Maize (Zea mays L.) B73 plants were grown in the field or a greenhouse and hand-pollinated. Endosperms were dissected from kernels harvested at different stages of development and processed for molecular and immunohistochemical analyses as described in previous publications (Leiva-Neto et al., 2004; Sabelli et al., 2005, 2013; Dante et al., 2014).

A nucleotide sequence encoding CYCB2;2 was initially obtained by querying Pioneer Hi-Bred’s maize EST database. Additional searches were made in the Maize Genome Sequencing Project¹, MaizeGDB² (Lawrence et al., 2004), Phytozome v10³, Rice Genome Annotation Project v7⁴ (Kawahara et al., 2013), Gramene v42⁵ (Ware et al., 2002), and Pfam v27⁶ (Finn et al., 2014) databases and the Maize eFP Browser⁷ (Sekhon et al., 2011). Functional motifs were predicted with the Eukaryotic Linear Motif Resource⁸ (Dinkel et al., 2014). Subcellular localization was predicted using LocTree 3⁹ (Goldberg et al., 2012), Plant-mPLoc¹⁰ (Chou and Shen, 2010), and BaCelLo¹¹ software. Multiple sequence alignments were carried out with M-Coffee¹² (Di Tommaso et al., 2011) or MUSCLE (Edgar, 2004). An un-rooted Neighbor-Joining tree of a set of 35 plant B-type cyclin amino acid sequences, spanning the conserved Cyc_N and Cyc_C domains (Nugent et al., 1991), was constructed using MEGA6 software package (Tamura et al., 2013). Amino acid sequences were selected based on previous analyses (La et al., 2006; Guo et al., 2007; Hu et al., 2010; Jia et al., 2014) and novel database searches. Only one amino acid sequence per locus was selected in the case of multiple predicted transcripts. Several shorter amino acid sequences (GRMZM2G025200_P01, Loc_Os02g41720, AT1G34460, Sb07g003015, Potri.006G035200.2) were not included in the analysis. The evolutionary distances were computed using the Poisson correction method. All positions containing gaps and missing data were eliminated. There were a total of 235 positions in the final dataset.

Detailed procedures for purification of endosperm RNA and protein and their analyses by RT-PCR and immunoblotting, respectively, are given in previous publications (Sabelli et al., 2005, 2013; Dante et al., 2014). The following RT-PCR primers were used for CYCB2;2: CYCB2;2F (GAAAATGAGGCTAAGAGTTGTGTAAG) and CYCB2;2R (GAGCTCCAGCATGAAAAATGACGCT) and actin: ACT1-F (ATTCAGGTGATGGTGTGAGCCACAC) and ACT1-R (GCCACCGATCCAGACACTGTACTTCC). Each developmental stage comprised a pool of 5–13 endosperm RNA samples. Two analysis replicates were carried out and the RNA levels averaged, normalized to those of actin control, and displayed relative to those at 7-DAP.

Analysis of CYCB2;2 RNA accumulation patterns in 14 different tissues/developmental stages was carried out by compiling Nimblegen-derived RNA expression data from Sekhon et al. (2011), available at the Maize eFP Browser⁷.

Immunohistochemical localization assays were carried out essentially as described by Dante et al. (2014), except for a monoclonal anti-tubulin antibody (YOL 1/34, Accurate Chemical and Scientific Corp., Westbury, NY, USA), which was used to stain microtubules. Antibodies were utilized at a concentration of 0.5–1 μg/ml. Immunoprecipitation and kinase activity assays were carried out as described previously (Dante et al., 2014).

Sequences encoding selected domains of maize cyclins (amino acid residues 1–243 of CYCA1;1, 1–206 of CYCB1;3, and 4–143 of CYCB2;2) were expressed as GST fusions in Escherichia coli and purified according to procedures described previously (Dante et al., 2014). For CYCB2;2, a cDNA fragment encoding a 139-aa long, N-terminal domain was amplified with primers B2;2 4–143F (ATCGCGGATCCCGCGCGGCGGATGAAAACCGCAGACC) and B2;2 1–62R (CCGCTCGAGTCAGAGCAATTCATCTTCGTTCATAATGTCC), and cloned at the BamHI and XhoI sites of the pGEX4T-3 vector (GE Heathcare, Life Sciences). Antibodies were generated in rabbits (anti-cyclin) and affinity purified or purchased (anti-actin) as previously reported (Dante et al., 2014).

