p1380N-Cas9/sgRNA:cslob1 was digested with HindIII, and the HindIII-CsVMV-GFP-35T-HindIII fragment was sub-cloned into HindIII-digested p1380N-Cas9 to obtain GFP-p1380N-Cas9. The GFP-p1380N-Cas9/sgRNA:cslob1 and p1380N-Cas9 was described previously (Jia et al., 2017). Using primers SaCas9-P1-XbaI (5′-AGGTTCTAGAGGATCCACCGGTGCCACCATGGCCCCAAAGAAGAAGCGGAAG-3′) and SaCas9-P2-EcoRI (5′-AGGTGAATTCTTACTTTCCCATCAACCTGGGTCCAAG-3′), the 3333 bp SaCas9 was PCR-amplified from pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA (Addgene plasmid #61593). After XbaI-EcoRI digestion, SaCas9 was inserted into XbaI-EcoRI-treated GFP-p1380N-Cas9 to form GFP-p1380N-SaCas9.

The sgRNA scaffold portion was amplified from pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA, using a pair of primers sgRNA-5-BamHI (AGGTGGATCCTGCTTACCGTAACTTGAAAGTATT) and sgRNA-3-KpnI (AGGTGGTACCAAAAATCTCGCCAACAAGTTGACG). The NosT fragment was amplified from GFP-p1380N-Cas9/sgRNA:cslob1, using NosT-5-KpnI (AGGTGGTACCGAATTTCCCCGATCGTTCAAACAT) I and NosT-3-AscI (ACCTGGGCCCGGCGCGCCGATCTAGTAACATAGATGA). Through three-way ligation, BamHI-KpnI-digested sgRNA and KpnI-AscI-cut NosT were constructed into BamHI-AscI-treated p1380N-Cas9 to form p1380N-sgRNA.

From p1380N-sgRNA, the CaMV 35S promoter was amplified using primers CaMV35-5-XhoI (5′-ACTCGAGACTAGTACCATGGTGGACTCCTCTTAA-3′) and sgRNA-cspds-P1 (5′-phosphorylated-GCAATGAATTCCCTCTCCAAATGAAATGAACTTC-3′), and the sgRNA-NosT fragment was amplified using primers sgRNA-cspds-P2 (5′-phosphorylated- ACTAACCATATGTTTTAGTACTCTGGAAACAGAAT-3′) and NosT-3-AscI. Through three-way ligation, XhoI-cut CaMV35S and AscI-digested sgRNA-NosT were inserted into XhoI-AscI-cut GFP-p1380N-SaCas9 to build GFP-p1380N-SaCas9/sgRNA:cspds (Figure 1A), which is designed to edit the sequence located 15736 bp downstream of ATG in CsPDS (Supplementary Figure 1A). Similarly, GFP-p1380N-SaCas9/sgRNA:cs2g12470 was developed, except using primers sgRNA-cs2g12470-P1 (5′-phosphorylated-GCAAAGCTAACCCCTCTCCAAATGAAATGAACTTC-3′) and sgRNA-cs2g12470-P2 (5′-phosphorylated- AGAGGCCTGAGTTTTAGTACTCTGGAAACAGAAT-3′) (Figure 1B). GFP-p1380N-SaCas9/sgRNA:cs2g12470 is designed to target the sequence located 259 bp downstream of ATG in Cs2g12470 (Supplementary Figure 1A).

Using p1380N-sgRNA as template, the CaMV 35S promoter was PCR-amplified using primers CaMV35-5-XhoI and sgRNA-Cs7g03360-P1 (5′-phosphorylated-GAATATTGCCACAGCCCTCTCCAAATGAAATGAACTTC-3′), and the sgRNA1-NosT fragment was PCR-amplified using primers sgRNA-Cs7g03360-P2 (5′-phosphorylated- AAACCATTGTTTTAGTACTCTGGAAACAGAAT-3′) and NosT-3-AscI. XhoI-cut CaMV35S and AscI-digested sgRNA-NosT were inserted into XhoI-AscI-cut GFP-p1380N-SaCas9 to build GFP-p1380N- SaCas9/35S-Cs7g03360sgRNA1 through three-way ligation. Using Arabidopsis genome as template, the AtU6-1 was amplified using AtU6-1-5-AscI (5′-AGGTGGCGCGCCTCTTACAGCTTAGAAATCTCAAA-3′) and sgRNA-Cs7g03360-P3 (5′-phosphorylated- CCTCTGATACCCCTCTCCAAATGAAATGAACTTC-3′). Using sgRNA-Cs7g03360-P4 (5′-phosphorylated- AAGTAGCAAGAGGTTTTAGTACTCTGGAAACAGAAT-3′) and NosT-3-P (5′-AGGTACTAGTCCGATCTAGTAACATAGATGACA-3′), the sgRNA2-NosT fragment was amplified from p1380N-sgRNA. Through three-way ligation, AscI-cut AtU6-1 and non-digested sgRNA-NosT were inserted into AscI-PmeI-treated GFP-p1380N- SaCas9/35S-Cs7g03360sgRNA1 to form GFP-p1380N-SaCas9/35S-sgRNA1:AtU6-sgRNA2 (Figure 1C).

