Plants have various ways of responding to limitations in their nutrient supply to ensure their survival. One such response is the induction of autophagy, which is the digestion by a cell of its own intracellular contents. It has been shown that this reaction occurs at the cellular level because autophagy can be induced in cultured cells by changing the regular medium to a nutrient-deficient one. In the case of tobacco BY-2 cells, autophagy is induced when there are restricted supplies of sugar, nitrogen, or phosphate (Pi) in the medium (Moriyasu and Ohsumi, 1996; Toyooka et al., 2006).

The in planta responses to Pi-starvation have been linked to sugar-signaling pathways (Rouached et al., 2010). In contrast to the in planta responses that require days after exposure to Pi-starvation, the induction of autophagy of BY-2 cells under nutrient-depleted conditions including Pi-starvation requires less than 12 h (Toyooka et al., 2006). The loss of Pi in the medium not only induces autophagy (Toyooka et al., 2006), but also causes cell cycle arrest of BY-2 cells at the G1 phase (Sano et al., 2004). Thus, information regarding a low extracellular level of Pi is transmitted not only to induce autophagy, but also to prevent progression of the cell cycle. In contrast to Pi-starvation, the deprivation of other major nutrients does not stop the cell cycle at a specific phase, although cell growth is arrested as in the case of Pi depletion (Sano et al., 2004). Therefore, in the present study we tested whether the induction of autophagy under conditions of deprivation of different nutrients would also interact with each other early in the process, or whether there are specific sensing steps for each nutrient in the cell.

We showed previously that a protein aggregate formed of the fusion protein of Cyt b5 and RFP (Cyt b5-RFP) was a good substrate for autophagy in tobacco BY-2 cells (Toyooka et al., 2006). Because the intact and processed forms of Cyt b5-RFP can be distinguished easily after the separation of proteins by SDS–PAGE, quantification of the fluorescent intensities of RFP-related polypeptides can be used to calculate the efficiency of autophagy (Toyooka et al., 2006). However, this method of quantification has a limitation in that the reporter proteins produced before the induction of autophagy cannot be distinguished from those produced afterwards. In other words, this method cannot distinguish whether the small amounts of intact Cyt b5-RFP that can be detected in cells undergoing induced autophagy arise from the de novo synthesis of the reporter protein or via inefficient degradation of the protein. To overcome this problem, we improved the previously reported method by using a photoconvertible and tetrameric fluorescent protein, kikume green-red (KikGR; Tsutsui et al., 2005) as a substitute for RFP, and the results of the analysis of Pi-starvation-induced autophagy using this new reporter protein are described below.

The culture of tobacco BY-2 cells and transformation of this cell line were performed as described previously (http://mrg.psc.riken.go.jp/strc/BY-2tran.htm). The induction of autophagy using a medium deficient in Pi, nitrogen, or sugar was carried out as described previously (Toyooka et al., 2006). In some cases, dipotassium hydrogen phosphite (Phi; Kanto Kagaku Co. Inc., Tokyo, Japan) was included at a final concentration of 2.6 mM.

Construction of pMAT137-Cytb5-cKikGR, which is an expression plasmid for the Cyt b5-KikGR fusion protein under the enhancer-duplicated CaMV35S promoter, was done as follows. A fragment containing restriction enzyme digestion sites for KpnI at the 5' terminus and for ClaI at the 3' terminus of the KikGR-coding region was amplified by polymerase chain reaction (PCR) using pKikGR1-MC1 (MBL, Nagoya, Japan) as a template and TTTAGGTACCCATGGTGAGTGTGATTACAT and TTATATCGATTTACTTGGCCAGCCTTGGCA as primers. The resulting DNA fragment was digested with ClaI and KpnI and cloned into the corresponding sites of a binary expression plasmid pMAT137 (Yuasa et al., 2005) to yield pMAT137-cKikume. A DNA fragment encoding Arabidopsis Cyt b5 (At5g48810) was amplified by PCR using GCGGAGATCTGTCACCAGCAGATCATCGGAGATGGG and GGCCGGTACCAAGAAGAAGGAGCCTTGGTCTTAGTGTAGT as primers and a plasmid for the expression of Cyt b5-RFP (Toyooka et al., 2006) as a template. The resulting DNA fragment was digested using BglII and KpnI, and subcloned into the corresponding sites of pMAT137-cKikume to yield pMAT137-Cyt b5-cKikGR. Expression of NtAtg8-YFP in cells expressing Cyt b5-KikGR was carried out by transforming the Cyt b5-KikGR-expressing cells with Agrobacterium harboring the expression plasmid for NtAtg8-YFP (Toyooka et al., 2006).

