Sequences of MYB proteins from E. grandis, P. trichocarpa, V. vinifera, and A. thaliana from a phenylpropanoid metabolism-related super clade were obtained from Soler et al. (2015). It includes members of S4 (with AtMYB6 and AtMYB8), S5, S6, S7, S15, SAtMYB5, SAtMYB82, WPS-I, WPS-II, and WPS-III. For P. trichocarpa, we updated the protein sequences from the last genome version (3.0). Two gene models from version 2.2 were not included in the analysis: POPTR_0019s05200 was absent in version 3.0, whereas the new amino acid sequence prediction of POPTR_0018s08500 (Potri.018G049000) lacked part of the R3 MYB domain.

Amino acid sequences were aligned using MAFFT with the FFT-NS-i algorithm (Katoh et al., 2002) and used to construct a Neighbor-joining phylogenetic tree using Mega5 (Tamura et al., 2011) with 1000 bootstrap replicates. Sequences were compared using the complete deletion method and the evolutionary distances were computed with the Jones–Taylor–Thornton substitution model using the rate variation among sites with a gamma distribution of 1, as done by Soler et al. (2015). A distant R2R3-MYB gene involved in the lignin biosynthesis, AtMYB52 (Cassan-Wang et al., 2013) was also used to root the phylogenetic reconstruction.

EgMYB88 coding sequence was obtained from Eucalyptus gunnii (Eg) xylem cDNA using the primers CACCCATATGGAGAAATCATCAGCTGCAA and GAGCTCTCCTGATCTCTCATCACA with the Phusion taq (Finnzymes). EgMYB88 sequence from E. gunnii (accession number KX470407) was highly similar to EgrMYB88 (Egr indicates E. grandis) sequence (Eucgr.F04423.1), with just one nucleotide change at the R3 MYB domain which do not modify the amino acid sequence. Amplicon was then inserted in the pENTR D-TOPO vector (Invitrogen) and subsequently transferred into several destination vectors using LR clonase II (Invitrogen) following manufacturer's instructions. Destination vectors were pGBD-GTW (kindly provide by Dr Laurent Deslandes, LIPM, INRA, France) for yeast auto activation assays, pFAST-G02 (Shimada et al., 2010) for overexpression in Arabidopsis, pJCV53 (obtained from the Gateway Vectors facility from Ghent University, Belgium) for overexpression in poplar, and pH35SGEAR (kindly provided by Dr Taku Demura, NAIST, Nara, Japan) for dominant repression in Arabidopsis and poplar. Coding sequences of EgMYB1 and EgMYB2 (Goicoechea et al., 2005; Legay et al., 2007) were cloned into the pDONR207 vector (Invitrogen) and were transferred into the pGBD-GTW vector also using the LR clonase II.

EgMYB88 cloned into the pFAST-G02, the pJCV53, or the pH35SGEAR vectors was inserted into Agrobacterium tumefaciens GV3101 (pMP90) using freeze and thaw method. Wild type Col-0 Arabidopsis plants were transformed using the floral dip method (Clough and Bent, 1998) with A. tumefaciens harboring EgMYB88 into the pFAST-G02 and the pH35SGEAR vectors. As controls, we used wild type plants and plants transformed with the respective empty vectors. Transformed seeds from pFAST-G02 vector were screened using a fluorescent stereomicroscope with GFP filters as described in Shimada et al. (2010), whereas seedlings transformed with the pH35SGEAR vector were screened using MS ½ media supplemented with hygromcycin (20 μg/ml). More than 10 transformed independent lines without any visible phenotype as compared to controls were obtained for each construct and screened by conventional RetroTranscriptase-quantitative Polymerase Chain Reaction (RT-qPCR) to assess the level of transgene expression. For detailed characterization of their phenotypes, three lines were selected for each construct based on high transgene expression levels (Figure S1). Plants were grown in a growth chamber in short day conditions (9 h light and 15 h dark) to promote secondary growth. Sampling was done in plants from at least 8 weeks old, when the inflorescence stems were fully developed and the first siliques were clearly observed. The base of the inflorescence stem was kept in ethanol 80% for histochemistry analysis. The rest of the inflorescence stem without leaves and siliques (except the first 5 cm, which were discarded because the proportion of xylem tissue was very low) was immediately frozen in liquid nitrogen. Five plants samples were pooled for each independent line. They were subsequently milled to powder using a ball-mill (MM400, Retsch) with liquid nitrogen to keep them protected from degradation, and kept at −80°C for lignin quantification. Similarly, hypocotyls were harvested, pooled, frozen in liquid nitrogen, milled to powder and kept at −80°C for Pyrolysis-Gas Chromatography/Mass Spectrometry (Py-GC/MS) phenolic profiling.