Using freeze-thaw method, Agrobacterium tumefaciens EHA105 was transformed by binary vectors GFP-p1380N-SaCas9/sgRNA:cspds, GFP-p1380N-SaCas9/sgRNA:cs2g12470 and GFP-p1380N-SaCas9/35S-sgRNA1: AtU6-sgRNA2, respectively. The PCR-positive Agrobacterium colonies were singled out for Xcc-facilitated agroinfiltration or citrus transformation.

Duncan grapefruit (Citrus paradisi) was grown in a greenhouse with temperature ranged from 25 to 30^°C. The plants were pruned for flushing before Xanthomonas citri subsp. citri (Xcc)-facilitated agroinfiltration was perform. The recombinant Agrobacterium cells contained binary vector GFP-p1380N-SaCas9/sgRNA:cspds or GFP-p1380N-SaCas9/sgRNA:cs2g12470. The detailed protocol for Xcc-facilitated agroinfiltration in citrus leaves was described in previous work (Jia and Wang, 2014b; Jia et al., 2017). Four days after agroinfiltration, genomic DNA was extract from the treated leaves after GFP fluorescence detection.

The epicotyls of Carrizo citrange were employed as explants to establish transgenic plants by Agrobacterium-mediated transformation. The recombinant Agrobacterium cells harbored binary vector GFP-p1380N-SaCas9/35S-sgRNA1:AtU6-sgRNA2. The number of explants used in these experiments was 5460. On those explants, there were 818 shoots. Out of 818 Carrizo shoots, 12 of them exhibited GFP fluorescence in all their tissues, whereas 31 shoots were chimeric. Only the 12 GFP-positive regenerants were subjected to subsequent grafting for PCR verification and SaCas9/sgRNA-mediated indel analysis.

The transgenic Carrizo citrange was verified by PCR amplification, using primers, AtU6-1-5-AscI and NosP-3-P2 (5′-TTGTCGTTTCCCGCCTTCAGT-3′).

GFP-p1380N-SaCas9/35S-sgRNA1:AtU6-sgRNA2-transformed Carrizo citrange was observed under illumination of the Stereo Microscope Fluorescence Adapter (NIGHTSEA) by using a Zeiss Stemi SV11 dissecting microscope, which is equipped with an Omax camera. The transgenic plant leaves were photographed by using the Omax Toupview software.

Genomic DNA was extracted from wild type (WT) Carrizo citrange, transgenic Carrizo plants, or the Duncan leaves treated by Xcc-facilitated agroinfiltration. To figure out the conserved region of Cs7g03360 in Carrizo, PCR was performed with the Phusion DNA polymerase (New England Biolabs) and a pair of primers, Cs7g03360-5-P1 (5′-TATCAGTACCAGTACCAGCAACAT-3′) and Cs7g03360-3-P2 (5′-TCCATATTAAGACGAAGATTCCCCAGT-3′) (Supplementary Figure 1B). After sequencing, seven potential sgRNAs were found in the conserved sequences, and two were singled out as SaCas9/sgRNA-directed targets, which were adjacent to PAM 5′NNGRRT (Supplementary Figure 1B). The conserved sequences were chosen as targets to target both allele of Cs7g03360 by the same sgRNA. Importantly, the sgRNA-targeting regions locate in the first exon of Cs7g03360 (Supplementary Figure 1).

To test the GFP-p1380N-SaCas9/sgRNA:cspds-mediated indels to CsPDS gene, 600 ng of Duncan genomic DNA, extracted from leaves treated by GFP-p1380N-SaCas9/sgRNA:cspds, was digested with NdeI overnight. Using the NdeI-cut genomic DNA as template, PCR was performed using primers CsPDS-5-P5 (5′-TGGCAATGTGATTGACGGAGATGC-3′) and CsPDS-3-P6 (5′-ATGAGTCCTCCTTGTTACTTCAGT-3′), flanking the targeted site of CsPDS.

Similarly, using StuI-digested Duncan genomic DNA prepared from leaves treated by GFP-p1380N-SaCas9/sgRNA:cs2g12470, the SaCas9/sgRNA-mediated modification was analyzed with a pair of primers Cs2g12470-5-P1 (5′-AGCTGATAGGCTTGTGCTTCAG-3′) and Cs2g12470-3-P2 (5′-AGGCATCTGGAATGAACCCAGA-3′).

