Mature seeds of a putative glyphosate-resistant (RG) rigid ryegrass biotype were collected in July 2013 from an olive grove, “El Álamo,” located in Beas de Segura, Jaén province, southern Spain. This olive grove had been treated with larger field doses than 1800 g ae ha^-1 glyphosate for at least 11 consecutive years (Roundup^®, 360 g ae L^-1 as isopropylamine salt). Seeds of a susceptible (SG) ryegrass biotype were collected from a nearby olive grove that had never received glyphosate treatments. Seeds were stored for 3 months under laboratory conditions and thereafter germinated in Petri dishes with filter paper moistened with distilled water, placed in a growth chamber at 28/18°C (day/night), i.e., near optimal temperature conditions (Steadman et al., 2003), under a photoperiod of 16 h, 850 μmol m^-2 s^-1 photosynthetic photon flux, and 80% relative humidity. Resulting seedlings of RG and SG biotypes were transplanted into pots containing sand/peat in a 1:1 (v/v) ratio and placed in a growth chamber under the environmental conditions described.

Herbicide treatments were applied at the 3–4 leaf growth stage. Glyphosate was applied in a laboratory chamber (SBS-060 DeVries Manufactering, Hollandale, MN, USA) equipped with 8002 flat fan nozzles delivering 200 L ha^-1 at 250 KPa at the height of 50 cm. The following glyphosate (Roundup^® Energy SL, 450 g ae L^-1 as isopropylamine salt, Monsanto) rates were used: 0, 31.25, 62.50, 125, 250, 500, 1000, 2000, and 4000 g ae ha^-1. The experiment was designed using five replicates per rate. Plant mortality and dry mass were evaluated 21 days after the application (DAT). Dry mass was measured for aboveground parts of RG and SG plants after drying at 60°C for 72 h in a heater (J.P. Selecta S.A., Barcelona, Spain).

The time patterns and extent of shikimate accumulation in glyphosate-exposed leaves of SG and RG rigid ryegrass plants were studied following two different spectrophotometric analyses. In the first analysis, 50 4-mm leaf disks were harvested from the youngest fully expanded leaf at the 3–4 tiller stage from 15 plants per biotype (Hanson et al., 2009). Five disks of fresh tissue were transferred to 2 mL eppendorfs containing 1 mL of 1 mM NH₄H₂PO₄ (pH 4.4). One microliter of glyphosate was added to eppendorfs at the following concentrations: 0, 0.1, 0.5, 1, 5, 10, 50, 100, 200, 400, 500, 600, and 1000 μM. The eppendorfs were incubated in a growth chamber during 24 h under the above conditions. After 24 h, the eppendorfs were stored at -20°C until further analysis. Eppendorfs were removed from the freezer and thawed at 60°C for 30 min. Thereafter, 250 μL of 1.25 N HCL was added to each eppendorf. Again, they were introduced at 60°C for 15 min. A 125 μL aliquot from each eppendorf was pipetted into a new 2 mL eppendorf, and 500 μL of periodic acid and sodium metaperiodate (0.25% [wt/v] each) was added. After incubation at room temperature for 90 min, 500 μL of 0.6 N sodium hydroxide and 0.22 M sodium sulfite were added. Finally, the eppendorf’s content was transferred to glass vials. Samples were measured in a spectrophotometer at 380 nm within 30 min. For each glyphosate concentration and biotype, five replications were established and repeated twice.

In the second analysis, RG and SG plants at the 3- to 4-leaf stage were treated with glyphosate at 300 g ae ha^-1 using the laboratory spray chamber and treatment conditions described above. At 24, 48, 72, and 96 h after treatment (HAT), 50 mg of plant tissue was harvested and placed in a vial containing 1 mL of 1 M HCl and then immediately frozen in liquid nitrogen. Shikimic acid accumulation was determined according to Singh and Shaner (1998). Sample absorbance was measured with a Beckman DU-640 spectrophotometer at 380 nm. Net shikimic acid accumulation was deduced from the difference between treated and non-treated plants in each biotype. The test was performed in triplicate on five treated and five non-treated plants per biotype.

The assays were carried out according to Cruz-Hipolito et al. (2011). ¹⁴C-glyphosate (American Radiolabeled Chemicals, Inc., Saint Louis, MO, USA) was added to a commercial glyphosate to achieve a specific activity of 0.834 kBq μL^-1. The final glyphosate concentration corresponded to 300 g ae ha^-1 applied in 200 L ha^-1. Plants of the RG and SG biotypes at the 3- to 4-leaf growth stage were treated with a drop of 1 μL (0.834 kBq plant^-1) deposited with a micropipette (LabMate) onto the adaxial surface of the second leaf.