Hybrid Populus tremula x P. alba (INRA clone 717-1-B4) was maintained on MS-1B media (Duchefa) supplemented with 2% sucrose, 0.5 mg/L of IAA (indole-3-acetic acid, Duchefa), and 0.5 mg/L of IBA (indole-3-butyric acid, Sigma). Hybrid poplar was transformed with A. tumefaciens harboring EgMYB88 into the pJCV53 and the pH35SGEAR vectors following the protocol described by Gallardo et al. (1999). As controls we used both wild type plants and plants transformed with the empty vectors. Selection of transformants was performed using kanamycin (50 μg/ml) for the pJCV53 and hygromycin (20 μg/ml) for pH35GEAR transformed plantlets. Several transformed plantlets were obtained for each construct without any visible phenotype as compared to controls, and screened by conventional RT-qPCR to assess the level of transgene expression. For detailed characterization of their phenotypes, three lines were selected for each construct according to transgene expression levels (Figure S2); however, for plants overexpressing EgMYB88 into the pJCV53 vector we did not chose the lines with the highest transgene expression as they did not multiply well in vitro. Selected plants were then acclimated for 3 weeks in a growth chamber in long day conditions (16 h light and 8 h dark) and then transferred into a greenhouse for 2 months. Sampling was done taking a 5 cm portion of the base of the stem and kept it in ethanol 80% for histochemistry analysis. The subsequent 5 cm portion of the base of the stem, taken for transcriptomics, as well as the rest of the stem (except the first 12 internodes, discarded because the proportion of xylem was low), taken for biochemistry, were immediately debarked, frozen in liquid nitrogen, milled to powder and kept at −80 °C for transcriptomic and biochemical analyses.

Yeast cells, strain Y2HGold (Clontech), were transformed with the plasmid pGBD-GTW using the Yeast Transformation System 2 (Clontech) following manufacturer's instructions and plating them on a Synthetically Defined medium without Tryptophan (SD-Trp). Plasmid pGBD-GTW contains a gene which confers the ability to grow on media without Tryptophan. Transformed yeast cells were resuspended in NaCl 0.9% solution until OD₆₀₀ of 2 and then plated in different selective media. After 3 days incubation at 30°C, growing of yeast cells was visible.

Total RNA was extracted from Arabidopsis leaves using the protocol for “vegetative tissues” from Oñate-Sánchez and Vicente-Carbajosa (2008) and from poplar leaves and debarked stems using the protocol from Southerton et al. (1998). RNA was further digested using TurboDNase (Ambion) to remove residual traces of contaminating DNA. One Microgram of RNA was retrotranscribed into cDNA using the High Capacity RNA to cDNA kit (Applied Biosystems) and diluted 5 times before use as template in conventional or microfluidic RT-qPCR.

Conventional RT-qPCR was performed on cDNA from Arabidopsis and poplar leaves to assess the level of transgene expression in technical triplicates using ABI 7900HT real-time PCR system (Applied Biosystems) with the Power SYBR Green PCR Master Mix (Applied Biosystems). PCR conditions were 95 °C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. After amplification, a dissociation step was performed to confirm the presence of a simple amplicon. Transcript abundance was calculated using the 2^−ΔΔCt method, with the housekeeping gene actin2 (ACT2, Legay et al., 2010) for Arabidopsis and the housekeeping gene cell division cycle2 (CDC2, Legay et al., 2010) for poplar to normalize data. Control samples were used to standardize results.

