The F2 mapping population was derived by crossing the North American cultivar ‘Williams 82’ with the cultivar ‘Peking,’ an introduction from China. Peking formed nitrogen-fixing nodules when inoculated with S. fredii USDA193 (Nod+) while Williams 82 restricted nodulation by this strain (Nod-) (Keyser et al., 1982). S. fredii USDA193, originally isolated from China (Keyser et al., 1982), was obtained from the National Rhizobium Germplasm Collection (USDA-ARS, Beltsville, MD, United States). The strain was cultured on YEM agar plates (yeast extract, 1.0 g/L; mannitol, 10.0 g/L; dipotassium phosphate, 0.5 g/L; magnesium sulfate, 0.2 g/L; sodium chloride, 0.1 g/L; calcium carbonate, 1.0 g/L; agar, 15.0 g/L) in the dark at 28°C for 4–5 days, and the bacterial paste was then collected and diluted in sterile water to OD₆₀₀ of 0.1. For nodulation assay, each 1-week-old seedling was flood-inoculated with 10 mL of the bacterial suspension. Plants were grown in sterilized 50/50 Perlite-Turface mix in a growth chamber programmed for 16 h light at 26°C and 8 h dark at 23°C. Nodulation phenotype was assayed 4 weeks post inoculation. Genotyping was conducted by using a CAPS (cleaved amplified polymorphic sequences) marker developed based on a SNP (single nucleotide polymorphism) between the Rfg1 (Williams 82) and rfg1 (Peking) alleles. The primer pair used was 5′TGAGAGTACTGGAATGGTGGAG3′ and 5′TTGCTGATCGAACCACTCTG3′, and the restriction enzyme used was HpaI.

The Williams 82 allele of Rfg1 was used for complementation tests. Genomic DNA of the Rfg1 allele was derived from the BAC clone Gm_WBa0019D20 of Williams 82 (Marek and Shoemaker, 1996) by digestion with PstI and BmgBI. The released 10.9-kb fragment included the 4.9-kb coding region, the 4.0 kb upstream of the start codon containing the promoter and 5′ untranslated region, and the 2.0 kb downstream of the stop codon encompassing the 3′ untranslated region. The DNA fragment was cloned into the binary vector pCAMBIA1305.1 through blunt end cloning. The binary vector was transferred into the Peking genetic background through hairy root transformation as described below. The transgenic roots were identified by GUS-staining because of the presence of a GUS expression cassette in the pCAMBIA1305.1 vector.

The CRISPR/Cas9 gene knockout constructs were developed based on the pHSE401 vector described by Xing et al. (2014). Two pairs of oligos were designed to specifically target two different sites within the fourth exon of Rfg1. For the first targeted site, we used the oligo pair 5′ATTGATGAGGACTTAAAAAGCTC3′ and 5′AAACGAGCTTTTTAAGTCCTCAT3′. For the second targeted site, we used the oligo pair 5′ATTGACAGTAAGC CTTACTACCT3′ and 5′AAACAGGTAGTAAGGCTTACTGT3′. The underlined sequences represent the targeted positions. The oligo pairs were first annealed to produce a double-stranded fragment with 4-nt 5′ overhangs at both ends, and then ligated into the BsaI-digested pHSE401 vector. The constructs were individually transformed to the Williams 82 (Nod-) background by means of hairy root transformation. To validate the CRISPR/Cas9-mediated gene disruption, the roots that formed nodules were subjected to DNA isolation, PCR amplification, and DNA sequencing. If the initial sequencing suggested the presence of multiple heterogeneous mutant alleles, the PCR product was ligated into pGEM T-Easy Vector System (Promega) and at least 10 colonies were selected for sequencing.