The treated leaf was washed with 3 mL of water: acetone (1:1 v/v) solution to remove non-absorbed ¹⁴C-glyphosate at 12, 24, 48, 72, and 96 h after drop application. The rinsate was mixed with 2 mL of scintillation cocktail and analyzed by liquid scintillation spectrometry (LSS) on a scintillation counter (Beckman LS 6500, Fullerton, CA, USA). The remainder of the plant was removed from the pot, and its roots were carefully washed with distilled water. The plant was divided into treated leaf, remaining shoot tissue, and roots. The plant parts thus obtained were dried at 60°C for 96 h and combusted in a Packard Tri Carb 307 biological sample oxidizer. Evolved ¹⁴CO₂ was trapped and counted by LSS in a 18 mL mixture of Carbo-Sorb E and Permafluor E+ (1:1v/v) (PerkinElmer, Packard Bioscience BV). The amount of radiolabel deposited was checked by washing a treated leaf excised immediately after deposition. The experiment was arranged in a completely randomized design with five replicates and repeated twice. The mean radioactivity recoveries were 93.17 ± 2.48% and 95.86 ± 3.39% for RG and SG biotypes, respectively. The proportion of absorbed herbicide was expressed as [kBq in combusted tissue/(kBq in combusted tissue + kBq in leaf washes)] × 100.

Translocation of ¹⁴C-glyphosate in plants of RG and SG biotypes of rigid ryegrass was also visualized using a phosphor imager (Cyclone, PerkinElmer). Plants were treated and collected in the same way as described in the uptake and translocation assays. The whole plants were gently rinsed, pressed, and then left to dry at room temperature during 4 days. The dried plants were placed adjacent to a 25 cm × 12.5 cm phosphor storage film for 13 h and scanned for radiolabel distribution on a phosphor imager. Three plants were analyzed per biotype.

Plants of RG and SG biotypes at the 3- to 4-leaf growth stage were treated with glyphosate at a rate of 300 g ae ha^-1 as described in the dose-response assays section, while other plants were kept without treatment as non-treated controls. At 96 HAT, following the methodology described by Rojano-Delgado et al. (2010), glyphosate and its metabolites, i.e., aminomethylphosphonic acid (AMPA), glyoxylate, sarcosine, and formaldehyde, were determined by reversed polarity capillary electrophoresis using a G1600A Capillary Electrophoresis System (Agilent, Santa Clara, CA, USA) instrument equipped with a diode array detector (DAD, wavelength range 190–600 nm). Glyphosate, AMPA, sarcosine, formaldehyde, and glyoxylate were used as standards. Leaf tissues were washed with distilled water, flash-frozen in liquid nitrogen, and stored at -40°C until use. The aqueous background electrolyte consisted of 10 mM potassium phthalate, 0.5 mM hexadecyltrimethylammonium bromide, and 10% acetonitrile at pH 7.5. Calibration equations were established from non-treated plants and known concentrations of glyphosate and its metabolites, which were determined from their peak areas in the electropherogram. The average value for the content of glyoxylate naturally produced by the plant was subtracted from the average content of each biotype. The experiment was arranged in a completely randomized design with five replications per biotype and repeated twice.

The enzyme extraction was conducted according to the protocol described by Sammons et al. (2007). Five gram of the leaf tissue of RG and SG biotypes of rigid ryegrass plants were ground to fine powder in a chilled mortar. Immediately after that, the powdered tissues were transferred to tubes containing 100 mL of cold extraction buffer (100 mM MOPS, 5 mM EDTA, 10% glycerol, 50 mM KCl, and 0.5 mM benzamidine) containing 70 μL of β-mercaptoethanol and 1% in polyvinylpolypyrrolidone (PVPP). Samples were previously stirred and subsequently centrifuged for 40 min (18,000 × g) at 4°C. The supernatant was decanted into a beaker through a cheesecloth. (NH₄)₂SO₄ was added to the solution to obtain 45% (w/v) concentration, with stirring during 30 min. After that, the mix was centrifuged at 20,000 × g for 30 min at 4°C. The previous step was repeated to precipitate the protein in the extracts but in that case with a (NH₄)₂SO₄ concentration of 80% (w/v) stirring for 30 min. Finally, they were centrifuged at 20000 × g for 30 min at 4°C. All the pellets were dissolved in 3 mL of extraction buffer and dialyzed in 2 L of dialysis buffer (30 mm, 1000-MWC dialysis tubing at 4°C on a stir plate) over 12 h. The protein concentrations were determined by Bradford assay.

