Tomatoes (Solanum lycopersicum L. cv. Micro Tom) were planted in pots (diameter, 20 cm; depth, 20 cm) containing a mixture of nutrient soil, vermiculite, and organic fertilizer (4:2:1, v/v/v). Tomato seedlings were grown under standard conditions: 60% relative humidity and 25°C/18°C (day/night) under a 12 h/12 h light/dark cycle. Plants were watered daily to the drip point. Apple (Malus × domestica) callus tissue derived from the “Golden Delicious” cultivar was grown on Murashige and Skoog (MS) medium at 27°C ± 1°C in darkness, and subcultured at 10-day intervals before being used for gene transformation.

The cDNA sequences of full-length Arabidopsis CrRLK1Ls were obtained from TAIR (http://www.arabidopsis.org). To identify FER-like (FERL) genes in apple or rice, the coding sequence of FER (At3g51550) was used as a query to BLAST the apple genome database (http://genomics.research.iasma.it/) or NCBI (https://www.ncbi.nlm.nih.gov/). Phylogenetic trees were constructed using the Neighbor-Joining (NJ) method in MEGA 4.0.2 software (Tamura et al., 2007), with 1000 bootstrap replicates performed to evaluate the reliability of the different phylogenetic groups. The deduced amino acid sequences of the MdFERLs were aligned using ClustalX 2.0.12 (Larkin et al., 2007) with default settings. The alignments were edited and marked using GeneDoc (Nicholas et al., 1997).

To isolate MdFERL1 and MdFERL6, total RNA was extracted from the fruit using an EZNATotal RNA Kit (Omega Biotek), according to the manufacturer's instructions. First-strand cDNA synthesis was conducted from 1 μg of total RNA. Full-length MdFERL1 and MdFERL6 were cloned from cDNA by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the following conditions: 98°C for 30 s (one cycle); 98°C for 30 s, 59°C for 25 s, and 72°C for 5 min (35 cycles); with a final extension of 72°C for 2 min. The PCR products were subcloned into the pCambia1304 vector and used to produce positive colonies. The primer sequences and GenBank accession numbers are shown in Supplemental Table S1.

RT-qPCR was performed using SYBR Premix Ex TaqTM (Takara Bio) in a 7500 Real-Time PCR System (Applied Biosystems). The expression level of each gene was analyzed in three pools of five fruits, with three measurement replicates per pool. ACTIN was used as an internal control. The 2^−ΔΔCT method was used to determine transcription levels, where ΔCT represents the difference between the cycle threshold values of the target and reference genes (Schmittgen and Livak, 2008).

The whole process from fruit set to ripening was classified into five stages based on days post-anthesis (DPA), namely 60DPA, 85DPA, 105DPA, 130DPA, and 155DPA. The fruit was frozen in liquid nitrogen, and kept at –80°C until required for gene expression analysis. The expression of MdFERL and ripening marker genes was assessed by RT-qPCR analysis, using primers designed in Primer3 Plus (http://www.primer3plus.com/cgi-bin/dev/primer3plus.cgi). Primer sequences are shown in Supplemental Tables S2, S3, S5. The data from five fruits were combined as an individual sample and each sample was analyzed in triplicate.

For the apple fruit treatment, 5 g of fruit disks (10 mm in diameter and 1 mm in thickness) was prepared and combined from six fruits at the 105 DPA stage. The disk samples were vacuum infiltrated for 30 min in equilibration buffer (10 mM MgCl₂, 50 mM MES-Tris (pH 5.5), 5 mM CaCl₂, 10 mM EDTA, 200 mM mannitol, and 5 mM vitamin C) (Archbold, 1988). The samples were then shaken for 6 h at 25°C in equilibration buffer containing 1 mM ACC or 3 μM 1-MCP. After incubation in the dark for 6 h, the samples were washed and frozen immediately in liquid nitrogen, and maintained at –80°C until required. Each individual analysis was conducted with three sample replicates. Primers used for the RT-qPCR analysis of ripening-related genes are provided in Supplemental Table S2.

