A high-efficiency protoplast isolation system was successfully constructed using broccoli explants of various genotypes. To determine the universality and efficiency of the system, three genotypes of broccoli protoplasts were all isolated by the same method. The cotyledons of sterile seedlings that had been cultured for 7-10 days were preincubated in CM solution ( Table S1 ) for 12 h, and strips of approximately 1 mm were then cut from the leaves and placed in 0.3 M mannitol enzymatic hydrolysis solution for enzymatic hydrolysis. The process did not require a vacuum environment and involve toxic reagents, which indicated it was simple and reliable in operation. The leaf material was hydrolyzed with 0.5% (w/v) cellulase R-10 and 0.1% (w/v) pectolyase Y-23 on a shaking table for 3 h. Using this method, the yield of B1, B40, and B42 protoplasts all reached or exceeded 5.05×10⁶ protoplasts/g. The B1 genotype yielded 5.33×10⁶-7.05×10⁶ protoplasts/g, the B42 genotype yielded 6.23×10⁶-9.84×10⁶ protoplasts/g, and the yield from the B40 genotype was 5.05×10⁶-6.04×10⁶ protoplasts/g. These yields met the standard needed for protoplast transformation experiments (1.0×10⁶-2.0×10⁶ protoplasts/mL). At the same time, the protoplast viability was determined by fluorescein diacetate (FDA) to be greater than 95% ( Figure 1 ) ( Table S2 ). Microscope observation showed that the purified protoplasts were relatively unfragmented and that the preparations contained little cell debris. Thus, they fully met the standard required for various protoplast-related experiments. From this result, protoplasts with high viability were obtained in high yield from the cotyledons of broccoli plants of the three genotypes, and there were no significant differences between the B1 with the B40 in yield or viability (p < 0.05), demonstrating the universality and efficiency of the method.

The PHG-eGFP (12.7 kb) and CP507-YFP (10.7 kb) plasmids were transferred into the prepared B1 protoplasts, and the protoplasts were cultured at 25°C for 13-16 h in the dark. The green fluorescence signal of GFP in protoplasts transfected with PHG-eGFP and the yellow fluorescence of YFP in protoplasts transfected with CP507-YFP were observed under excitation at 488 nm ( Figure 2A ). The result showed that the plasmid DNA that encoded the fluorescent protein could be transferred into broccoli protoplasts and the fluorescent proteins were stably expressed. The two plasmids were also transformed into B40 and B42 protoplasts, and the fluorescent proteins were also stably expressed in those protoplasts. Thus, a transient transformation system for broccoli protoplasts was successfully constructed in this study.

A total of 5 μg, 10 μg, and 15 µg plasmid vectors of PHG-eGFP and CP507-YFP were transferred into 200 μL (approximately 4 × 10⁵) protoplasts obtained from broccoli genotypes, and the resulting transformation efficiency was calculated shown in Figures 2B, C . Although the average efficiency of transformation by PHG-eGFP and CP507-YFP increased slightly as the plasmid concentration increased, there was no significant difference between treatments in any of the three genotypes (p < 0.05). When the plasmid mass was increased stepwise from 5 μg to 15 μg, the efficiency of transformation of B1 protoplasts by PHG-eGFP was respectively 58.6-65.8%, 59.5-64.7%, and 59.4-73.1%, with mean values of 61.4%, 63.0%, and 67.4%, respectively. For B40, they were respectively 15.5-25.0%, 17.6-34.5%, and 27.4-32.4%with mean values of 20.6%, 26.6%, and 29.7%. And in B42, they were 12.8-24.5%, 10.4-32.2%, and 16.8-30.4% with mean values of 16.3%, 21.4%, and 24.7%, respectively. When the same amounts of the CP507-YFP plasmid were used, the efficiency of transformation of B1 were respectively 42.2-44.8%, 30.0-55.2%, and 38.2-48.8% with mean values of 41.7%, 43.0%, and 44.7%; the efficiency for B40 were respectively 25.4-41.8%, 35.0-53.0%, and 38.8%-44.2% with mean values of 35.7%, 44.4%, and 41.0%. While the efficiencies for B42 were respectively 15.4-19.8%, 21.2-27.4%, and 20.0-33.3% with mean values of 17.7%, 24.0%, and 26.0%. The results indicated that over the range of 5-15 μg plasmid/4×10⁵ protoplasts, the amount of plasmid had little or nearly no effect on the transfection efficiency. The transformation efficiency of PHG-eGFP in B1 varied the most with increasing plasmid concentration (58.6%-73.1%). The average transformation efficiency of the other two plasmids were less than 9.1% ( Figures 2B, C ) ( Table S3 ).