The assay for the determination of EPSPS activity followed the methodology described by Dayan et al. (2015) using the EnzCheck^® phosphate assay Kit (Invitrogen, Carlsbad, CA, USA) to determine the inorganic phosphate release. The EPSPS activity from biotypes was determined in the presence and absence of glyphosate. The glyphosate concentrations used were 0, 0.1, 1, 10, 100, and 1000 μM to determine the enzyme activity inhibition. The assay buffer used was composed of 1 mM MgCl₂, 10% glycerol, and 100 mM MOPS, 2 mM sodium molybdate and 200 mM NaF. The experiment was repeated three times with three replications at each glyphosate concentration. EPSPS enzyme activity was expressed as percentage of enzyme activity in presence of glyphosate with respect to the control (without glyphosate). The EPSPS activity was calculated to determine the amount of phosphate (μmol) released μg of total soluble protein (TSP)^-1 min^-1.

Total RNA was isolated from leaves using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA was then treated with TURBO DNase (RNase-Free; Ambion, Warrington, UK) to eliminate any DNA contamination and stored at -80°C. RNA integrity was verified in 0.8% agarose gel. The amount and quality of the RNA was measured by a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Walthman, MA, USA). First strand complementary DNA (cDNA) synthesis was started from the totality of the RNA adjusted to the same concentration in all the samples (50 ng μL^-1). An iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at a total reaction volume of 40 μL was employed following the manufacturer’s instructions. Primers (forward: 5′ AGCTGTAGTCGTTGGCTGTG 3′; reverse: 5′ GCCAAGAAATAGCTCGCACT 3′) were used and expanded a 543-bp fragment of the EPSPS gene that contains the mutation site described as conferring resistance to glyphosate in Lolium species. The PCR reactions were carried out using cDNA from 50 ng of total RNA, 1.5 mM MgCl₂, 0.2 mM dNTP, 0.2 μM of each primer, 1 × buffer, and 0.625 units of a 100:1 enzyme mixture of non-proofreading (Thermus thermophilus) and proofreading (Pyrococcus furiosus) polymerases (BIOTOOLS, Madrid, Spain) in a final volume of 25 μL. All PCR reactions were in duplicate and cycling conditions were: 94°C for 3 min, 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, with a final extension cycle of 72°C for 10 min. An aliquot of the PCR product was loaded in a 1% agarose gel to check the correct band amplification. The rest of the PCR product was then purified using ExoSAP-IT^® for PCR Product Clean-Up (USB, Cleveland, OH, USA) as indicated by the manufacturer. Fifteen purified PCR products per biotype were sequenced (STAB VIDA, Caparica, Portugal). The resulting fragments were aligned and numbered based on published EPSPS sequences for rigid ryegrass [R rigid ryegrass from Fernandez et al. (2015); S rigid ryegrass from GenBank: AF349754].

Field and laboratory/greenhouse experiments were conducted to evaluate the effectiveness of different alternative herbicide treatments in terms of immediate “in situ” control of the standing RG biotype of rigid ryegrass and of longer-term effects on soil seed bank size.

Three field trials were carried out during two consecutive seasons, 2013–2014 and 2014–2015. Single-herbicide or herbicide mixtures with glyphosate were applied either at early post-emergence (3- to 8-leaf stage, trial 1), at tillering (trial 2) or at full heading, immediately before flowering (trial 3) (Table 1). Three completely randomized blocks were established each study year within the cultivation row. Blocks were located within the cultivation row. The experimental unit was a plot of 2 m × 15 m. The herbicides were applied using a Pulverex backpack sprayer with a T coupling for the wand equipped with four flat fan nozzles, at a spraying pressure of 200 kPa, and calibrated to deliver a volume of 200 L ha^-1. A strip of 1 m was established between plots within a block to prevent treatment overlap. Direct treatment effects on target plants were evaluated 60 days after application (DAT) in terms of percentage reduction of rigid ryegrass soil cover with respect to untreated plots, and treatment effectiveness was finally expressed as the complementary percentage.