Microfluidic RT-qPCR was performed on cDNA from poplar debarked stems to assess the levels of phenylpropanoid metabolism genes using the Biomark® 96.96 Dynamic Array platform (Fluidigm) as described in Cassan-Wang et al. (2012). After amplification, a dissociation step was performed to confirm the presence of a simple amplicon. Transcript abundance was calculated using the 2^−ΔΔCt method, with the geometric mean of five validated housekeeping genes to normalize the results [Ubiquitin (UBQ), CDC2 (Legay et al., 2010), HK1, HK3, and HK11 (Sixto et al., 2016)]. Control samples were used to standardize the results. Finally, data was used in MeV (Saeed et al., 2003) to generate a heatmap.

Genes analyzed by microfluidic RT-qPCR were selected according to their importance in the phenylpropanoid metabolism or in cambium activity and differentiation, based on literature search (Ranocha et al., 2002; Shi et al., 2010; Berthet et al., 2011; Sun et al., 2011; Huang et al., 2012; Vanholme et al., 2013; Zhu et al., 2013; Liu et al., 2014a,b; Chedgy et al., 2015; Etchells et al., 2015; Yoshida et al., 2015). Primer sequences were obtained from literature whenever possible or designed either using Quantprime (Arvidsson et al., 2008) or Primer3 (Rozen and Skaletsky, 2000). Primer sequences for RT-qPCR are detailed in Table S1.

Arabidopsis and poplar stems were cut into 90 μm-thick sections using a vibratome (VT 100S, Leica). Due to the strong lignification of secondary xylem of poplar stems, vibratome was equipped with a Sapphire blade (Delaware Diamond Knives). Lignified secondary cell walls were stained with phloroglucinol-HCl reagent (VWR) and observed immediately under a bright-field inverted microscope (DM IRBE, Leica) equipped with a CDD color camera (DFC300 FX, Leica).

Milled samples from Arabidopsis and poplar stems were lyophilized and then subjected to exhaustive extraction with water, then ethanol, ethanol/toluene (50/50) and acetone in a Soxhlet apparatus. Recovered extractive-free samples were dried at 60°C overnight. Lignin content was evaluated in Arabidopsis using the acetyl bromide lignin method on 10 mg samples as described by Soler et al. (2016). Klason procedure was performed as previously described (Méchin et al., 2014) to quantify the acid-insoluble lignin on 50 mg of poplar samples.

The poplar lignin structure was analyzed using the thioacidolysis method on 10 mg of extractive-free sample as described by Méchin et al. (2014). Briefly, we used 1 ml of thioacidolysis reagent per mg of sample (for 100 ml of solution: 2.5 ml of boron trifluoride, 10 ml of ethanethiol and 0.2 ml of tetracosane 1.25 mg/ml, up to 100 ml dioxane). An aliquot of this solution (5 μl) was trimethylsilylated with 100 μl of N,O-bis(trimethylsilyl)trifluoroacetamide and 10 μl of pyridine for 30 min at 60°C. The trimethylsilylated samples were injected in a Gas Chromatography/Mass Spectrometry (GC-MS) (TSQ Quantu, Thermo Scientific) fitted with an autosampler, a splitless injector (280°C), and a iontrap mass spectrometer operating in the electronic impact mode with a source at 220°C, an interface at 280°C, and a 50–650 m/z scanning range. The column was a ZB5-MSi (Phénomenex) operated in the temperature program mode (from 45 to 180°C at +30°C/min, then 180 to 260°C at +3°C/min) with helium carrier gas at 1.5 ml/min flow rate.

