERF54, AtMLO6, and AtMAF5 was up-regulated, but the expression of AtBEE1, AT5G52190, and AtbZIP34 was down-regulated in ClMBD2-OE and WT plants (Figure 8C). The expression levels of AtWRKY18, AtERF54, AtMAF5, AT5G52190, and AtBEE1 were significantly decreased in ClMBD2-OE plants after infection of Pst DC3000, as compared with those in the WT plants (Figure 8C). These data consistently conformed the results from RNA-seq analysis and indicate that ClMBD2 regulates a small set of defense and signaling genes that are involved in Arabidopsis immunity.