To treat apple calli with 1-MCP, the calli were transfected with MdFERL6-AS and empty pCambia1304 vector, and then cultivated on MS medium at 27°C in darkness. Three days after the transfection, calli were treated with 3 μM 1-MCP for 6 h and expression of the selected genes was analyzed as described above.

To construct vectors for the overexpression (OE) of MdFERL1 (MDP0000445374) and MdFERL6 (MDP0000465341) (abbreviated hereafter as MdFERL1-OE and MdFERL6-OE), full-length MdFERL1 and MdFERL6 were respectively cloned into the plant expression vector pCambia1304 using the KpnI and EcoRI restriction sites. The empty pCambia1304 vector and the overexpression vectors MdFERL1-OE and MdFERL6-OE were transformed individually into the Agrobacterium tumefaciens strain EHA105 (Lazo et al., 1991). For the MdFERL6-antisense (as) vector, a 621-bp fragment near the 5′ end of MdFERL6 cDNA was amplified by PCR using the primer pair 5′-GAATTCGTCCACGAACGTGTCTC -3′ (with an EcoRI restriction site; forward) and 5′- GGTACCGGATCGTTGATCTCAGAG -3′ (with a KpnI restriction site; reverse). The obtained fragment was sequenced and forward-cloned into the EcoRI and KpnI restriction sites of pCambia1304. To generate the TRV-VIGS (virus-induced gene silencing) vectors, a 595-bp fragment of SlFERL1 (GenBank accession number KY435602) was PCR-amplified from tomato cDNA. The resulting product was cloned into the vector pTRV2 to generate pTRV2-SlFERL1. The A. tumefaciens strain GV3101 containing vectors pTRV1 or pTRV2 and their derivatives was used for the VIGS experiments.

The transformed strains were grown at 28°C in Luria-Bertani liquid medium containing 10 mM MES, 20 μM acetosyringone, and the appropriate antibiotics. When the culture reached an optical density at 600 nm of approximately 0.8, the A. tumefaciens cells were harvested, resuspended in infection buffer (10 mM MgCl₂, 10 mM MES (pH 5.6), and 200 mM acetosyringone), and shaken for 2 h at room temperature before being used for infiltration. For VIGS infiltration, each A. tumefaciens strain containing pTRV1 and pTRV2 or their derivative vectors was mixed at a ratio of 1:1 and infiltrated into the carpopodium of tomato fruits attached to the plant about 18 days after pollination, using a 1-mL needle-less syringe. Pairs of fruit at the same developmental stage and with similar phenotypes were selected; for each pair, one fruit was transfected with MdFERL1-OE, MdFERL6-OE, or SlFERL1-VIGS, while the other was transfected with an empty vector as the control. For each gene, 25 pairs of fruit were injected. To examine the effect of MdFERL1-OE, MdFERL6-OE, and SlFERL1-VIGS on the expression of ripening-related genes, the fruits were collected 10 dayd after transfection for MdFERL1-OE and MdFERL6-OE, and 12 days after transfection for SlFERL1-VIGS.

Callus tissues were subcultured three times at 15-day intervals before being used for gene transformation. The fresh calli were soaked for 20 min in an A. tumefaciens solution containing the MdFERL6-OE or MdFERL6-AS constructs, or the empty vector. The calluses were co-cultured on MS medium at 25°C.

Flesh firmness was measured after skin had been removed on opposite sides of the fruit using a GY-4 fruit hardness tester (Zhejiang Top Instrument). The contents of fruit pigment, flavonoid, and total phenol were determined as described (Fuleki and Francis, 1968; Lees and Francis, 1971). The soluble sugar content was determined as described by Jia et al. (2011). Titratable acidity was calculated as malic acid. The total titratable acidity was determined using the acid-base titration method (Kafkas et al., 2007). Fruit aroma production was characterized by performing a headspace solid-phase microextraction and gas chromatography-mass spectrometry, as described by Dong et al. (2013).

To measure ethylene production, intact fruits were enclosed in a gas-tight container (0.86 L, 24°C) equipped with septa, and 1 mL of headspace gas was sampled using a gas syringe. The ethylene concentration was measured using a gas chromatograph (GC-17A, Shimadzu). Six fruits were assessed as one sample, and three replicates were performed.