Pyrolysis–Gas Chromatography/Mass Spectrometry (Py-GC/MS) analysis were performed with 80 μg of lyophilized powder per injection using non-extracted Arabidopsis hypocotyls. Powder was applied to a pyrolyzer equipped with an auto sampler (PY-2020iD and AS-1020E, Frontier Lab) connected to a GC/MS (7890A/5975C, Agilent). Pyrolysate separation and analysis, including peak detection, integration, normalization, and identification was done according to Gerber et al. (2012).

A total of 30 mg of lyophilized powder from poplar stems was extracted with 1 mL methanol 70% blended for 1 min using an Ultra-thurrax and then centrifuged at 10,000 g for 10 min. The supernatant was transferred to a new tube and one additional mL was added to the pellet, vortexed and let for 2 h at room temperature. The mixture was centrifuged again at 10,000 g for 10 min and the recovered supernatant was mixed with the first one. The 2 mL solution was evaporated in a speed-vacuum until dryness. Then, dried pellet was dissolved in 500 μL methanol 70% and passed through 0.22 μm filter.

Extracts (1 μL) were analyzed on Ultra-High Performance Liquid Chromatography (U-HPLC) system (Shimadzu) equipped with a photoDiode Array Detector (DAD) and a mass spectrometer. Sample was separated on a C18 kinetex (100 × 2.1 mm) column (Phenomenex). The mobile phase consisted in 0.1% formic acid in ultra-pure water (solvent A) and 0.1% formic acid in methanol (solvent B).

The molecules were eluted through a gradient elution from 1 to 99% B for 13 min with a flow rate of 400 μL/min and then 3 min in 99% B. The column was then re-equilibrated to 1% B prior to the next run. Mass spectrometry analysis was carried out in ESI negative mode. Quantification was performed by measuring the area under each peak at 280, 320, or 350 nm, depending on the lambda max of each molecule. Total metabolic signal was performed at 280 nm. Due to co-eluting signal at 280 nm, catechin quantification was realized by measuring the area under peak at m/z 289, corresponding to the [M-H]⁻ of the molecule. Experimental exact masses and MS fragments were compared to metabolomics data banks (Respect: http://spectra.psc.riken.jp/; Mass Bank: http://massbank.jp/, DNP: http://dnp.chemnetbase.com/) and data available in the literature in order to identify the nature of the metabolites.

Based on the phylogeny of the whole R2R3-MYB family in E. grandis (Soler et al., 2015), we selected the genes from the WPS-I and from closely related subgroups (S4, S5, S6, S7, SAtMYB5, SAtMYB82, WPS-II, and III) that constitute a phenylpropanoid metabolism-related super-clade. We reconstructed a phylogenetic sub-tree using sequences of E. grandis, A. thaliana, P. trichocarpa, and V. vinifera (Figure 1). WPS-I is supported by a high bootstrap value and is clearly separated from the other subgroups. It contains six genes from E. grandis, four from poplar, three from grapevine, but none from Arabidopsis.

No segmental, whole genome or tandem duplications were previously detected for any of the WPS-I genes in the E. grandis genome (Soler et al., 2015). However, giving the extremely high sequence conservation (98% similarity at the protein level) between EgrMYB22 and EgrMYB23, the corresponding genes likely derived from a relatively recent duplication event further supported by their close location on the same chromosome (Figure S3, Table S2). All the other members of the WPS-I subgroup are located on different chromosomes. The EgrMYB88 protein sequence is the most divergent from the other Eucalyptus WPS-I members (Table S2). It has two putative orthologs in P. trichocarpa, PrtMYB11 and PtrMYB171 (Figure 1, Table S2).

The six E. grandis and the four P. trichocarpa proteins exhibit high sequence homology in the R2R3-MYB domain, and also a conserved motif in the C-terminal region (Figure 2). This motif specific of the subgroup suggests similar function of the WPS-I genes. Moreover, as found for many other R2R3-MYB genes, a predicted motif for interaction with basic Helix-Loop-Helix (bHLH) proteins was also detected [(DE)Lx₂(RK)x₃Lx₆Lx₃R; Figure 2] (Zimmermann et al., 2004), which indicates that the function of these genes may be modulated by protein-protein interactions.