For expression in Drosophila S2 cells, CYCB2;2 was PCR-amplified with primers E2-KpnI (ATCCGCGGTACCAAACATGGCGGCGCGGGCGGCTGACGAGAAC) and E2HAS2 (ATCGC GAATTCCTATTAGGCGTAATCGGGCACATCGTAGGGGTAG-TTTGCACCTGAAGGAGGCGG), cloned into the KpnI and EcoRI sites of the pHSKSMCS vector (kindly provided by Dr. Thomas Bunch, University of Arizona), expressed in Drosophila S2 cells either alone or co-expressed with maize CDKA;1 or CDKA;3, and analyzed essentially as described previously for other cyclins (Dante et al., 2014). CYCB2;2 was immunoprecipitated from cell lysates and assayed for interaction with co-expressed maize CDKs using an anti-PSTAIR (Sigma, catalog No. P7962) antibody (Dante et al., 2014). Immunoprecipitates were also tested for kinase activity on histone H1 substrate in in vitro-assays as described (Dante et al., 2014).

³⁵S-radiolabeled CYCB2;2, and a T417A mutant (CYCB2;2T/A) polypeptides were synthesized in vitro using TNT T7 Quick for PCR DNA kit (Promega, Madison, WI, USA) as described (Dante et al., 2014). These proteins were incubated with cell extracts obtained from prevalently mitotic (i.e., 7-DAP) or endoreduplicating (i.e., 15-DAP) endosperm for 90 min before being subjected to SDS-PAGE and authoradiography. The 26S proteasome-specific inhibitor, carboben-zoxyl-leucinyl-leucinyl-leucinal (MG-132, Sigma), was utilized to determine whether protein degradation was proteasome-dependent. Procedures for these assays were as previously reported (Dante et al., 2014).

An EST encoding a B-type cyclin from maize, hereafter termed CYCB2;2, was identified by searching Pioneer Hi-Bred Inc.’s database. Subsequently, a corresponding genomic sequence located on chromosome 2, with accession number GRMZM2G138886, was also identified. The deduced CYCB2;2 protein sequence is 424 amino acids long, with a calculated molecular weight of 47.5 kDa. It possesses two all-alpha fold domains embedded in the so-called and highly conserved “cyclin core,” which are characteristic of cyclin proteins: Cyc_N (or cyclin box), which contains the CDK-binding site and is located between residues 163 and 289, and Cyc_C, which however, is less conserved among cyclins, and is located between residues 291 and 407 (Nugent et al., 1991; Figure 1A). A potential PRKK nuclear localization signal (NLS) is located between residues 231–234. A protein destruction box (SRRALTDIK, D-Box), targeted by the anaphase-promoting complex/cylosome (APC/C) and which is required for anaphase-specific proteolysis, is predicted at residues 26–34. A MRAIL motif, which is involved in cyclin binding to substrates containing the RxL motif, such as CDK-specific inhibitors and RBRs (Schulman et al., 1998), is located between residues 192–196.

Thr-417 represents a potential CDK phosphorylation site, which is conserved with similar phosphorylation sites in animal CycE proteins (Figures 1A,B). Phosphorylation of this site contributes to CycE proteolysis via the SCF-Fbw7 ubiquitin ligase pathway (Welker et al., 2003; Hwang and Clurman, 2005; Hao et al., 2007). Through database searches, a closely related cyclin from sorghum (Sb06g025380.1) was identified that also possesses this putative phosphorylation site (Figures 1B and 2), though it does not appear that this motif is conserved in other plant cyclins.

Phylogenetic analyses indicated that the maize CYCB2;2 cyclin described in this study clusters with other B2-type cyclins from monocots (maize, sorghum, and rice) and dicots (Arabidopsis and poplar). These results are in general agreement with previous analyses (Hu et al., 2010). During the course of this study, a gene was identified on chromosome 10 (GRMZM2G061287) that encodes a closely related and previously un-reported maize cyclin, which was termed CYCB2;3. The closest cyclins from rice (CYCB2;1) and sorghum (Sb06g025380.1; Figure 2) also lack functional characterization to date, which makes it difficult to predict a precise function for maize CYCB2;2 based on sequence similarity.