Totally, 5 μg PHG-eGFP vectors were added to 200 μL of B1, B40 and B42 cotyledon protoplasts, and transfection was induced by the addition of an equal volume of 20% (w/v) PEG4000 or 40% (w/v) PEG4000 PEG-Ca²⁺ and incubation for 20 min. The results showed that the efficiency of transformation using 40% PEG4000 was higher than 20% PEG4000, but when the protoplasts were cultured in the presence of 40% PEG4000, a large number of the protoplasts ruptured, and this seriously affected the subsequent observation and culture of the protoplasts ( Figure 2D ). Similarly, the protoplasts transformed by CP507-YFP in the presence of 40% PEG-Ca²⁺ showed obvious rupture. Thus, this study found that the optimal mass concentration of PEG4000 for cotyledon protoplast transformation of the three broccoli genotypes was 20%.

The transformation efficiency of protoplasts for B1, B40 and B42 genotypes were compared under the conditions of 5 μg plasmid concentration and 20% PEG-Ca²⁺ induction solution. From Figure 2A and Table S3 , we could find that the PHG-eGFP and CP507-YFP plasmid vectors all yielded higher transformation efficiency in B1 protoplasts, and that there were significant differences in the transformation efficiency obtained using different plasmid vectors (p < 0.05) to 65.8% with an average of 61.4%. And for CP507-YFP, transformation efficiency ranged from 38.2% to 45.0% with an average of 41.7%. The transformation efficiency of PHG-eGFP and CP507-YFP were both in the lowest level in B42 protoplasts, which respectively ranged from 12.5% to 24.8% and from 15.0% to 20.6% with the average values were 16.3% and 17.7%. So, our research had shown that the efficiency of protoplast transformation was obviously influenced by recipient genotypes and by vector types.

The expression of three target genes, CRa, Bol021900 and Bol031350, linked to GFP in B1 protoplasts cultured in W5 suspension was verified by laser confocal microscopy. It has been reported that Bol021900 and Bol031350 are involved in the regulation of sulforaphane metabolism and that CRa expression significantly enhances resistance to clubroot in Brassica crops (Ueno et al., 2012; Ce et al., 2021). After induction with 20% PEG-Ca²⁺, the protoplasts were cultured in W5 solution for 12-15 h. Under microscopic observation, green fluorescence was observed in the protoplasts, and the three gene products and their fusion proteins were all located in the nucleus ( Figure 3 ). The expression of fluorescent proteins in broccoli protoplasts demonstrated the validity and stability of this transformation system, which showed that it can be successfully applied to study the subcellular localizations of the products of specific genes.

The cotyledons of sterile seedlings of various genotypes of the broccoli inbred lines B1, B40 and B42 were used as exosomes for protoplast isolation ( Figure 5 ). All materials were cultivated by Institute of Vegetable and Flower Research, Chinese Academy of Agricultural Sciences (IVF-CAAS). B1 was the F₆ generation of the inbred line material, and it exhibited medium-early maturity, semierect plant type, dome-shaped head, blue−green buds, medium fine flower buds, and no lateral branching in the field ( Figure 5A ). B40 was the F₆ generation of the inbred line material, and it showed medium-late maturity, erect plant type, semidome-shaped head, dark green buds, medium flower buds and no lateral branching in the field ( Figure 5B ). B42, the F₇ generation of inbred line material, exhibited early maturity, semierect plant shape, dome-shaped head, green bulbs, fine buds and few lateral branches in the field ( Figure 5C ).