Because WPS-I closely related subgroups such as S6 and S7 involved in flavonoids biosynthesis were shown to be post-transcriptionally repressed by microRNAs, (mostly miR828 and/or miR858; Xia et al., 2012), we examined if the genes of WPS-I could also be targets of these microRNAs. By performing an in silico search, we found that the miRNA828 recognition sequence located at the end of the R2R3-MYB domain was highly conserved (Figure 3) in all the WPS-I genes from Eucalyptus and poplar with the exception of EgrMYB40. No cleavage site for miR858 was found in any of these genes (data not shown). These results are in agreement with a Eucalyptus degradome analysis showing that EgrMYB22, 23, 62, 67, and 88, but no EgrMYB40, were cleaved by miR828 (Carocha and Paiva, personal communication).

We then analyzed the transcript abundance of the genes from WPS-I in different Eucalyptus organs and tissues previously described in Soler et al. (2015). All of them showed the highest expression in the cambial region although some were also expressed in other tissues/organs (Figure 4). EgrMYB22, for instance was also highly expressed in leaves. EgrMYB88 was preferentially expressed in the vascular tissues (xylem and phloem) and exhibited the highest expression in the cambial region. The expression of its orthologs in P. tremula was obtained from Popgenie database (Sjödin et al., 2009) based on the RNAseq survey performed by Sundell et al. (2015). Similarly to EgMYB88, PtMYB11, and PtMYB171 were highly expressed in wood, but exhibited distinct expression profiles in other non-woody tissues (Figure S4). Because of the importance of the vascular cambium and differentiating xylem in the secondary growth characteristic of woody plants, we decided to investigate the function of EgrMYB88 by cloning its coding sequence from E. gunnii growing in Southwest France (EgMYB88). Nucleotide coding sequence is nearly identical between EgrMYB88 and EgMYB88, with just a base change at the R3 MYB domain that do not modify the amino acid sequence.

To determine if EgMYB88 is a transcriptional activator, we fused it to the Gal4 binding domain and investigated its capacity to activate the transcription of four reporter genes in yeast (Figure 5A). EgMYB88 was able to activate the reporter gene HIS3 and MEL1, as revealed by the ability of the yeast transformed with EgMYB88 to grow on selective media lacking Histidine and to metabolize X-α-Gal (5-bromo-4-chloro-3-indolyl alpha-D-galactopyranoside) producing blue colonies (Figure 5B). EgMYB88 was, however, unable to induce the reporter gene ADE2 and AUR1C, since the yeast transformed with EgMYB88 did not grow on media lacking both Adenine and Histidine, or containing the antibiotic Aureobasidin A in addition to X-α-Gal. Thus, EgMYB88 behaves as an activator in yeast, but its activity seems weaker than that of EgMYB2, a known transcriptional activator (Goicoechea et al., 2005), which was able to activate the four reporter genes (Figure 5B). In contrast, EgMYB1, a known transcriptional repressor (Legay et al., 2007; Soler et al., 2016), as well as the effector empty vector, were unable to activate any of the reporter genes.

As a first step to functionally characterize EgMYB88 in planta, we used the 35S Cauliflower Mosaic Virus promoter promoter (Pro35S) to overexpress in Arabidopsis either its native form (Pro35S:EgMYB88) or a dominant repression form (Pro35S:EgMYB88-EAR). The fusion with the EAR motif was previously shown to efficiently convert transcriptional activators into strong repressors (Hiratsu et al., 2003). Several independent transgenic plants were obtained for each of the two constructs, which were phenotypically similar to the controls (wild-type plants and lines containing empty vectors) after visual inspection. We selected three lines for each construct (Figure S5) in order to further characterize their phenotypes by performing histochemical and biochemical analyses. Sections at the basis of the inflorescence stems were stained in red with phloroglucinol-HCl, a common stain for lignin. No differences in the staining intensity nor in the xylem structure were observed in the Pro35S:EgMYB88 and/or Pro35S:EgMYB88-EAR lines compared to controls (Figure 6). Lignin contents assessed using the acetyl bromide method on extractive-free cell walls of Arabidopsis inflorescence stems were similar in Pro35S:EgMYB88, Pro35S:EgMYB88-EAR lines and controls (Table 1), in agreement with the histological observations. In order to have a wider overview of cell wall composition, we performed Py-GC/MS analysis of non-extracted Arabidopsis hypocotyls. The comparison between the transgenic lines and the controls did not reveal any differences (Table S3).