Conversion of the fluorescence of Cyt b5-KikGR was carried out essentially as described previously (Abiodun and Matsuoka, 2013a) with a minor modification. In brief, a 100 ml aliquot of the cultured transformed cells at the exponential phase of growth in a 300 ml Erlenmeyer flask was exposed to purple light from a 100 W black light bulb (H100BL-L; Toshiba, Tokyo, Japan), which emits line spectra at wavelengths of 334, 365, and 404 nm, with shaking at room temperature for appropriate times.

Proteins were extracted from the cells as follows. After incubation in various media, cells were collected from cell suspension by centrifugation at 360 × g for 1 min in a 1.5 ml microfuge tube. Precipitated cells were suspended into approximately 10 volumes of phosphate-buffered saline (PBS; 4.3 mM Na₂HPO₄, 1.4 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl, pH 7.4) and centrifuged as above. The resulting cell pellet was suspended with an equal volume of PBS and disrupted by sonication in an ice-cold water bath using a Bioruptor UCD-200TM sonicator (Cosmo Bio. Co. Ltd. Tokyo, Japan) at an M power setting for 1 min with 30 s interval 10 times. After centrifuging the microfuge tube at 360 × g for 5 min, the supernatant was collected and used for total protein fraction. Proteins were quantified using Bio-Rad Protein Assay kits (Bio-Rad Co., Hercules, CA, USA) as indicated by the manufacturer's instructions, using bovine serum albumin as a standard. To estimate the cell volume in culture, a 10-ml aliquot was centrifuged in a conical tube with graduations at 360 × g for 5 min and the volumes of cell precipitates were recorded. To weigh the cells, a 100 ml aliquot of the culture was filtered through a filter paper attached to a Buchner funnel with vacuum applied, and the weights of trapped cells were measured using a balance.

For detecting red and green fluorescence, aliquots of total protein fractions were mixed with 0.25 volumes of 5 × SDS sample buffer (250 mM Tris-HCl, pH 6.8, 50% (w/v) glycerol, 10% (w/v) SDS, 0.2 M dithiothreitol (DTT), 1% (w/v) bromophenol blue), and subjected directly to 9% SDS–PAGE without heating. After the separation of proteins by electrophoresis, the green and red fluorescence of proteins in the gels were recorded using a Typhoon 9400 image analyzer (GE Healthcare) with the following conditions: a 526 SP Cy2 filter set with a 488 nm laser running at 650 V was used for the recording of green fluorescence and a 580 BP30 Cy3 filter set with 532 nm laser running at 650 V was used for the recording of red fluorescence. The intensity of fluorescence was quantified using Image Quant Software (GE Healthcare).

For collecting epifluorescence images, an Olympus IX50 microscope equipped with DP70 color CCD camera (Olympus, Tokyo, Japan) was used. All the images were collected using a 20 × LC PLAN FL lens (Olympus). For the observation of green fluorescence, WIB filter/dichroic mirror cube (Olympus) was used. An RFP filter/dichroic mirror cube (Olympus) was used for detecting red fluorescence.