The Rfg1 allele that restricts nodulation by S. fredii USDA257 is allelic to Rj2, an allele that restricts nodulation by B. japonicum USDA122 (Yang et al., 2010). At this locus, there exist three type of alleles in natural populations of soybeans, including the Rj2 (rfg1) allele that restricts nodulation with USDA122 but allows nodulation with USDA257, the rj2 (Rfg1) allele that permits nodulation with USDA122 but restricts nodulation with USDA257, and the rj2 (rfg1) allele that nodulates with both strains. These allelic specificities are defined by seven amino-acid substitutions (Yang et al., 2010). However, we did not identify an Rj2 (Rfg1) allele type that prohibits nodulation with both USDA122 and USDA257 in the surveyed soybean lines (Yang et al., 2010). We thus modified the Rfg1 allele by replacing part of polymorphic sequence of Rfg1 with the corresponding sequence of the Rj2 allele, with the expectation to generate a chimeric gene that could lead to restriction of nodulation by both strains. For this purpose, we amplified two overlapping DNA fragments, one that contained the substitutions responsible for the Rj2 allelic function and another that possessed the substitutions required for the Rfg1 allelic function. We then used an overlapping PCR strategy to assemble the two DNA templates into a single one. The amplified fragment was then cloned into the EcoRI digested genomic construct of Rfg1 mentioned above using the In-Fusion Advantage PCR Cloning Kits (Clontech). We tested the function of this chimeric allele by transferring it into Peking, a genotype that formed nodules with both USDA122 and USDA257. To avoid redundancy, we will provide a further description of this experiment in the “Results” section.

Agrobacterium rhizogenes-mediated hairy root transformation was carried out based on the protocol described by Kereszt et al. (2007). Briefly, bacterial paste of the A. rhizogenes strain K599 that contains individual binary vectors was injected into the cotyledonary node of 1-week-old seedlings using a latex free syringe with a thin needle (0.4 mm × 13 mm) (1 ml 27G1/2, Becton, Dickinson & Co.). The infected seedlings were grown in sterile vermiculite and covered with plastic bags in a growth chamber to maintain high humidity. Two to three weeks after inoculation, when hairy roots were well developed at the infection sites, the main roots were removed, and the composite plants were inoculated with rhizobia. Nodulation assays were performed 4 weeks post inoculation.

Assay for root hair curling followed the method described in Yang et al. (2010). For anatomical analysis of nodules, nitrogen-fixing nodules of Peking and rudimentary nodules of Williams 82 were harvested 4 weeks post inoculation and immediately fixed in 4% paraformaldehyde (w/v) overnight at 4°C. The tissues were then dehydrated in a graded ethanol series followed by a graded series of xylene. After infiltrated in 50/50 Epon-Araldite resin and propylene oxide overnight and then in 75/25 Epon-Araldite resin and propylene oxide for 8 h, the samples were embedded in resin. Embedded tissues were sectioned (10 μm thick) with a microtome, stained with Toluidine Blue, and examined with bright-field optics.

Sinorhizobium fredii USDA193 formed mature nitrogen-fixing nodules on the roots of Peking (Figure 1A) but not on the roots of Williams 82 (Figure 1B). Despite being unable to form functional nodules in the Williams 82 background, the bacterial strain could frequently induce the formation of rudimentary nodules, bump-like small cortical proliferations on the roots (Figure 1B). In contrast to the infected nodules formed in the compatible interaction (Figure 1C), the rudimentary nodules on the roots of Williams 82 were completely devoid of infected bacteria; as such, the cortical cell division ceased at very early stage of the nodule development (Figure 1D). The ability to produce rudimentary nodules with USDA193 on the Williams 82 roots suggested that the early responses of Nod factor perception are not affected. Consistent with this inference, root hair curling, a hallmark of Nod factor responses, occurred in both compatible and incompatible interactions (Figures 1E,F). Thus, we concluded that the restriction of nodulation by S. fredii USDA193 in Williams 82 was not due to a failure in Nod factor perception but caused by the block of bacterial infection.

We carried out genetic analysis of the symbiosis incompatibility involving S. fredii USDA193 in an F2 population derived from the cross between Williams 82 (Nod-) and Peking (Nod+). From a small population of 122 plants inoculated by USDA193, 95 were Nod- and 27 were Nod+. The segregation statistically fits the 3:1 (Nod- to Nod+) ratio (χ² = 0.54, df = 1, P = 0.46), suggesting that the restriction of nodulation by USDA193 in Williams 82 is controlled by a single dominant gene. The dominant nature of the nodulation-restrictive allele supports our hypothesis that the incompatible interaction between Williams 82 and USDA193 was not due to a failure in Nod factor signaling but resembles ‘gene-for-gene’ resistance in the plant–pathogen interactions.

