Calcareous sodic soil samples collected from three districts of Tamil Nadu, India viz., Coimbatore (Altitude of 411 m above mean sea level, 11.0°N latitude and 76.9°E longitude), Ramnad (Altitude of 2 m, 9.3°N latitude and 78.8°E longitude), and Trichy (Altitude of 85 m, 10.7°N latitude and 78.7°E longitude), showed the free CaCO₃ concentration of 7.2, 7.6, and 7.8%, respectively and were stored at 4°C. In order to isolate CDB, 100 g of each soil was enriched with 1% CaCO₃ individually and incubated for 2 weeks. Along with enriched soil samples, native, or initial soil samples were also used for the isolation of CDB.

The CDB were isolated from both enriched and initial soil samples by serial dilution and plating technique using DB agar medium consisting of g.l⁻¹ Glucose 5; Yeast extract 1; Peptone 1; K₂HPO₄ 0.4; MgSO₄ 0.01; NaCl 5; (NH₄)₂SO₄ 0.05; CaCO₃ 5 and Agar 20 (Cacchio et al., 2004). The CD positive isolates picked based on clear zone formation around the colony were further confirmed by point inoculation onto the same medium. The solubilization index (SI) of the individual isolates was determined by measuring the ratio of the clear zone and colony size on DB agar plate by using the following formula:

(Mihalacheet al., 2015)

Secondary screening of positive isolates was carried out by calculating titratable acidity (TA) from 24 h old cultures grown in DB liquid medium. One milliliter of the cell free culture supernatant was titrated against 10 mM NaOH in the presence of phenolphthalein indicator until the appearance of pink color (Whitelaw et al., 1999).

Total genomic DNA of the selected isolates were extracted and purified using the method described by Clark (2013). CDB isolates were identified by amplification of 16S rRNA gene using 27F (5′ AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′ GGTTACCTTGTTACGACTT 3′) primers with the PCR conditions of initial denaturation at 95°C for 10 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 1 min, followed by a final extension at 72°C for 15 min in a thermo cycler (BioRad, USA). Then, the PCR products were cloned into the pGEMT vector and transformed into chemically competent E. coli DH5α cells (Sambrook et al., 1989). Positive clones were selected based on blue-white screening from Amp-X-gal-IPTG plates and further confirmed by colony lysis PCR using M13 forward (5′ GTAAAACGACGGCCAGT 3′) and reverse primers (5′ AACAGCTATGACCATG 3′). The positive clones were sequenced [Bioserve Biotechnologies (I) Pvt. Ltd., Hyderabad, India]. 16S rRNA gene sequence obtained for each clone was aligned and compared with available sequences of bacterial lineage using Ez Taxon-e (http://eztaxon-e.ezbiocloud.net/). A phylogenetic tree was constructed using MEGA 6 program (Tamura et al., 2013) and their grouping sequence was based on confidence values obtained by bootstrap analysis of 1000 replicates.

One day old Brevibacterium sp. SOTI06 culture (0.1 ml) was taken into 96 well micro titre plate, covered and incubated at 30°C for 24 h. After incubation, the plates were washed thoroughly with sterile distilled water and air dried. One hundred and fifty microliters of 0.1% crystal violet was added to each well and incubated for 45 min. The excess stain was removed by sterile distilled water and air dried. Subsequently, 200 μl of 95% ethanol was added to each well and plates were incubated for 10–15 min. Contents of each well were mixed and 125 μl of the crystal violet/ethanol solution was transferred to a separate clear bottom well and optical density was measured at 600 nm using micro plate reader (Molecular Devices LLC, USA; Djordjevic et al., 2002).

Brevibacterium sp. SOTI06 was cultured in DB liquid medium supplemented with CaCO₃ (5 g.l⁻¹) and incubated at 30°C for 24 h at 120 rpm. The culture was centrifuged at 4000 g for 15 min and the pellet was used for estimation of EPS by suspending the pellet with 5 ml distilled water and 5 ml 0.1 N KOH. The contents were boiled at 100°C for 10 min. After cooling, the suspension was neutralized with 1M HCl and 1 ml of suspension, was mixed with 5 ml Anthrone reagent and the intensity of color was measured at 620 nm in UV-VIS spectrophotometer (Systronics, India, DuBois et al., 1956).

In order to quantify CD ability of Brevibacterium sp. SOTI06 grown in DB liquid medium, cell free culture supernatant obtained at periodical intervals were subjected to the analysis of calcium (Jackson, 2005), calcium carbonate (Piper, 1944), carbonates, bicarbonates (Richards, 1954), phosphatase (Tabatabai and Bremner, 1969), protein concentration (Bradford, 1976), pH, and TA.