An N-terminal region of CYCB2;2 (amino acid residues 4–143) that has little or no sequence identity with other maize cyclins identified so far (∼39% identity with the corresponding regions in CYCB2;1, the closest maize homolog) was selected to raise specific antibodies (Figure 1A). This region of the protein lies outside the Cyc_N domain, and thus these antibodies were not likely to interfere with the catalytic or CDK-binding activity of CYCB2;2. The corresponding CYCB2;2 cDNA sequence was expressed in E. coli as a GST fusion and polyclonal antibodies were raised in rabbits against the purified protein, and were affinity purified. These antibodies were tested against the recombinant CYCB2;2 antigen and comparable N-terminal regions of maize CYCA1;1 and CYCB1;3, which were also expressed as GST-fusions in E. coli as described previously (Dante et al., 2014; Figure 3). While these antibodies effectively recognized the CYCB2;2 N-terminal polypeptide, no cross-reactivity was observed with either CYCA1;1 or CYCB1;3.

The expression patterns of CYCB2;2 RNA and protein during endosperm development were analyzed by RT-PCR and western blotting, respectively (Figure 4). These experiments showed that CYCB2;2 RNA levels are relatively high in 7-DAP endosperm and decline steadily thereafter, reaching by 13-DAP a minimum of less than 20% the 7-DAP reference levels, and remaining low up to 21-DAP (Figures 4A,B). This result is in agreement with the expression pattern of CYCB2;2 RNA obtained through global transcriptome analyses of developing maize endosperm (12–24 DAP) and available through the Maize eFP Browser (Sekhon et al., 2011; Figure 4C). Additionally, the data shown in Figure 4C indicate that CYCB2;2 RNA is widely expressed in maize tissues, and particularly at high levels in those known to contain an elevated proportion of mitotic cells, such as the primary root, shoot tip, leaf base, immature ear, embryo, and young endosperm.

The anti-CYCB2;2 antibody recognized a polypeptide of the expected molecular weight in endosperm extracts (Figure 4D). However, longer autoradiograph exposure times revealed the presence of an additional band of slightly lower molecular weight, which tended to accumulate specifically during the endoreduplication phase of endosperm development and was detectable from around 13-15 DAP (Figure 4E). This low-molecular-weight (LMW) CYCB2;2-related polypeptide was never detected in 7- or 9-DAP extracts; its accumulation appeared to be associated with the endoreduplication phase of endosperm development, which suggests it may play a specific role in this specialized type of cell cycle.

Comparison of the CYCB2;2 RNA and protein accumulation patterns revealed a discrepancy between the marked decline of RNA levels and the relatively constant protein levels observed between 7 and 21 DAP. This observation raises the possibility that CYCB2;2 protein may be subject to different turnover regulation in early (i.e., 7-DAP) versus more advanced (i.e., 13–21 DAP) endosperm developmental stages, which primarily comprise cells that are mitotic or endoreduplicating, respectively. Specifically, CYCB2;2 may not be as efficiently degraded in endoreduplicating endosperm as in mitotic endosperm.

Sequence analyses by subcellular localization prediction software and the presence of a putative NLS in the CYCB2;2 amino acid sequence suggested this protein could be targeted to the nucleus. We investigated the localization pattern of CYCB2;2 in endosperm, embryo, and root tip cells by immunofluorescence using anti-CYCB2;2 antibody (Figure 5). DNA and tubulin were stained as markers for nuclei and the microtubule cytoskeleton, respectively, in the same tissue sections. In 7-DAP endosperm, CYCB2;2 was clearly localized to the nucleus, though a weak signal was also detected in the cytoplasm (Figures 5A–D). Although most endosperm nuclei stained positively for CYCB2;2, the signal among nuclei differed notably, with a rather diffused CYCB2;2 accumulation pattern in some nuclei and a sharply punctuate one in others. These differences in localization patterns within a population of cells that are asynchronously engaged in the cell cycle are typical of cell cycle-regulated proteins. In 13-DAP endosperm cells, CYCB2;2 was clearly localized to the nucleus but it also showed extensive and diffuse localization in the cytoplasm, which was clearly more pronounced than in 7-DAP endosperm cells (Figures 5E–H). However, peripheral cells gave a relatively stronger CYCB2;2 signal than inner endosperm cells in both 7- (Figures 5A,D) and 13-DAP (Figures 5E,H) sections, but it is not clear whether this might be due to physiological differences between the two cell types or to the highly dense cytoplasm of peripheral cells at both developmental stages. Analysis of 7-DAP endosperm (Figure 5A, arrow indicates a telophase cell), embryo (Figures 5I–L, arrow indicates a late-phragmoplast cell in which the residual phragmoplast is being eroded beginning from its central zone) and meristematic root tip cells (Figure 5M), which typically proliferate through the mitotic cell cycle and do not undergo endoreduplication, revealed CYCB2;2 was localized to the phragmoplast between two daughter nuclei, suggesting a potential role for CYCB2;2 in late mitosis-early cytokinesis and the deposition of the new cell wall separating daughter cells. In root tip cells (Figure 5M), CYCB2;2 was localized to the cytoplasm but also to the mitotic spindle’s mid-zone in anaphase (center arrow), the phragmoplast mid-zone in telophase (right arrow) and at the site of cell wall formation at cytokinesis (left arrow). Both in mitotic and endoreduplicating cells, the nuclear fraction of CYCB2;2 did not appear to coincide with the DNA, and thus it appeared to be generally excluded from chromatin, similarly to CYCB2;1 (Mews et al., 1997), but there was some overlap with the microtubule cytoskeleton.