Williams 82 and Peking showed the same phenotype when inoculated with S. fredii strains USDA257 and USDA193, and we previously reported that the resistance to nodulation with USDA257 in Williams 82 is controlled by the dominant Rfg1 allele (Glyma16g33780) that encodes a TIR-NBS-LRR protein (Yang et al., 2010). We therefore suspected that Rfg1 possibly also confers resistance to S. fredii USDA193. To test this possibility, we started the mapping experiment by using a polymorphic DNA marker developed from Rfg1. Consistent with our hypothesis, linkage analysis in the aforementioned F2 population revealed co-segregation between the nodulation phenotypes and the marker genotypes. Thus, we considered Rfg1 as a candidate gene that restricts nodulation by S. fredii USDA193.

We first tested the Rfg1 gene by complementation tests using A. rhizogenes-mediated hairy root transformation. Because the transformation experiments were performed without selection, the hairy roots induced by A. rhizogenes included both transgenic and wild type, which can be readily distinguished by the GUS-staining assay. As shown in Figure 2, introduction of the Rfg1 allele of Williams 82 into the Peking background resulted in complete block of nodule formation on the transgenic roots. From >20 composite transgenic plants that possessed both transgenic and wild-type roots, nodules were formed on the wild-type roots but not on the transgenic roots.

We further used the CRISPR/Cas9-based reverse genetics tool (Doudna and Charpentier, 2014) to knock out the Rfg1 gene in the Williams 82 background (Nod-). For this purpose, we designed two gRNA vectors that individually target two different sites of the fourth exon (Figures 3A,B). The vectors were introduced to A. rhizogenes K599 for hairy root transformation, followed by assaying the nodulation capacity of the hairy roots by inoculation with S. fredii USDA193. For both vectors, we obtained >30 putative transgenic roots from more than 50 independent plants that formed mature nitrogen-fixing nodules. DNA sequencing validated the targeted gene disruption in these roots and these roots did not contain the wild-type allele. Two examples are illustrated in Figures 3C,D. Figure 3C shows that a transgenic root forming nodules resulted from the knockout of Rfg1 at the site 1, and sequence analysis revealed two mutant alleles, one with a 3-bp deletion and another with a 10-bp deletion. Figure 3D represents an example showing that knockout of Rfg1 at the site 2 also led to the formation of root nodules on a transgenic root; sequence analysis identified two mutant alleles, one with a 4-bp deletion and another with a 26-bp deletion when compared with the wild-type allele. Taken together, we conclude that Rfg1 is responsible for nodulation restriction by S. fredii USDA193 in Williams 82.

Rfg1 and Rj2 are allelic genes, each encoding a TIR-NBS-LRR protein of 1052 amino acids (Yang et al., 2010). A survey of a group of soybean lines identified three types of naturally occurring alleles, namely Rj2 (rfg1), rj2 (Rfg1), and rj2 (rfg1) (Yang et al., 2010). The Rj2 (rfg1) allele restricts nodulation with USDA122 but not with USDA257; the rj2 (Rfg1) allele restricts nodulation with USDA257 but not with USDA122; and the rj2 (rfg1) allele allows nodulation with both strains. These allelic specificities are determined by seven amino acid substitutions occurring around the C-terminus of the NBS domain and the sixth LRR repeat (Figures 4A,B). Comparing between Rj2 (rfg1) and rj2 (rfg1) and between rj2 (Rfg1), and rj2 (rfg1) suggests that E452 and I490 are required for the Rj2-mediated nodulation restriction against USDA122, while E731, N736, S743, D756, and S758 are essential for Rfg1-mediated resistance against USDA257 and USDA193. If this inference is true, then the chimeric gene of Rj2 and Rfg1, called Rj2 (Rfg1), encoding a protein with E452, I490, E731, N736, S743, D756, and S758, would prevent nodulation with both strains. We generated multiple transgenic roots (from >100 independent plants) expressing the chimeric gene in Peking that carries an rj2 (rfg1) allele and forms nodules with USDA257, USDA193, and USDA122. In consistence with our hypothesis, the transgenic roots restrict nodulation with both USDA257 (Figure 4C), USDA193 (Figure 4D), and USDA122 (Figure 4E). The transgenic roots retained their ability to nodulate with B. japonicum USDA110, a strain that nodulates both Rj2 and Rfg1 genotypes (Figure 4F).