<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" 'JATS-journalpublishing1-3-mathml3.dtd'>
<article article-type="research-article" dtd-version="1.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Physiol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Physiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Physiol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1664-042X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1733425</article-id>
<article-id pub-id-type="doi">10.3389/fphys.2025.1733425</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Intermittent exercise alleviates MI-induced renal injury in mice via IGF-1</article-title>
<alt-title alt-title-type="left-running-head">Zhu et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphys.2025.1733425">10.3389/fphys.2025.1733425</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhu</surname>
<given-names>Wanyu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3257513"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bo</surname>
<given-names>Wenyan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ma</surname>
<given-names>Yixuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>School of Physical Education, Institute of Sports and Exercise Biology, Shaanxi Normal University</institution>, <city>Xi&#x2019;an</city>, <state>Shaanxi</state>, <country country="CN">China</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>College of Physical Education, Shanxi University</institution>, <city>Taiyuan</city>, <state>Shanxi</state>, <country country="CN">China</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: Wanyu Zhu, <email xlink:href="mailto:zhuwanyu2000@126.com">zhuwanyu2000@126.com</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2025-12-19">
<day>19</day>
<month>12</month>
<year>2025</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1733425</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>10</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>12</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>20</day>
<month>11</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Zhu, Bo and Ma.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Zhu, Bo and Ma</copyright-holder>
<license>
<ali:license_ref start_date="2025-12-19">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<p>Myocardial infarction (MI) often induces acute kidney injury (AKI) via systemic hypoperfusion and oxidative stress, yet the protective mechanisms of exercise remain unclear. This study investigated whether intermittent exercise alleviates MI-induced AKI through the insulin-like growth factor-1 (IGF-1)/PI3K/AKT signaling pathway. An AKI model was established in mice via coronary artery ligation, followed by moderate-intensity intermittent treadmill training for 4 weeks. Echocardiography, serum biochemical markers, renal histology, RT-qPCR, and Western blotting were used to assess cardiac and renal function, inflammatory cytokines, oxidative stress, apoptosis, and IGF-1/PI3K/AKT signaling. <italic>In vitro</italic>, H<sub>2</sub>O<sub>2</sub>-treated NRK renal cells were used to mimic oxidative damage. Recombinant human IGF-1 (rhIGF-1), AMPK agonist AICAR, IGF-1 receptor inhibitor NVP-AEW541, and PI3K inhibitor LY294002 were applied to explore the pathway&#x2019;s involvement in exercise-induced renoprotection. MI led to impaired cardiac function, renal structural injury, elevated BUN and MDA levels, increased expression of IL-6, TNF-&#x3b1;, Bax, and Cleaved Caspase-3, and decreased SOD activity. Intermittent exercise improved cardiac output, attenuated renal injury, enhanced antioxidant capacity, and upregulated IGF-1 expression and its downstream PI3K/AKT signaling. <italic>In vitro</italic>, rhIGF-1 and AICAR mimicked the protective effects of exercise, while IGF-1R or PI3K inhibitors partially abolished these effects. These findings suggest that intermittent exercise ameliorates MI-induced AKI by activating the IGF-1/PI3K/AKT pathway, thereby exerting anti-inflammatory, antioxidant, and anti-apoptotic effects. This study highlights the role of exercise-induced IGF-1 in heart-kidney axis protection and provides a mechanistic basis for therapeutic interventions targeting MI-related renal complications.</p>
</abstract>
<kwd-group>
<kwd>exercise</kwd>
<kwd>heart</kwd>
<kwd>kidney</kwd>
<kwd>IGF-1</kwd>
<kwd>PI3K</kwd>
<kwd>AKT pathway</kwd>
</kwd-group>
<funding-group>
<funding-statement>The authors declare that no financial support was received for the research and/or publication of this article.</funding-statement>
</funding-group>
<counts>
<fig-count count="9"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="37"/>
<page-count count="12"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Renal Physiology and Pathophysiology</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<label>1</label>
<title>Introduction</title>