An eGFP expression cassette was created using the plasmids PHG-eGFP (12.7 kb), which encode green fluorescent protein and promote eGFP expression using CaMV 35S promoter and rbcS ployA as a terminator. The plasmid CP507-YFP (10.7 kb) containing yellow fluorescent protein uses CaMV 35S promoter to promote YFP expression and NOS as the terminator to form a YFP expression box ( Figures 6A , B ). The CP507-YFP plasmid was provided by the Quality Molecular Research Group of IVF-CAAS, and was propagated and preserved in our laboratory. The plasmid was amplified in the E. coli DH5α strain, and the EndoFree Maxi plasmid kit (TIANGEN Biotech Co., Ltd., Beijing, China) was used to extract the plasmid. The purified plasmid was stored at –20°C for later use.

Cellulase “onozuka” R-10 and pectolyase Y-23 were purchased from YAKULT HONSHA CO., LTD. Mannitol, bovine serum albumin (BSA), fluorescein diacetate (FDA), 2-(N-morpholino) ethanesulfonic acid (MES), polyethylene glycol 4000 (PEG 4000) and other reagents were purchased from Beijing Exelon Biotechnology Co., Ltd. The E. coli DH5α strain was purchased from Shanghai Weidi Biotechnology Co., Ltd.

Selected filled seeds were sterilized in 50 mL centrifuge tubes containing 75% alcohol for 3 min and then poured into 8% sodium hypochlorite for 8 min, rinsed three times with sterile water, and spread on seeding medium (4.45 g/L MS + 28 g/L sucrose + 8 g/L agar, pH 5.8). The cultures were incubated for 7-10 d at 25°C in low light (150 μmol m-2 s-1, 16 h light, 8 h dark).

Upper fully expanded broccoli cotyledons of aseptic seedlings cultured for 7-10 d were selected ( Figure 5 ), spread over the bottoms of sterile 9-cm glass Petri dishes filled with CM ( Table S1 ), and incubated in the dark at 4°C for 12 h. After pretreatment, the CM was discarded, a scalpel was used to make a scratch approximately 1 mm long on the back of the leaf, and 10 mL of preconfigured enzyme digestion solution (0.5% cellulase R-10, 0.1% pectolyase Y-23, and 0.6 M mannitol, pH 5.8) was added. The material was placed on a shaker and enzymatically digested at 25°C in the dark for 3 h. After enzymatic digestion, the dishes were gently shaken in a single direction to release the protoplasts. The leaf residue was removed by passage of the material through a 50.0-μm nylon membrane sieve. The material that passed through the sieve was collected in a 10-mL round-bottom centrifuge tube. After centrifugation of this material at 700 r/min for 5 min, the supernatant was discarded, 7.0 mL of W5 (154 mM NaCl, 125.0 mM CaCl₂, 5.0 mM KCl and 2.0 mM MES, pH 5.7) was added to the pellet, the resulting suspension was centrifuged at 700 r/min for 3 min, and the supernatant was again discarded. The above process was repeated twice. The protoplasts were then immediately resuspended in MMG solution (0.4 M mannitol, 15.0 mM MgCl₂ and 4.0 mM MES, pH 5.7) at a density of 1.0-2.0×10⁶ protoplasts mL^-1.

The yield of protoplasts was calculated using the hemocytometer counting method. The yield of obtained protoplasts (cells g^-1) = N×10⁴×V×m^-1, where N = the number of protoplasts counted in a hemocytometer chamber, V = the volume of diluted protoplasts, and m = the fresh weight of the cotyledons used for protoplast isolation. The viability of the protoplasts obtained was checked using fluorescein diacetate (FDA). Ten microliters of 0.01% fluorescein diacetate (FDA) were added to 500 microliters of protoplast suspension. After 5 min, the protoplasts were examined with an Olympus BX51 fluorescence microscope (green fluorescence, Olympus, Japan). The viability of the obtained protoplasts (%) = the number of protoplasts with green fluorescence/total protoplasts in the field (×100%). The experiment was repeated three times, and the average value was taken (n = 3).