Organic acid production was estimated from 24 h old culture by injecting 30 μl of 0.2 μm filtered cell free supernatant in HPLC with a UV detector set at 210 nm. The organic separation was carried out on Cosmosil packed column (Nacalai Tesque, Japan) with 10.8% Acetonitrile in 0.0035 M H₂SO₄ as mobile phase at a flow rate of 0.6 ml.min⁻¹ (Chen et al., 2006). The data integration and analysis was done using Autochrom software. HPLC grade organic acids kit (No.47264 from Sigma Aldrich, USA) was used as standards.

FT-IR spectrum of CaCO₃ in the spent medium by Brevibacterium sp. SOTI06 was recorded in JASCO FT-IR 6800 fitted with diamond enabled Attenuated Total Reflectance (ATR) sample holder and a DLaTgs detector and compared with CaCO₃. The wavelength range was from 400 to 4000 cm⁻¹. Spectral measurements were done in triplicates and 64 scans were recorded for all samples at a 4 cm⁻¹ resolution.

Siderophore production of Brevibacterium sp. SOTI06 was observed by point inoculation with fresh culture onto Chrome Azural S (CAS) agar plate and incubated for 48 h at 30°C (Schwyn and Neilands, 1987), which was further confirmed by broth assay. The assay was carried out by mixing the culture supernatant (0.5 ml) with 0.5 ml CAS reagent and the absorbance was measured at 630 nm against a reference consisting of un-inoculated liquid medium. Siderophore content was estimated using the formula:

(Payne, 1994)

Where, Ar is the absorbance of reference and As is the absorbance of sample.

The calcite dissolution behavior of Brevibacterium sp. SOTI06 was estimated over a period of 5 days by measuring the pH, TA, phosphatase, CaCO₃, Ca²⁺, CO32-, and HCO3- content in the medium. The results revealed that pH decreased gradually from 8.02 to 5.72 until 4th day and there after increased to 6.60 on 5th day. On contrary, TA and phosphatase activity showed an increasing trend from 0 to 4th day and decreased later. Production of TA started on 1st day (0.93 g.l⁻¹) and almost doubled on 2nd day (1.63 g.l⁻¹), further an increment in TA was noticed up to 4th day (1.95 g.l⁻¹) and suddenly dropped to 1.33 g.l⁻¹ at 5th day. But, the phosphatase activity was linearly increased from 1st day (19.7 U.ml⁻¹) onwards, reaching maximum up to 4th day (91.8 U.ml⁻¹) and reduced to 70.7 U.ml⁻¹on 5th day (Figure 5A). The protein concentration was also increased from 1st day (10.0 g.l⁻¹) to 4th day (34.4 g.l⁻¹) and declined on 5th day (26.7 g.l⁻¹).

The supplemented calcium carbonate content was slowly decreased from 5.0 to 4.07 g.l⁻¹ with simultaneous increase in calcium and bicarbonate concentrations. The release of Ca²⁺into the solution was higher than bicarbonate ions. A minimal amount of calcium (0.04 g.l⁻¹) and no bicarbonates were released on 0th day and thereafter, the release of calcium content was higher until 5th day (3.60 g.l⁻¹). However, the bicarbonate content was increased until 4th day reaching the maximum of 0.65 g.l⁻¹ and decreased later. Overall, Brevibacterium sp. SOTI06 was capable of dissolving 18.6% of calcite within 5 days of incubation (Figure 5B).

Supplementation of CaCO₃ to Brevibacterium sp. SOTI06 resulted in the production of organic acids such as gluconic acid, acetic acid, fumaric acid, and phytic acid. Among the secreted organic acids, gluconic acid was the predominant one (3.24 mg.ml⁻¹) followed by acetic acid (3.17 mg.ml⁻¹). A minimal amount of phytic acid (10 μg.ml⁻¹) and fumaric acid (7 μg.ml⁻¹) was also recorded in the medium enriched with CaCO₃ (Figure 6). Conversely, the medium without CaCO₃ resulted in lesser production of acetic acid (0.92 mg.ml⁻¹) and fumaric acid (0.25 μg.ml⁻¹) whereas; the release of predominant gluconic acid was not observed (data not given).

FT-IR spectra of calcite dissolution by Brevibacterium sp. SOTI06 was compared with uninoculated control (Figure 7) and the spectral data showed changes in vibration and alteration of structure with reduced intensity (55.36–41.27%) which confirmed the calcite dissolution by bacterium (1636 cm⁻¹). Further, the presence of additional two new peaks at wave number of 1222 and 1370 cm⁻¹ with strong OH groups was observed in treated sample (Table 1).

The development of yellow halo around the colonies in CAS plate was confirmed by broth assay showed that Brevibacterium sp. SOTI06 produced siderophore both in CaCO₃ amended as well as unamended liquid medium was evidenced by a change of color from blue to yellow (Figure 8). But, their production was higher in amended medium registering 91.6 per cent siderophore units than the control (88.6%).