<p>Myocardial infarction (MI), with its increasing prevalence, is a major culprit of cardiac dysfunction and ultimately heart failure (<xref ref-type="bibr" rid="B8">Elgendy et al., 2019</xref>). In the acute stage, extensive loss of cardiomyocytes diminishes the heart&#x2019;s pumping efficiency, leading to reduced cardiac output and systemic hypoperfusion, among which the kidney is particularly susceptible. Clinical observations indicate that a significant proportion of MI patients present with impaired renal function and disturbances in water&#x2013;electrolyte balance, thereby fostering a detrimental &#x201c;heart-kidney&#x201d; interaction, termed cardiorenal syndrome (CRS) (<xref ref-type="bibr" rid="B23">McCallum and Sarnak, 2023</xref>; <xref ref-type="bibr" rid="B26">Rangaswami et al., 2019</xref>). Therefore, it is of great clinical significance to develop approaches that can concurrently enhance cardiac performance and maintain renal metabolic stability to slow disease progression (<xref ref-type="bibr" rid="B1">Bridgewater et al., 2005</xref>).</p>
<p>Current therapeutic strategies for CRS mainly focus on supportive care, including hemodialysis, diuretics, and positive inotropic agents. Although these methods can transiently relieve organ stress, they do not reverse the reciprocal damage between the heart and kidney nor address the underlying pathophysiological mechanisms of the &#x201c;heart-kidney axis.&#x201d; In recent years, physical exercise, recognized as a cost-effective and low-risk non-pharmacological intervention, has attracted increasing attention in chronic disease prevention and rehabilitation (<xref ref-type="bibr" rid="B18">Kouidi et al., 2024</xref>). Research evidence suggests that exercise, with intermittent exercise in particular, can improve distant organ function by modulating circulating humoral factors and extracellular vesicle content (<xref ref-type="bibr" rid="B4">Chow et al., 2022</xref>; <xref ref-type="bibr" rid="B22">Martinez et al., 2021</xref>; <xref ref-type="bibr" rid="B11">Gao et al., 2021</xref>; <xref ref-type="bibr" rid="B28">Sprick et al., 2022</xref>). Among these exercise-induced mediators, insulin-like growth factor-1 (IGF-1) has been identified as a key molecule with diverse biological activities (<xref ref-type="bibr" rid="B9">Fang et al., 2023</xref>; <xref ref-type="bibr" rid="B29">Vinciguerra et al., 2012</xref>). IGF-1 not only contributes to cardiovascular stability (<xref ref-type="bibr" rid="B19">Lee et al., 2024</xref>) but also confers anti-apoptotic, antioxidant, and reparative benefits to renal tissue (<xref ref-type="bibr" rid="B7">Dong et al., 2019</xref>). Importantly, levels of IGF-1 in the kidney decrease significantly following MI, whereas exogenous IGF-1 supplementation improves renal function (<xref ref-type="bibr" rid="B5">Cui and He, 2022</xref>), highlighting its crucial role in modulating the &#x201c;heart&#x2013;kidney axis.&#x201d;</p>
<p>Exercise has been reported to improve cardiac function after MI partly by upregulating IGF-1 expression (<xref ref-type="bibr" rid="B17">Khetarpal et al., 2025</xref>). Previous studies have revealed that IGF-1 exerts cytoprotective effects by binding to its receptor (IGF-1R) and activating the downstream PI3K/AKT signaling pathway (<xref ref-type="bibr" rid="B16">Khan et al., 2025</xref>; <xref ref-type="bibr" rid="B24">Meng et al., 2021</xref>; <xref ref-type="bibr" rid="B30">Wang et al., 2020</xref>; <xref ref-type="bibr" rid="B36">Zeng et al., 2021</xref>; <xref ref-type="bibr" rid="B21">Liao et al., 2018</xref>; <xref ref-type="bibr" rid="B12">Higashi et al., 2010</xref>; <xref ref-type="bibr" rid="B3">Chapuis et al., 2010</xref>). Building upon this evidence, previous studies have demonstrated that exercise promotes growth factor&#x2013;driven recovery of skeletal muscle dysfunction following MI (<xref ref-type="bibr" rid="B20">Li et al., 2022</xref>). In particular, exercise activates IGF-1 and its downstream PI3K/AKT signaling cascade, thereby mitigating skeletal muscle atrophy (<xref ref-type="bibr" rid="B10">Feng et al., 2022</xref>; <xref ref-type="bibr" rid="B2">Cai et al., 2018</xref>). Consistent with these findings, our earlier work revealed that exercise elevates the expression of the myokine Irisin, which subsequently stimulates the AMPK/Sirt1 pathway and suppresses apoptosis in renal cells of MI mice (<xref ref-type="bibr" rid="B32">Wu et al., 2020</xref>). Collectively, these results reinforce the notion of an &#x201c;exercise&#x2013;myokine&#x2013;kidney&#x201d; protective axis. However, whether IGF-1 mediates the renoprotective actions of exercise following MI through the IGF-1R/PI3K/AKT pathway has not been systematically investigated. To address this knowledge gap, we established a murine model of MI-induced acute kidney injury combined with moderate-intensity intermittent treadmill training, and further constructed an <italic>in vitro</italic> oxidative stress model using Normal Rat Kidney (NRK) cells. By applying the IGF-1R inhibitor NVP-AEW541, the PI3K inhibitor LY294002, and human recombinant IGF-1 protein (rhIGF-1). This study aimed to clarify whether exercise-induced activation of the IGF-1/IGF-1R/PI3K/AKT pathway mediates renal protection following MI thereby providing mechanistic insight for developing exercise-based strategies against cardiorenal dysfunction.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2-1">