Poplar plants were transformed with the same kind of constructs, i.e., Pro35S:EgMYB88 and Pro35S:EgMYB88-EAR. Transgenic lines generated in vitro did not show any visible differences as compared to control lines. Three independent lines per construct (Figure S6) were acclimated and transferred into the greenhouse for a deeper characterization by histochemical and biochemical analyses. The Pro35S:EgMYB88 and Pro35S:EgMYB88-EAR plants were grown in two separate batches together with their appropriate controls. None of the lines showed differences in their overall xylem structure, including cell wall thickness (observed in mature xylem cells as well as in differentiating xylem close to the vascular cambium), vessel frequency and size (Figure 7). The intensity of the phloroglucinol-HCl staining of Pro35S:EgMYB88 xylem was similar to that of their controls, whereas a weaker red color was observed in the xylem of Pro35S:EgMYB88-EAR lines, suggesting a reduction of the lignin content (Figure 7).

These histochemical observations were confirmed by Klason lignin quantification (Table 2). The insoluble lignin content of Pro35S:EgMYB88 poplar plants was unchanged as compared to their corresponding controls (Table 2) while the Pro35S:EgMYB88-EAR poplar plants exhibited a small but significant reduction (6%) of the Klason lignin content (Table 3). Lignin structure was then analyzed by thioacidolysis, which specifically targets the lignin units (S and G) involved only in labile β-O-4 linkages (Méchin et al., 2014). When normalized relative to the Klason lignin content, the thioacidolysis yield was not significantly different between the Pro35S:EgMYB88 lines and their controls, meaning that the total amount of G and S lignin units involved only in β-O-4 linkages was unaffected (Table 2). However, Pro35S:EgMYB88 plants showed a significant different proportion of lignin units, with an increase in S units and a decrease in G units, resulting in a higher S/G ratio (13% higher than controls, Table 2). The thioacidolysis yield was not affected in the Pro35S:EgMYB88-EAR poplar xylem, but the proportion of S and G units were slightly affected resulting in a tendency of lower S/G ratio, although not statistically significant (Table 3).

We also analyzed the effects of EgMYB88 and EgMYB88-EAR on the profiles of soluble secondary metabolites in debarked stems of transgenic poplar lines. The Liquid Chromatography with photoDiode Array Detection–Mass Spectrometry (LC-DAD-MS) analysis of the water-methanol extracts revealed a complex composition of molecules absorbing at 280 nm. Among them, the 21 main different peaks were quantified, of which 14 could be attributed to a compound name or family (Figure S7).

The total content of phenolic secondary metabolites was increased by 12% in Pro35S:EgMYB88 plants compared to controls. This increase was mostly due to salicinoid phenolic glycosides and to the flavonoid catechin, although some unidentified compounds were also increased (Table 4, Table S4). The three salicinoid phenolic glycosides detected were tremulacin, salicortin, and salireposide, which increased by 87, 70, and 56%, respectively as compared to controls. The level of the flavonoid catechin was also strongly increased (about 2.6 fold compared to controls). In the Pro35S:EgMYB88-EAR poplar plants, the total content of secondary metabolites was not significantly different from controls, neither were the contents of phenolic glycosides (Table 5, Table S5). However, the contents of catechin and oligolignols were significantly reduced by about 40% and 18%, respectively. The oligolignols G(8-O-4)SP(8-5)G [coniferyl alcohol (8-O-4) sinapyl p-hydroxybenzoate (8-5) coniferyl alcohol], G(8-O-4)SP(8-5)G′ [coniferyl alcohol (8-O-4) sinapyl p-hydroxybenzoate (8-5) coniferaldehyde] and a putative oligolignol not yet identified, were reduced by 35, 36, and 24%, respectively.