Apart from immediate effects on the abundance of the standing biotype, selected treatments were also evaluated according to their ability to reduce the soil seed bank on which future infestations would be dependent. To quantify treatment effects on seed bank size, we first estimated for surviving plants their mean seed set, i.e., the proportion of flowers produced by an individual plant transformed into single-seeded fruits (referred to as seeds throughout the paper). Rigid ryegrass plants of the RG biotype surviving the different herbicide treatments in the field trials were let to flower and fruiting. At maturity, inflorescences were bulk collected for each treatment within each block and stored in the laboratory for 3 months. As long as after-ripened rigid ryegrass seeds readily germinate under favorable laboratory conditions (Steadman et al., 2003), the seed set was measured as the germination fraction of floret units sampled from mature inflorescences. In each of the two study years, seed germination tests were carried out using 50 randomly chosen florets from each bulk collection. Floret samples were placed in plastic Petri dishes sealed with parafilm inside a growth chamber under the environmental conditions described above. Percentage of germination was recorded after 14 days. Seed set of surviving plants was established for the different treatments relative to seed set of untreated plants, and the resulting fractions were multiplied by the corresponding mean values of relative soil cover at 60 DAT to obtain relative measurements of the contribution of the standing population to the soil seed bank following exposure to the different herbicide treatments. The same as above, effectiveness in reducing the seed bank was finally expressed as the complementary percentages.

The frequency of the glyphosate-resistant phenotype among the progeny of plants of the RG biotype surviving the different “in situ” treatments was also estimated as follows. Seedlings resulting from germination tests were individually transferred to pots and placed in the greenhouse. At the 3- to 4-leaf stage, seedlings were treated with glyphosate at the labeled field rate (720 g ae ha^-1) using the laboratory spray chamber described previously. Due to space limitations, the seedlings were divided into three lots per maternal treatment, and seedlings from each lot were simultaneously treated in the chamber. The number of plants surviving glyphosate treatment, i.e., exhibiting a resistant phenotype, was counted 21 days after treatments.

Whole plant dose-response and EPSPS enzyme activity data were subjected to non-linear regression analysis using a four-parameter log-logistic equation (Eq. 1) to determine the glyphosate dose causing 50% reduction in growth (GR₅₀), 50% mortality (LD₅₀), and inhibition of EPSPS activity by 50% (I₅₀).

where Y is above-ground weight or survival expressed as a percentage of the non-treated control, c and d are the parameters corresponding to the lower and upper asymptotes, b is the slope of the curve at the inflection point, g the herbicide rate at the inflection point (i.e., GR₅₀, LD₅₀, I₅₀), and x (independent variable) is the herbicide rate.

Regression analyses were conducted using the drc package (Ritz et al., 2015) for the statistical environment R (R 3.2.4; R Core Team, 2015). Resistance indices were computed as RG-to-SG GR₅₀, LD₅₀, or I₅₀ ratios. To test for a common GR₅₀, LD₅₀, or I₅₀ for RG and SG biotypes, i.e., Resistance Index equal to 1, a lack-of-fit test was used to compare the model consisting of curves with biotype-specific g values with a reduced model with common g (Ritz et al., 2015).

Analysis of variance (ANOVA) was conducted using Statistix 9.0 (Analytical Software, USA) to test for differences between RG and SG biotypes in shikimate accumulation in leaves, either at 1000 μM glyphosate in the leaf segment or at 96 HAT in the whole plant analysis; proportion of the different glyphosate metabolites; proportion of applied ¹⁴C-glyphosate taken up by leaves, and proportions of absorbed ¹⁴C-glyphosate remaining in the treated leaf, translocated to roots and to the rest of the plant at 96 HAT; and basal enzyme activity. Percentage data were previously transformed (arcsine of the square root) to meet model assumptions of normality of error distribution and homogeneity of variance. Model assumptions were graphically inspected. When needed, differences between means were separated using the Tukey HSD test.