We compared the subcellular distribution patterns of CYCB2;2 between 9-DAP endosperm cells, which are mostly mitotic, and 15-DAP cells, which are primarily endoreduplicating. Subcellular fractions enriched for nuclear and cytosolic proteins were prepared from these two endosperm developmental stages and assayed for CYCB2;2 accumulation by western blotting (Figure 6). CYCB2;2 appeared prevalently localized to the nuclear fraction in 9-DAP endosperm, but a lower molecular weight polypeptide, corresponding to the additional LMW band shown in Figures 4D,E, accumulated specifically in the cytosolic fraction in 15-DAP endosperm. The presence of intact actin protein as well as tubulin and other cyclins as recently reported (Dante et al., 2014) indicates that the LMW, CYCB2;2-related band was not due to general protein degradation in the extract. These results are in agreement with the immunohistochemistry data shown in Figure 5, which does not discriminate signal based on molecular weight differences. In prevalently mitotic endosperm (i.e., 7–9 DAP), CYCB2;2 is mostly nuclear with relatively little signal from the cytoplasm. In endoreduplicating cells (i.e., 13–15 DAP), however, CYCB2;2 becomes more extensively localized to the cytoplasm, and the cell fractionation analysis suggests that this shift in localization is due to the specific accumulation of an extra-nuclear, LMW form of the protein (Figure 6). The presence of similar amounts of full-length CYCB2;2 in mitotic and endoreduplicating endosperm cells suggests this protein maybe involved in regulating cell cycle processes that are common to these two cell types, such as DNA synthesis. Alternatively, partial CYCB2;2 proteolysis and exclusion from the nucleus may be associated with the endocycle and may underscore a role for the intact protein in mitosis and/or cytokinesis. Thus, in contrast to mitotic cells, endoreduplicating endosperm cells are characterized by specific nuclear-to-cytosol redistributions of CYCB2;2, specifically suggesting that accumulation of the LMW component in the cytoplasm may be critical for the transition from the mitotic to endoreduplication phase of endosperm development.