For BiFC assays, the full-length coding sequences of MdFERL1, MdFERL6, MdSAMS, MdETR2, MdETR5, MdACS3, and MdACS5 were amplified and individually cloned into pCambia1300-YFP(n/c) vectors. To determine the subcellular localization of MdFERL6, the full-length cDNA sequence was amplified and fused to green fluorescent protein (GFP) in the pMDC83 plant expression vector. A coexpression analysis was conducted in tobacco (Nicotiana tabacum) leaves as described by Schütze et al. (2009). Fluorescence was observed 3 days after transformation using a confocal laser-scanning microscope (Fluoview FV1000, Olympus). Maize (Zea mays) protoplast isolation and transformation were carried out according to a protocol described by Sheen et al. (1995), with minor modifications (Li et al., 2012). The primers used are listed in Supplemental Table S4.

For CoIP assays, the vector pMDC83:His-MdFERL6-GFP was used to generate the fusion protein His-MdFERL6-GFP, and the vector pCambia1300:Myc-MdSAMS-YFPn was used to generate the fusion protein Myc-MdSAMS-YFPn. The primers used are listed in Supplemental Table S4. His-MdFERL6-GFP and Myc-MdSAMS-YFPn were co-transformed into apple calli, using co-transformation of His-MdFERL6-GFP and pCambia1300-Myc-YFPn or Myc-MdSAMS-YFPn and pMDC83-GFP as control. The total proteins were extracted 3 days after transformation using extraction buffer (25 mM Tris–HCl, 1 mM EDTA, 10% glycerin, 0.5% Triton X-100, and 1 mM DTT). Protein A+G-Sepharose beads (100 μL, ComWin Biotech) were incubated with 10 μL polyclonal anti-Myc or anti-His antibody (ComWin Biotech) for 2 h at 4°C. An equal amount of anti-Myc antibody-coupled Protein A+G-Sepharose beads was added to total protein samples expressing Myc-MdSAMS-YFPn/His-MdFERL6-GFP and Myc-MdSAMS-YFPn/pMDC83-GFP, and detected with anti-His antibody. An equal amount of anti-His antibody coupled Protein A+G-Sepharose beads was added to total protein samples expressing Myc-MdSAMS-YFPn/His-MdFERL6-GFP and His-MdFERL6-GFP/ pCambia1300-Myc-YFPn and detected with anti-Myc antibody.

Apple calli were transfected with MdFERL6-OE, MdFERL6-AS, and empty vector, and then cultivated on MS medium containing 0, 100, and 200 μM L-ethionine. The growth status of calli was used to reflect the activity of SAM synthase. After a 7-days incubation at 25°C, the weights of the calli were measured and MdFERL6 and MdSAMS expression were determined by qRT-PCR.

Samples were analyzed in triplicate, and the data were noted as the mean + SD. Data were analyzed by Student's t-test using SAS software (version 8.1, USA), and the least significant difference at a 0.05 level of probability was used to explore the effect of P input on parameters. P < 0.05 was considered as significantly different, P < 0.01 was considered as highly significantly different. The statistical significance of differences between samples in Figure 6C was tested with ANOVA using the SAS software package 8.02 and the least significant difference (LSD) was used to compare the means.

The FER-like receptor kinases (FERLs) belong to the CrRLK1L family. To identify FER-like genes in apple, we first conducted a genome-wide screen for members of the MdCrRLK1L family. The MdCrRLK1L family consists of 34 members, which can be divided into six clades (Figure 1). A comparison of the MdCrRLK1L family with the AtCrRLK1Ls of Arabidopsis thaliana and the OsCrRLK1Ls of rice (Oryza sativa) indicated that the functionally characterized representative members of AtCrRLK1L, i.e., FERONIA, NAXUR, HERK, and THESEUS, were distributed in different clades, with FER being located in clade II. Interestingly, all members of clade I were apple CrRLK1Ls, suggesting that this group of CrRLK1Ls could be specific to the apple genome. Compared to other genes, the proteins encoded by members of clades I and clade II showed a relatively higher amino acid sequence identity with FER, and hence were designated as FERLs (FERONIA-Like receptor kinase). There were 17 MdFERL members, designated as MdFERL1–17. Clades I and II contained 12 and 5 MdFERLs, respectively. When the MdFERLs were aligned, all members were found to have an extracellular domain containing a malectin domain, which is predicted to bind carbohydrates.