For collecting confocal images, a Leica TCS SP8 confocal microscope system (Leica Microsystems, Mannheim, Germany) equipped with a white light laser and HyD detectors was used. Images were captured using an HCPL APO CS2 40 × 1.30 oil lens with a pinhole of 44.1 μm of the confocal unit at an image resolution of 1024 × 1024 pixels at 100 Hz. For detecting green fluorescence, the excitation wavelength was 505 nm and signals of 514–546 nm were recorded using a HyD detector at a gain of 100. For detecting red fluorescence, the excitation wavelength was 555 nm and signals of 610–653 nm were recorded using a HyD detector at gain 101. At the same time, transmission images were recorded using a photomultiplier tube (PMT)-type detector. Only a single scan of each color using the line scan mode was used to collect each image.

The isolation of vacuole-enriched fractions from BY-2 cells and in vitro processing of reporter proteins were carried out essentially as described previously (Toyooka et al., 2006), except that the buffer conditions were changed as follows: the pH 6.6 and 6.0 buffers consisted of 8:2 and 6:4 mixtures of 50 mM Hepes-KOH pH 7.4 and citrate-Na pH 5.0, respectively.

We observed that the fusion protein of Cyt b5 and KikGR forms aggregates as in the case of the Cyt b5 and RFP fusion protein (Figure 1). The protein aggregates are able to change their fluorescence color after illumination with purple light, as in the case of the intact KikGR protein. The color-converted aggregates change color from red to orange, yellow or both red and green after the incubation of cells in normal medium (Figure 2D). This observation suggests that the aggregates are not static structures and can incorporate newly synthesized proteins. However, we cannot rule out the possibility that the formation of the aggregates with both green and red fluorescence were the result of de novo formation of newly synthesized (green) Cyt b5-KikGR and the preexisting (red-converted) Cyt b5-KikGR that had not contributed to generate aggregates. We also cannot rule out the possibility that some of the images of aggregates with both green and red colors (Figure 4D) were the result of close association of aggregates of two different colors because the resolution of our fluorescence microscope was not high enough. Future time-course analyses chasing one aggregate will be necessary to determine whether these aggregates with both colors were derived from color-converted aggregates.

Our observations here and our recent analysis of Golgi proliferation using a monomeric KikGR-tagged reporter protein (Abiodun and Matsuoka, 2013a,b) indicate that bulk conversion of the reporter fluorescence color and subsequent analysis is a method that can be applied to analyze the synthesis and/or turnover of distinct intracellular structures. However, this method has a limitation when used for the quantitative comparison of preexisting and newly synthesized proteins. The fluorescence of the red-converted KikGR is more sensitive to acidic pH than that of the nonconverted KikGR (Figure 3C). Despite this limitation, the method could be used successfully for the analysis of inducible protein turnover and/or intracellular movements. Analysis of protein turnover after separating the proteins by SDS–PAGE and subsequent scanning of both red and green fluorescence allowed the quantification of preexisting and newly synthesized proteins (Figure 3). However, such protein samples should be handled as quickly as possible because both sunlight and light from regular fluorescent lamps contain wavelengths that can cause the conversion of the fluorescence color of KikGR. The presence of faint red signals in nonconverted samples (Figure 2B) could have arisen from the conversion of fluorescence during sample processing.

The depletion of extracellular nutrients such as sugar, nitrogen, or Pi induced degradation of the aggregate. Thus, both the degradation of preexisting (red-converted) Cyt b5-KikGR and the synthesis of green-fluorescent Cyt b5-KikGR were observed in color-converted cells (Figure 3). The kinetics of the increase in green Cyt b5-KikGR were not significantly different from the Pi-limited and normal conditions up to 12 h (Figure 3A). Autophagic degradation was not observed early after the change in medium, and only a small decrease in color-converted protein was observed at 12 h after the shift to nutrient-starved medium. This suggested that the induction of autophagy under Pi-starvation was not a result of the sensing of the level of extracellular Pi, but rather that some intracellular events might be required. Protein synthesis was not attenuated at the time when autophagy was already induced (Figure 3A, at 24 and 48 h). This suggests that de novo protein synthesis might be taking place under Pi-starvation and autophagic degradation of the cellular constituents might supply energy and building blocks for protein synthesis.