We investigated whether CYCB2;2 is part of active kinase complexes, is capable of phosphorylating various substrates, and its activity varies between immature ear and endosperm at different stages of development. CYCB2;2 was immunoprecipitated from extracts prepared with either immature ear and 9-DAP endosperm, two tissues comprising prevalently mitotic cells, and tested for phosphorylation of histone H1 substrate by in vitro assays (Figure 7A). Whereas virtually no CYCB2;2-associated kinase activity was detected in extracts from immature ear, a strong signal was obtained from 9-DAP endosperm extracts. These patterns were similar to those of CYCB1;3, and antithetic to those of CYCD2;1 or CYCD5, which displayed much strong associated kinase activities in immature ear relative to endosperm. These experiments indicate there are specific differences with regard to the kinase activity associated with CYCB2;2 between immature ears and 9-DAP endosperm, as well as those associated with other types of cyclins. Although both tissues are known to exhibit high mitotic activity, these data underscore the presence of potentially important differences in the regulation of the cell cycle between these two tissues, and suggest a more prominent role in endosperm for B-type cyclins. We next asked whether CYCB2;2-associated kinase activity from 9-DAP endosperm could phosphorylate different recombinant polypeptides expressed as GST fusions (Figure 7B). The pocket domain of RBR3 was effectively phosphorylated, although RBR1 pocket was only weakly phosphorylated in this assay. Neither N-terminal domain of these proteins was phosphorylated, consistent with the typical predominance of conserved CDK targets specifically within the pocket domain of RBR proteins from many organisms (Sabelli et al., 2005; Sabelli and Larkins, 2009a; Burke et al., 2012). The E2F1 substrate was also phosphorylated by CYCB2;2-associated kinase activity, similarly to recent results for CYCB1;3-associated kinase activity (Dante et al., 2014). By 9-DAP, some endosperm cells could have already initiated the transition to endoreduplication, particularly those located in the center of the tissue, and thus analyses of kinase activity at this stage may not exclusively reflect mitotic cells. We thus measured CYCB2;2-associated kinase activity in 7-DAP endosperm extracts, a stage characterized exclusively by mitotic cells as shown by flow-cytometric profiles (Dante et al., 2014), in 15-DAP extracts, a stage in which cells are actively endoreduplicating and mitotic figures are rare, as well as at 11-DAP, which represents a transition stage with high rates of mitotic and endoreduplication cell cycle activities (Dante et al., 2014). As shown in Figure 7C, while CYCB2;2-associated kinase activity was high and virtually at the same levels in 7- and 11-DAP endosperm, it declined dramatically in 15-DAP endosperm. Collectively, these results indicate that CYCB2;2/CDK complexes are more active in mitotic than in endoreduplicating endosperm cells.

We next investigated whether CYCB2;2 can form complexes with A-type CDKs when co-expressed in a heterologous cell system, and whether such complexes are active (Figure 8). CYCB2;2 was co-expressed with either maize CDKA;1 or CDKA;3 in Drosophila S2 cells. Protein extracts were immunoprecipitated with anti-CYCB2;2 antibody and tested for the presence of either CDKA using anti-PSTAIR antibodies. In both cases, a clear interaction between CYCB2;2 and CDKA;1 or CDKA;3 was detected. However, these CDKA/CYCB2;2 complexes did not phosphorylate histone H1 substrate (Figure 8B), suggesting either that the CYCB2;2-associated kinase activity in endosperm extracts is due to a CDK other than CDKA;1 or CDKA;3 or that the expression system utilized for this assay was deficient for some other necessary factors, such as, for example, specific CDK-activating kinases typically acting upstream of CDKAs (Umeda et al., 2000; Shimotohno et al., 2004).

The sustained accumulation of CYCB2;2 protein during endosperm development, in spite of rapidly declining levels of its RNA, suggested that perhaps CYCB2;2 was becoming resistant to degradation by the 26S proteasome during the endoreduplication phase. Indeed, we recently showed that endoreduplicating endosperm can be differentiated from mitotic endosperm by virtue of sustained expression of certain A-, B-, and D-type cyclins associated with their reduced ubiquitin-mediated proteolysis (Dante et al., 2014). A similar outcome was obtained for CYCB2;2 in the present investigation (Figure 9). In vitro-synthesized CYCB2;2 was almost entirely degraded by a 90-min incubation with mitotic (i.e., 7-DAP) endosperm extracts, whereas it was unaffected by endoreduplicating (i.e., 15-DAP) extracts (Figure 9A). Degradation by mitotic extracts at 7-DAP was primarily due to the 26S proteasome, as it could largely be prevented by the addition of the proteasome-specific inhibitor, MG-132 (Figure 9B). In addition, we tested whether Thr-417 is required for CYCB2;2 proteolysis. This residue, in fact, is a potential CDK phosphorylation site that is conserved in animal CycE proteins and is necessary for protein degradation via the ubiquitin-dependent pathway (Welker et al., 2003; Hwang and Clurman, 2005; Hao et al., 2007). Thr-417 was mutagenized to Ala-417 (Figure 9C), which would destroy the putative phosphorylation site in CYCB2;2, but the mutant CYCB2;2T/A protein was degraded by incubation with mitotic extracts just as effectively as the wild-type protein (Figure 9A), suggesting that Thr-417, at least in vitro, is not required for CYCB2;2 proteolysis.