The expression patterns of FERLs during fruit development and ripening are commonly correlated with their corresponding functions. To investigate the potential roles of MdFERLs in apple, we first examined their expression patterns in relation to fruit development and ripening. Apple fruit development and ripening occur between anthesis and the time when fruits are ready to be harvested (i.e., during a period of about 160 days) (Figure 2A). A preliminary examination by RT-PCR detected only six MdFERL members with a relatively high transcript level in the fruits (Supplemental Figure S1A); therefore, these six genes were further analyzed by RT-qPCR. Two of these genes, MdFERL1 and MdFERL6, were expressed more than 10- to 1,000-fold higher than the others. Strikingly, unlike the expression patterns for the other MdFERL members examined, the transcript level of MdFERL6 was high at the early stages of fruit development, but quickly declined after about 105 DPA (Figure 2B). It has been reported that ethylene production in “golden” apple fruit peaks at around 105 DAF, then remains high during the fruit development and ripening stages (Li et al., 2015). Accordingly, we found that most ethylene biosynthesis and signaling transduction genes, such as MdACO1, MdACO2, MdACS1, MdACS3, MdERF2, and MdERF3, were significantly upregulated at around 105 DPA and remained high from then onwards (Figure 2C). Comprehensive analysis of the unique expression pattern of MdFERL6 and of ethylene evolution in apple fruit, suggests that MdFERL6 regulates ethylene production in apple fruit.

To further characterize the onset of ripening in apple fruit, we evaluated the expression of ripening-related genes such as key transcription factor genes and structural genes involved in pigment accumulation, starch degradation, sugar metabolism, acid metabolism, and fruit softening (Figure 2C). Most ripening-related genes examined, including the softening genes MdBG, MdEXP1, and MdXYL1, pigment metabolism genes MdMYB10, MdCHS, MdDFR, and MdUFGT, and the sugar metabolism gene MdSPS1, were strongly up-regulated after 105 DPA. Starch biosynthesis genes did not follow this pattern, and were down-regulated at this time point. Collectively, these results suggest that MdFERL6 is a regulator of ethylene-mediated fruit ripening.

To further explore the relationship between FERLs and ethylene in apple fruit, we examined the effects of 1-MCP, an inhibitor of ethylene perception, and ACC (1-aminocyclopropanecarboxylic acid), a precursor of ethylene, on the expression of the six MdFERLs evaluated earlier. As shown in Figure 3, MdFERL1, MdFERL6, MdFERL8, and MdFERL12 were upregulated by 1-MCP and suppressed by ACC treatment; however, MdFERL7 could only be induced by 1-MCP and MdFERL14 was only suppressed by ACC (Figure 3).

As mentioned above, MdFERL1 and MdFERL6 have the highest transcript levels in apple fruit among the FERLs examined. MdFERL1 has the highest level of amino acid identity with Arabidopsis FER, while MdFERL6 belongs to the group of CrRLK1Ls that appears to be specific to the apple genome. We thus examined the potential roles of MdFERL1 and MdFERL6 in fruit ripening and development. Our attempt to manipulate the expression of these genes in a variety of apple species under different conditions failed. However, methods of transgenic manipulation are well established in tomato; therefore, we heterologously expressed MdFERL1 and MdFERL6 in tomato fruit. Expressing either MdFERL1 or MdFERL6 in tomato fruit delayed ripening in comparison with the control fruit transformed with empty vector (Figure 4A). Since a dramatic increase in ethylene biosynthesis is a critical signal controlling apple and tomato fruit development and ripening, we examined the effects of MdFERL1 and MdFERL6 on ethylene production. The heterologous expression of MdFERL1 or MdFERL6 both resulted in a significant reduction in ethylene production in comparison with the control (Figure 4B). Notably, the regulatory effect of MdFERL6 on both fruit ripening (Figure 4A) and ethylene production (Figure 4B) was much stronger than that of MdFERL1. These results, in combination with the finding that MdFERL6 was potentially specific to the apple genome and that the expression pattern of MdFERL6 was most tightly associated with fruit ripening, prompted us to select this gene for further studies using overexpression and antisense manipulation in apple fruit calli. We found that MdFERL6 overexpression greatly suppressed ethylene production, and conversely, that antisense expression greatly promoted ethylene production (Figure 4C).