ANOVA was conducted in R accounting for the experimental design to test for the effects of herbicide treatment and year, and their interaction, on effectiveness in reducing soil cover of the R biotype in the field trials, and on seed set of plants surviving the treatments to fruiting. As above, response variables were previously transformed and model assumptions of homogeneity of variance and normality of errors were graphically inspected. Generalized linear mixed models (GLMM) with binomial error distribution and logit link function were used to test for treatment and year effects on the survival rate of the progeny from glyphosate in laboratory/greenhouse experiments. GLMMs allow for a proper treatment of hierarchical designs and, in the case of proportions, also they correct for varying initial sample sizes. GLMMs were conducted in R using the package lme4 (Bates et al., 2015). Model assumptions were graphically checked. For each maternal growth stage, we compared survival rates resulting from each maternal treatment to survival rates of untreated plants (the reference class), judging the effect as significant when the parameter of a specific treatment in the linear component of the model was significantly different from 0. Non-significant terms, starting with the interaction, were dropped one at a time and, in every step, the reduced model was compared with the previous model using likelihood ratio tests. We continued this process up to when no additional terms could be dropped.

Dose-response assays clearly established differential susceptibility to glyphosate between the SG and the putative resistant RG biotypes of rigid ryegrass, both in terms of survival and aboveground dry biomass (Figure 1 and Table 2). As expected, the SG biotype was highly susceptible to glyphosate and at the labeled field rate in Spain (720 g ae ha^-1) it showed a very low survival and biomass (Figure 1). At this rate, however, 97% of the plants of the RG biotype survived the treatment, and aboveground dry biomass was only reduced to 48% of untreated plant biomass (Figure 1). The test for lack of fit, comparing a reduced model with common g parameter for SG and RG curves to a model with biotype-specific g values, was significant (p < 0.01) for both survival (LD₅₀) and dry biomass (GR₅₀), indicating that both rates do differ between biotypes and thus confirming resistance to glyphosate of the studied RG biotype from southern Spain (Table 2).

Shikimic acid accumulation patterns in glyphosate-exposed leaves of rigid ryegrass plants of RG and SG biotypes are shown in Figure 2. In agreement with contrasting responses of RG and SG biotypes to glyphosate dose, leaves of SG plants accumulated much larger amounts of shikimate compared to RG plants, as demonstrated by the analyses at the whole plant and leaf segment levels. The whole plant analysis indicated that these differences in shikimate accumulation were already apparent 48 h after treatment and after 96 h, a highly significant (p < 0.001, DF = 1, n = 10) 2.5-fold greater shikimate concentration was found in leaves of the SG biotype (Figure 2A). The leaf segment analysis showed that increased shikimate levels in glyphosate-exposed SG biotype plant leaf segments were evident from very low glyphosate concentrations and at 1000 μM, the highest concentration tested, the difference was 5.2-fold greater in SG versus RG leaf segments (p < 0.001, DF = 1, n = 10) (Figure 2B).

The maximum ¹⁴C-glyphosate uptake for both biotypes was reached at 96 HAT, RG biotype rigid ryegrass plant leaves took up a significantly lower proportion (p < 0.001, DF = 1, n = 10) of applied ¹⁴C-glyphosate compared to the SG biotype, 58 and 89%, respectively (Figure 3). Differential patterns of glyphosate translocation within the plant were also evident between RG and SG biotypes. From 48 HAT onward, a higher proportion of the glyphosate taken up by the treated leaf remained in its tissues in RG plants compared to SG plants, and at 96 HAT, these proportions were significantly different (p < 0.001, DF = 1, n = 10), 61.6 and 37.9% for RG and SG plants, respectively (Figure 3). Accordingly, compared to the RG biotype, SG biotype plants showed a significantly higher proportion (p < 0.001, DF = 1, n = 10) of absorbed glyphosate in both the roots and rest of plant at 96 HAT (Figure 3). Overall, uptake and translocation assays indicated that glyphosate translocation was 2.4-fold greater in SG than in RG rigid ryegrass plants. Differences between rigid ryegrass biotypes in ¹⁴C-glyphosate translocation were also evidenced through phosphor imaging (Figure 4).

A mean proportion of 87.4% of applied glyphosate remained un-metabolized at 96 HAT in rigid ryegrass plants with no significant differences (p = 0.8714, DF = 1, n = 10) in RG versus SG biotypes (Table 3). However, the remaining fraction was differentially metabolized to AMPA and glyoxylate in plants of RG and SG biotypes. Whereas AMPA was the main metabolism product of the RG biotype, it was glyoxylate for the SG biotype (Table 3).

The specific activity of EPSPS in the absence of glyphosate was similar in RG and SG biotypes (p = 0.824, DF = 1, n = 6), 0.0839 ± 0.0053 and 0.0781 ± 0.0093 μmol μg^-1 TSP min^-1, respectively. The concentration of glyphosate required to inhibit EPSPS activity by 50% (I₅₀) was 8.23 and 6.94 μM in RG and SG biotypes, respectively, with no significant difference (p = 0.603) (Table 2).