The PCR products were ligated to the PCR-BluntII-TOPO vector (Life Technologies), and 16 random colonies were chosen for DNA sequencing. Chromas Lite program was employed to analyze the sequencing results.

Genomic DNA from 12 transgenic plants was used as template for PCR amplification using a pair of primers, Cs7g03360-5-P1 and Cs7g03360-5-P2. All PCR products were pooled to construct the DNA library for sequencing using an Illumina HiSeq 2500 platform at Novogene (Beijing, China). More than 50,000 paired-end reads were generated for each sample. The raw amplicon sequencing reads have been deposited in NCBI Bioproject database under the accession number PRJNA416781. The high quality reads were generated from the raw reads by de-multiplex, barcode and primer deletion using custom Perl script. To further guarantee the quality for each reads, the high quality reads were quality trimmed using sickle software with parameters average quality 30 and reads length threshold 200 bp (Fass et al., 2011). The remaining high-quality reads were clustered with a threshold of 100% pairwise identity using UCLUST (Edgar, 2010). The representative sequences from abundant clusters with relative abundance >1% were aligned using MEGA7 (Tamura et al., 2013) and further be analyzed for indel mutation genotype.

Though SaCas9/sgRNA has been used to modify Arabidopsis, tobacco and rice genome (Steinert et al., 2015; Kaya et al., 2016), it has not been used in citrus. Previously, Xcc-facilitated agroinfiltration was employed as rapid functional analysis of transgenes in citrus leaves, including SpCas9/sgRNA system (Jia and Wang, 2014b). Here, Xcc-facilitated agroinfiltration was employed to test whether SaCas9/sgRNA could be used to conduct citrus genome editing in Duncan grapefruit. Binary vectors GFP-p1380N-SaCas9/sgRNA:cspds and GFP-p1380N-SaCas9/sgRNA:cs2g12470 were constructed to edit CsPDS and Cs2g12470 of Duncan grapefruit, respectively (Figures 1A,B and Supplementary Figure 1A). It should be pointed out that the sgRNA-targeting region of CsPDS harbors NdeI (Figure 1A), and the sgRNA-targeting region of Cs2g12470 contains StuI (Figure 1B). Both NdeI and StuI locate in the predicted SaCas9/sgRNA-cleavage site (Ran et al., 2015), which is necessary for selective PCR amplification. Using either NdeI-digested or StuI-digested genome as template, selective PCR amplification of mutagenized CsPDS and Cs2g12470 was performed to assess SaCas9/sgRNA-mediated mutagenesis after Xcc-facilitated agroinfiltration. The sequencing results of 16 random colonies confirmed that both CsPDS and Cs2g12470 were mutated via SaCas9/sgRNA-mediated mutations (Figure 2), and the mutation occurred 3 bp upstream of the PAM sequence. It should be pointed out that the PAM sequence in CsPDS is 5′GTGGAT, which is a canonical SaCas9 PAM 5′NNGRRT, whereas in Cs2g12470 it is 5′TAGAGA, which belongs to the non-canonical PAM sequence (Ran et al., 2015; Kaya et al., 2016). Our results are consistent with the previous studies, in which SaCas9/sgRNA was reported to be capable of editing the sequence upstream of both the canonical and non-canonical PAMs (Ran et al., 2015; Kaya et al., 2016).

To generate citrus plants with homozygous mutations, we designed a binary vector to target Cs7g03360, a homologous gene of tomato Argonaute7 (SlAgo7), of Carrizo citrange. The homozygous mutant tomato, created by SpCas9/sgRNA-mediated disruption of SlAgo7, has the clear phenotype represented by the first leaves having leaflets without petioles and later-formed leaves lacking laminae (Brooks et al., 2014). Carrizo citrange leaf is composed of three leaflets, which is different from single leaf of Duncan grapefruit. Therefore it is reasonable to assume that easily detectable phenotypic changes will appear in Carrizo leaf, given that homozygous mutant Carrizo could be established by SaCas9/sgRNA-mediated Cs7g03360 targeting.

Sequence of Cs7g03360 was confirmed by sequencing and sgRNA was designed to target two conserved regions of Cs7g03360 in Carrizo citrange to generate deletion (Supplementary Figure 1B). The binary vector GFP-p1380N-SaCas9/35S-sgRNA1:AtU6-sgRNA2 was constructed to modify the two sites, which were designated as Site 1 and Site 2 (Figure 1C and Supplementary Figure 1B). Through Agrobacterium-mediated epicotyl transformation, 12 GFP-p1380N-SaCas9/35S-sgRNA1:AtU6-sgRNA2-transformed Carrizo plants were created, which were subsequently verified by GFP fluorescence and PCR (Figure 3).