Under Pi-starvation, we observed a decrease in a form of YFP-NtAtg8A found in nonstarved cells, and an increase in the slowly migrating form of YFP-NtAtg8 (Figure 3A). The formation of the slow-migrating form was suppressed in the presence of Phi when autophagic degradation of the aggregates was not occurring (Figure 3A). Although the nature of this form is unknown, similar slowly migrating forms of the Atg8 protein have been observed in Arabidopsis, especially in mutants deficient in Atg8/12 conjugation systems (Thompson et al., 2005; Chung et al., 2010). Interestingly, such forms were not found in maize (Chung et al., 2009). Therefore, it will be interesting to characterize this in terms of whether multiple orthologs of Atg8s in Arabidopsis and tobacco (Thompson et al., 2005; Toyooka and Matsuoka, 2006) generate such forms under different conditions of autophagic induction. It will also be interesting to investigate whether such processing is related to a plant-specific autophagy-related compartment that is generated under carbon-starvation (Honig et al., 2012).

The induction of autophagy was retarded when Phi was included in the Pi-deficient medium (Figure 3). Phi is a nonmetabolizable analog of Pi that does not support the growth of plants (Thao and Yamakawa, 2009). However, it has been shown to affect multiple events related to Pi metabolism. Thus, Phi attenuates several, but not all, in planta responses to Pi-starvation (Ticconi et al., 2001, 2004; Varadarajan et al., 2002; Kobayashi et al., 2006; Stefanovic et al., 2007; Ribot et al., 2008; Li et al., 2010; Berkowitz et al., 2013). Moreover, Phi mimics Pi in terms of the inducible degradation of Pi-deficient inducible phosphatase (Bozzoa et al., 2004), and Phi accelerates programmed cell death induced by Pi-starvation in cultured brassica cells (Singh et al., 2003). Our observations indicate that not only the in planta response to Pi deficiency, but also the induction of autophagy are prevented by Phi (Figure 4). However, the effect was lost at 72 h after incubation in Pi-free medium when Phi was included from the start. This limited effect can be explained by the observation that Phi rapidly absorbed from the medium is slowly sequestered into the vacuoles in tobacco BY-2 cells (Danova-Alt et al., 2008). In fact, subsequent addition of Phi under the Pi-deficient induction condition continued to prevent the induction of autophagy (Figure 4E). Thus, cytosolic Phi might mimic Pi and prevent the induction of autophagy.

Some of the signal transduction pathways induced by Pi deficiency merge with sugar-signaling pathways (Rouached et al., 2010 and references therein). However, our observation that Phi did not prevent the induction of autophagy in sugar-starved medium (Figure 5) suggests that the sensing mechanism for Pi-starvation that induces autophagy is independent of sugar signaling. Likewise, Phi did not prevent the induction of autophagy under nitrogen-starvation (Figure 5). In the case of sugar starvation-dependent induction of autophagy, it was reported in sycamore maple cells that the level of energy supply is crucial, and that the inclusion of pyruvate, which is a good substrate for the mitochondrial energy supply system, could suppress sugar starvation-inducible autophagy (Aubert et al., 1996). In mammalian and yeast systems, the target of rapamycin (TOR) protein kinase has been shown as a key negative regulator for nutrient limitation-induced autophagy (Díaz-Troya et al., 2008). It was also shown in Arabidopsis that constitutive autophagy is negatively regulated by TOR using an interfering RNA (RNAi)-based suppression approach (Liu and Bassham, 2010). Therefore, it would be interesting to apply the present approach, along with pyruvate and/or respiratory inhibitors or downregulation of the expression of TOR, to analyze whether the cellular mechanisms used to sense limitations in the supply of different nutrients and in the induction of autophagy might be associated.