To investigate the main modifications in gene expression induced by the overexpression of EgMYB88 and EgMYB88-EAR in transgenic poplars, we analyzed the transcript levels of key genes involved in the phenylpropanoid metabolism and in cambium activity and patterning by microfluidic qPCR. In general, as can be seen in the overall picture of Figure 8, Pro35S:EgMYB88 and Pro35S:EgMYB88-EAR showed opposed tendencies, meaning that genes induced in one transgenic type tend to be repressed in the other, and vice versa. However, whereas transcript abundance levels were clearly altered in Pro35S:EgMYB88, they were only moderately altered in Pro35S:EgMYB88-EAR plants (Tables 6, 7).

Most of the genes involved in the biosynthesis of phenylpropanoids, including those of lignin, flavonoids, and phenolic glycosides branches, were induced either significantly or at least showed a tendency to be up-regulated in Pro35S:EgMYB88 poplar plants (Figure 8, Table 6). In contrast, they were repressed in Pro35S:EgMYB88-EAR poplars although not significantly because of the high variation found among plants (Figure 8, Table 7). Interestingly, genes involved in the biosynthesis of flavonoids and salicinoid phenolic glycosides were the most induced ones in Pro35S:EgMYB88 poplars (Figure 8, Table 6). The gene encoding benzoyl-CoA:benzyl alcohol O-benzoyltransferase (BEBT), an enzyme involved in the biosynthesis of salicortin and other salicinoid phenolic glycosides (Babst et al., 2010; Chedgy et al., 2015) was the most induced (2.4 fold induction), in agreement with the strong accumulation of phenolic glycosides found in these lines. The genes encoding chalcone synthase (CHS), dihydroflavonol-4-reductase (DFR), and anthocyanidin reductase (ANR), involved in the biosynthesis of flavonoids, were also strongly induced (Figure 8, Table 6), in agreement with the increase in catechin levels. The genes from the general phenylpropanoid pathway (phenylalanine ammonia-lyase, PAL and 4-coumarate:CoA ligase, 4CL) were moderately induced in Pro35S:EgMYB88 poplars as was ferulate 5-hydroxylase (CAld5H), involved in the biosynthesis of sinapyl alcohol which generate S lignin units, in agreement with the increase in the S/G ratio.

Most of the genes regulating the cambial activity tested in this study were repressed or showed a tendency to be repressed in Pro35S:EgMYB88 poplars (Table 6), whereas they seemed to be induced in Pro35S:EgMYB88-EAR lines (Table 7). HB2/PopREV and HB4, respectively orthologs of Arabidopsis REVOLUTA and PHABULOSA/PHAVOLUTA (Zhu et al., 2013), and PIN1b, ortholog of Arabidopsis PIN1 (Liu et al., 2014b), were significantly repressed in EgMYB88 overexpressing poplars (22, 22, and 23% of repression, respectively). These genes are related to cambium activity and to the differentiation of vascular tissues in Arabidopsis (Gälweiler et al., 1998; Zhong and Ye, 1999) and poplar (Robischon et al., 2011).

Finally, we analyzed the transcript levels of the two poplar orthologs of EgMYB88: MYB11 and MYB171. Unexpectedly, the two genes exhibited opposite behaviors depending on the transgenic lines type. For example, in Pro35S:EgMYB88 plants, MYB171 was clearly repressed (35% repression), whereas MYB11 was not significantly affected (Table 6). In contrast, MYB171 was not significantly altered in Pro35S:EgMYB88-EAR plants whereas MYB11 was clearly induced (40% induction) (Table 7).

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.