The transgenic Carrizo was subjected to targeted next-generation sequencing (NGS) to analyze mutation genotypes and indel rate, mediated by SaCas9/sgRNA. The NGS results indicated that no large fragment deletion between Site 1 and Site 2 took place for all of Carrizo transformants, though SpCas9/sgRNA was successfully used to delete large fragment between two sgRNAs in some plant species (Ma et al., 2015). On the other hand, indel mutations mediated by SaCas9/sgRNA were observed for individual Site 1 and Site 2, as expected, occurring at 3 bp upstream of the PAM site (Figure 4), same as SpCas9/sgRNA-mediated mutations (Jia et al., 2016, 2017). Since the genotype of Site 1 and Site 2 could be either WT or Indel, there were four kinds of genotype combinations in transgenic Carrizo, (1) WT1/…/WT2: both Site 1 and Site 2 are WT, (2) WT1/…/Indel2: Site 1 is WT, whereas Site 2 is indel, (3) Indel1/…/WT2: Site 1 is indel, whereas Site 2 is WT, (4) Indel1/…/Indel2: both Site 1 and Site 2 are indel (Figures 4, 5A). It should be noted that Site 1 mutation genotypes were either 1A insertion or 1T insertion, whereas Site 2 mutation genotypes included 1A insertion, 1T insertion, and a variety of short deletions (Figures 4, 5A), which indicated that all Carrizo transformants were chimeric.

Based on targeted NGS results, the mutation rates of 12 Carrizo transformants were calculated. Including both Site 1 and Site 2, the rate of genotype WT1/…/WT2 was from 20.11 (Cz3) to 49.60% (Cz9), that of WT1/…/Indel2 was from 13.23 (Cz7) to 53.42% (Cz3), that of Indel1/…/WT2 was from 0.07 (Cz10) to 2.16% (Cz2), that of Indel1/…/Indel2 was from 14.57 (Cz12) to 38.42% (Cz7) (Figure 5A). When Cs7g03360 Site 1 was calculated alone, the mutation rates were from 15.55 (Cz12) to 39.13% (Cz7) (Figure 5B). In the case that only Cs7g03360 Site 2 was calculated, the mutation rates were from 49.01 (Cz9) to 79.67% (Cz3) (Figure 5C). Therefore, the mutation rate was different for each Carrizo transgenic line. Consistently, the SpCas9/sgRNA-transformed Duncan grapefruit also had different mutation rates (Jia et al., 2016, 2017).

Cs7g03360 function is unknown in Citrus. SlAgo, a homologous gene of Cs7g03360 in tomato, affects leaf development. Loss of its function in homozygous tomato leads to leaf abnormality (Brooks et al., 2014). In this study, there were no any visible phenotypes among all transgenic Carrizo plants (Supplementary Figure 2), which might be attributed to none of transgenic Carrizo containing Cs7g03360 homozygous mutation (Figures 4, 5). In SaCas9/sgRNA-transformed Arabidopsis, the indel mutations were heritable, and the homozygous plants were created in next generation (Steinert et al., 2015). It is possible to obtain the homozygous Cs7g03360-mutated Carrizo in the T₁ generation, which is useful to study Cs7g03360 function in citrus. Alternatively, the transgenic Carrizo could be harnessed as either maternal or paternal donor to produce Cs7g03360-knock-out plants in next generation through hybridizing with other citrus cultivar. However, to create homozygous Carrizo transformants in the T₀ generation via CRISPR/Cas9 still remains a great challenge for citrus genome editing. In a recent study, YAO promoter was harnessed to drive SpCas9 expression to promote indel efficiency in citrus (Zhang et al., 2017). It is reported that the Csy4 ribonuclease and tRNA processing enzymes can be used to simultaneously express 12 sgRNAs for efficient indel mutations, and the TREX2 exonuclease can also enhance mutagenesis (Cermak et al., 2017).

Using a web tool¹ (Bae et al., 2014), potential off-target mutagenesis induced by SaCas9/35S-sgRNA1:AtU6-sgRNA2 was filtered (Mismatch number = 3, RNA bulge size = 1), based on sweet orange genome. There was no off-targets for Cs7g03360 Site 1, on the other hand, three potential off-targets of Cs7g03360 Site 2 were identified (Supplementary Figure 3). The three potential off-targets were subjected to PCR-amplification, and sub-cloning. Five colonies for each off-target were randomly chosen for sequencing. The results demonstrated that no mutations took place in the three potential off-targets in the transgenic Carrizo plants (Supplementary Table 1).