Since the heterologous expression of MdFERL1/6 in tomato fruits in combination with the overexpression and antisense expression of MdFERL6 in apple fruit calli strongly implicated FERLs in fruit ripening and ethylene production, we investigated the effect of FERL downregulation on fruit ripening. Using VIGS, we investigated the effect of downregulating tomato FERL expression on fruit ripening. A search of the tomato genome identified a total of six FERLs, designated SlFERL1–6, which contained many relatively conserved domains (Supplemental Figure S2). SlFERL1 shared 55.3% amino acid sequence identity with FER, and could be considered a FER homolog; therefore, we selected SlFERL1 for VIGS manipulation. Unexpectedly, VIGS of SlFERL1 caused a great decrease in the transcript levels of not only SlFERL1, but also of the other five SlFERLs (Figure 5A). Furthermore, VIGS of SlFERL1 greatly promoted fruit ripening (Figure 5B) and ethylene production (Figure 5C).

Fruit ripening involves dramatic changes in a series of physiological parameters, such as pigment content, sugar/acid content, aroma, flavor, and texture. The effect of FERL manipulation on fruit ripening described above is reflected by a change in pigment accumulation. To decipher the roles of FERLs in fruit development and ripening, we examined their effects on some related physiological parameters. Given that VIGS-mediated silencing of SlFERL1 downregulated the expression of several other FERL members, and importantly, that it affected fruit ripening more strongly than OE, we analyzed various physiological parameters of the VIGS line. We found that SlFERL1-VIGS affected several major physiological parameters associated with fruit ripening and quality (Table 1). Strikingly, while SlFERL1-VIGS had only a small effect on fructose content, it had a major impact on both sucrose and glucose contents.

To further probe the mechanisms by which MdFERLs influence fruit development and ripening, we examined the altered expression of important fruit development genes following the manipulation of the MdFERLs. Given that ethylene production was greatly affected by the changes in the expression of the MdFERLs, we focused on genes associated with ethylene biosynthesis and signaling responses, such as ACO, ACS, ERF, E4, and E8. We also examined the expression of several marker genes of fruit ripening and quality, such as CHS, F3H, ANS, and PSY, which function in pigment metabolism, SS and SPS, which are involved in fruit sugar metabolism (fruit quality), PG, PME, XYL, and EXPs, which function in cell wall metabolism (fruit texture), and RIN, CNR, and HB1, which encode ripening-related transcription factors in tomato. Heterologous expression of MdFERL1 and MdFERL6 in tomato fruits significantly suppressed the expression of most of the genes examined, except for SPS1 and SS, which were up-regulated rather than suppressed, and EXP1, which was not altered (Figure 6A). In accordance with these observations, VIGS of SlFERL1 resulted in an increase in the transcript levels of most of the genes examined, particularly ACS, E4, and E8, but the expression of SS and SPS1 decreased, while no change was observed for ACO1 or ACO2 (Figure 6B). To further reveal how MdFERL6 regulates fruit ripening and to identify its precise role in ethylene-mediated fruit ripening, we examined the expression of various genes involved in the regulation of ethylene biosynthesis, ethylene signaling transduction, and fruit ripening in apple fruit calli in which the levels of MdFERL6 had been manipulated. Overexpression of MdFERL6 caused a dramatic decrease in the expression of the ethylene biosynthesis genes MdACO1, MdACS1, MdACS5; ethylene signal transduction genes MdCTR1, MdETR2, and MdETR5; and fruit ripening-related genes MdCEL4, MdPG1, and MdXYL1 (Figure 6C). By contrast, antisense expression of MdFERL6 caused a great increase in the expression of these genes (Figure 6D). Furthermore, the expression of most of the analyzed genes was suppressed by 1-MCP treatment. Interestingly, MdACO2, MdACS5, MdETR5, MdERF1, MdCEL4, MdPG1, MdEXP1, and MdPME1 expression was less sensitive to 1-MCP treatment in apple calli harboring the MdFERL6 antisense construct (MdFERL6-AS) than in non-transgenic control calli treated with 1-MCP, while the expression of MdSS1 and MdSPS1 was more sensitive to 1-MCP treatment, suggesting that all of these genes are regulated by ethylene through MdFERL6-mediated pathways. However, compared to non-treated MdFERL6-AS calli, the expression of MdACS1, MdACS3, MdETR2, MdCTR1, MdERF2, MdXYL1, and MdEXP1 was not significantly altered by 1-MCP, suggesting that MdFERL6 also regulates fruit ripening via an ethylene-independent mechanism or that MdFERL6 functions downstream of the examined signaling proteins (e.g., MdCTR1 and MdERF2; Figure 6D). The intricate roles of MdFERL6 in the regulation of fruit ripening and ethylene signal transduction merit further investigation.