The RG biotype of rigid ryegrass did not reveal any mutation at position Pro-106 in the EPSP synthase gene (Figure 5).

The abundance of the RG biotype of rigid ryegrass in the original olive grove was potentially large, as denoted by the high soil cover measured in untreated plots, with mean values of 80 and 85% in years 1 and 2, respectively (Figure 6). In situ responses of the RG biotype to the different chemical treatments tested indicated that herbicide applications at the later growth stage tended to be less effective in terms of immediate effects on population size than earlier applications, with the exception of glufosinate (Table 4). Glyphosate-only applications at both early post-emergence and full heading led to a significant lower control effectiveness than alternative treatments within each growth stage (Figure 7), with the exception of full heading during the first study year, in which glyphosate effects did not differ from those of clethodim, quizalofop, and diquat (Table 4). These results confirm farmer’s claims regarding their inability to adequately control the local biotype of rigid ryegrass using glyphosate-only treatments. Removal of at least 85% of the RG biotype, a minimum threshold for satisfactory control, resulted from three treatments at early post-emergence, cycloxydim, flazasulfuron and flazasulfuron + glyphosate (Figure 8), and from the three treatments tested at tillering. At full heading, however, only glufosinate showed this effectiveness level in the second study year (Table 4).

As expected, high mean germination percentages, 78–83%, were recorded from floret units of mature inflorescences of untreated plants of the RG biotype of rigid ryegrass (Table 5), this supporting germination percentage of floret units from mature inflorescences, following after-ripening, as being an adequate proxy for the seed set. A significant interaction (p < 0.01) between treatment and year was found for each growth stage, except for tiller stage, so one-way ANOVAs were conducted for each study year to test for treatment effects. Compared to untreated plants, a significantly lower mean seed set was found in RG plants surviving in situ the different herbicide treatments, including glyphosate-only applications, although the seed set was clearly dependent on herbicide identity (Table 5). The herbicides cycloxydim, which, however, is currently not authorized for use in olive groves, and flazasulfuron, either alone or in a mixture with glyphosate, prevented development of mature seeds in surviving treated plants irrespective of growth stage at treatment. Interestingly, clethodim and quizalofop-p-ethyl only prevented seed production in treatments at full heading, whereas at earlier growth stages, these herbicides, or their mixtures with glyphosate, did not fully prevent seed maturation (Table 5). Glyphosate-only applications tended to be among the treatments penalizing fewer seed sets of surviving plants, although seed set effects of quizalofop at early post-emergence, and diquat at full heading, did not differ significantly from glyphosate effects at the respective growth stages (Table 5). Evaluation of treatment effectiveness in terms of ability to reduce the soil seed bank, rather than on the basis of immediate effects on current population size, led to some contrasting conclusions (Table 4). With the exception of glyphosate-only treatments, and diquat at full heading, the different treatments tested appeared to be highly effective in reducing the soil seed bank (>90%). In addition, the results suggest that, with the referred exceptions of glyphosate and diquat, high effectiveness in seed bank reduction was generally achieved also at the most advanced growth stage (Table 4).

Treatment of progeny seedlings with glyphosate at the labeled field rate (720 g ae ha^-1) using the laboratory spray chamber was clearly useful to separate glyphosate-resistant and susceptible phenotypes (Figure 1). The herbicide treatment applied “in situ” to the RG biotype showed a significant effect on the frequency of the resistant phenotype among the progeny of surviving plants (Figure 9). The frequency of the resistant phenotype within the RG biotype, as evaluated by the survival response to glyphosate of the progeny of untreated plants, was 95–96% (Figure 9). Clethodim (66.7%) and quizalofop-p-ethyl (84.6%) applied at early post-emergence in the second study year, clethodim + glyphosate (50.0%) and quizalofop-p-ethyl+glyphosate (72.7%) at tillering in the second study year, and diquat (mean 87.9%) and glyphosate (mean 86.3%) at full heading in both study years significantly lowered the frequency of the resistant phenotype in the progeny of surviving plants (Figure 9). While the fraction of glyphosate-resistant seeds produced by the plants surviving glyphosate treatment, and the untreated plants did not differ at early post-emergence, as expected, this fraction was, significantly lower for plants treated at the most advanced growth stage, as previously stated.