The isolation and purification of broccoli cotyledon protoplasts of the three genotypes was performed using the above procedure.

The method referenced by Zhang et al. (2011) to transfect broccoli protoplasts was slightly optimized (Zhang et al., 2011). Plasmids (5-15 μg) were added to 200 μL of protoplast suspension (approximately 4×10⁵ protoplasts), followed by addition of an equal volume of PEG-Ca²⁺ solution (PEG4000, 0.2 M mannitol and 0.1 M CaCl₂), and transformation was allowed to proceed in the dark at room temperature (approximately 25°C) for 20 min. Two volumes of W5 solution were then added to stop the reaction, the sample was centrifuged at 700 r/min for 3 min, the supernatant was discarded, and 1.0 mL of W5 solution was added to resuspend the pelleted material. The protoplasts were transferred to a 3.0-cm petri dish and cultured at 25°C in the dark for 12-15 h. The concentration of protoplasts used for transformation and the amount of W5 solution used to culture the transformants can be appropriately increased or reduced according to the purpose of the experiment. At the end of the culture period, the expression of fluorescent protein was observed under a fluorescence microscope, and the results were used to calculate the transformation efficiency of different materials.

Protoplast transformation efficiency was defined as the number of protoplasts with green fluorescence/total protoplasts in the field (×100%). The experiment was repeated three times, and the average value was taken (n = 3).

To obtain higher protoplast transformation efficiency, stepwise gradients of the factors affecting the transformation were tested: plasmid masses of 5, 10 and 15 μg and mass concentrations of PEG4000 in the PEG-Ca²⁺ solution of 20% (w/v) and 40% (w/v) were tested. The transformed materials were cotyledon protoplasts of different broccoli genotypes of B1, B40, and B42.

To construct the PHB-CRa plasmid, the full-length 4.6-kb CRa gene (derived from cabbage) cloned in our laboratory was ligated to the PHB plasmid after single digestion of the PHB plasmid with XhoI. Subsequently, PHB-CRa was digested with BamHI/XbaI, and DNA ligase (M0202M, NEB, MA, USA) was used to ligate eGFP to construct a PHG-CRa-eGFP expression vector ( Figure 6C ).

The Bol029100 gene was amplified by PCR using the specific primers P1 (F: ATCCTCGAGCTGCAGG AGCTCATGGCACCCGCATGCAGCAGAATC; R: CCCTTGCTCACCATCACTAGTCCAATCAGCTTCTGTCTCAAGAAATC), and the Bol031350 gene was amplified using the specific primers P2 (F: ATCCTCGAGCTGCAGGAGCTCATGGCACCCTCTTGCAGTCCAATC; R: CCCTTGCTCACCATCACTAGTCCCCCAAATATCTGAGAGGGAATAAC). The PCR fragment was recovered after gel electrophoresis and ligated to the digested plasmid PHG-eGFP to construct the PHG-029100-eGFP and PHG-031350-eGFP expression vectors ( Figures 6D , E ).

Fluorescence microscopy (Olympus BX51, Japan) was used to observe and photograph the expression of green and red fluorescent proteins in broccoli protoplasts transfected with the PHG-eGFP, and CP507-YFP plasmids. The subcellular localization of the fluorescent proteins was observed through laser confocal microscopy (Olympus BX51, Japan). GFP was excited using a 488-nm laser line.

All data were analyzed by analysis of variance (ANOVA) using SPSS Statistics version 19.0 (IBM^®, Chicago, IL, USA). Student’s t-test or one-way analysis of variance (ANOVA), and Duncan’s multiple tests were used to assess significant differences (p < 0.05).