Given that MdFERL1 and MdFERL6 were shown to regulate ethylene production as well as ethylene responses, we further tested the possibility that these enzymes physically interact with key enzymes in the ethylene biosynthesis pathway and the signaling proteins involved in the ethylene response. The ethylene receptor ETRs are central proteins in ethylene signal transduction, and are localized to the endoplasmic reticulum. Interestingly, in addition to its localization to the membrane, MdFERL6 was also found to localize to the ER (Figure 7A). We thus tested the possibility that MdFERL6 interacts with ethylene receptors, using a BiFC assay. We also tested whether three well-characterized key enzymes in the ethylene biosynthesis pathway, SAMS, ACS, and ACO, could interact with MdFERL1 and MdFERL6. While fluorescence was not observed in the control (combination of empty vectors) or in the combinations of MdFERL6 and MdACS and of MdFERL6 and MdACO, strong fluorescence appeared when MdSAMS-YFPⁿ was combined with MdFERL1 and MdFERL6 (Figures 7B,C). Furthermore, MdFERL6 did not appear to interact with the ethylene receptor MdETRs. The interaction between MdFERL1/6and SAMS further indicate that MdFERL1 and MdFERL6 modulate ethylene production during fruit development and ripening. To test whether MdFERL6 could interact with MdSAMS in apple calli, we conducted a co-immunoprecipitation (Co-IP) assay. As shown in Figure 7D, the Myc-MdSAMS protein complex (43 kD) was co-immunoprecipitated by His-MdFERL6 with anti-His antibody, and the His-MdFERL6-GFP complex (98 kD) was co-immunoprecipitated by Myc-MdSAMS with anti-Myc antibody. These results suggest that MdFERL1 and MdFERL6 may interact in vivo.

Having demonstrated that MdFER6 physically interacts with MdSAMS in apple, we further examined the roles of the MdFERL-SAMS protein complex in ethylene production by performing an ethionine activity assay. Ethionine is a toxic analog of methionine (Met). When cultivated with ethionine, plants with higher SAMS activity absorb more ethionine, resulting in toxic symptoms. Thus, plant growth status can be used as an indicator of SAMS activity (Mao et al., 2015). As shown in Figure 8, when cultivated in the presence of ethionine, the growth status of MdFERL6-OE and MdFERL6-AS transgenic calli was altered. MdFERL6-AS transgenic calli were more sensitive than control calli to ethionine treatment. After 7 days of cultivation, MdFERL6-AS transgenic calli had become pale and gained less weight than control calli, suggesting that SMAS has higher activity in MdFERL6-AS transgenic calli than in the control. Furthermore, after 7 days of cultivation, MdFERL6-OE transgenic calli had become dark yellow and, for the 200 μM treatment, had gained more weight than the control, indicating that overexpression of MdFERL6 suppresses SAMS activity (Figures 8A,B). Furthermore, the expression of MdSAMS was increased in MdFERL6-AS and repressed in MdFERL6-OE, suggesting that MdFERL6 affects SAM synthesis through both activity level and transcription level (Figure 8C).

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.