<label>2.1</label>
<title>Experimental animals, cell treatments and grouping</title>
<p>Forty healthy male C57BL/6J mice (8 weeks old, 20&#x2013;22 g) were purchased from the Animal Experimentation Center of Xi&#x2019;an Jiaotong University. All procedures conformed to the Guide for the Care and Use of Laboratory Animals (8th ed., ISBN-10: 0-309-15396-4) and were approved by the Animal Ethics Committee of Shaanxi Normal University. Mice were housed at 22 &#xb0;C&#x2013;25 &#xb0;C with 50%&#x2013;60% humidity under a 12-h light/dark cycle with free access to food and water. After 1 week of acclimation, they were randomly assigned to four groups (n &#x3d; 10 each): sham (S), sham &#x2b; exercise (SE), myocardial infarction (MI) and myocardial infarction &#x2b; exercise (ME).</p>
<p>Normal rat kidney (NRK) cells were obtained from CytoCell. Cells were maintained in DMEM/F-12 supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin&#x2013;streptomycin at 37 &#xb0;C in a humidified 5% CO<sub>2</sub> incubator. When confluence reached 70%&#x2013;80%, cells were exposed to 0.2 mmol L<sup>&#x2212;1</sup> H<sub>2</sub>O<sub>2</sub> for 4 h to induce acute oxidative stress, after which they immediately received pharmacological treatments. Interventions included recombinant human IGF-1 (rhIGF-1, PeproTech, 100 ng mL<sup>&#x2212;1</sup>), the AMPK agonist AICAR (Sigma-Aldrich, 500 &#xb5;M), the IGF-1R inhibitor NVP-AEW541 (Selleckchem, 5 &#xb5;M), the PI3K inhibitor LY294002 (Selleckchem, 10 &#xb5;M), and freshly prepared H<sub>2</sub>O<sub>2</sub> (0.2 mmol L<sup>&#x2212;1</sup> in sterile PBS). All agents were added directly after modelling, and treatment durations (typically 12&#x2013;24 h) were set according to subsequent protein or gene-expression assays to evaluate their protective effects and signalling impacts following oxidative stress (<xref ref-type="fig" rid="F1">Figure 1</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Experimental design and grouping diagram.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g001.tif">
<alt-text content-type="machine-generated">Diagram illustrating two experimental procedures. On the left, a mouse model involving sham and myocardial infarction with intermittent exercise for four weeks. It leads to kidney analysis using histological staining, RT-qPCR, and Western blotting. On the right, a cell culture experiment with NRK cells treated with H2O2/AICAR and compounds rhIGF-1, NVP-AEW541, and LY294002, affecting p-PI3K and p-AKT, followed by Western blotting.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s2-2">
<label>2.2</label>
<title>Myocardial-infarction model construction and exercise protocol</title>
<p>Myocardial-infarction model construction: After induction of anaesthesia with inhaled isoflurane, each mouse was fixed supine on the surgical table. A mid - sternal thoracotomy was performed to expose the heart, and the left anterior descending coronary artery was ligated. ST-segment elevation or T-wave inversion on the postoperative electrocardiogram, together with visible blanching of the apical myocardium, was taken as evidence of successful modelling</p>
<p>Exercise protocol: One week after surgery, mice underwent adaptive incremental treadmill training <sub>(5&#x2013;10 m min</sub>
<sup>&#x2212;1</sup>
<sub>, 10&#x2013;30 min d</sub>
<sup>&#x2212;1</sup>
<sub>, 5 consecutive days)</sub>. Formal training consisted of a 10-min warm-up at 5 m min<sup>&#x2212;1</sup> <sub>(&#x2248;40&#x2013;50% VO2max)</sub>, followed by intermittent running: 3 min at 8 m min<sup>&#x2212;1</sup> <sub>(50&#x2013;60% VO2max)</sub> alternated with 7 min at 12 m min<sup>&#x2212;1</sup> <sub>(80&#x2013;90% VO2max)</sub> for a total of 50&#x2013;60 min d<sup>&#x2212;1</sup>, 5 days week<sup>&#x2212;1</sup> for 4 weeks. The VO<sub>2max</sub> values were set according to previous measurements and were not determined individually for each animal. Exercise intensity was determined based on VO<sub>2max</sub> values reported in prior studies using comparable mouse models rather than individual testing, to minimize stress and variability. This method has been widely applied to ensure reproducibility of moderate-intensity protocols (<xref ref-type="bibr" rid="B13">Huang et al., 2025</xref>; <xref ref-type="bibr" rid="B25">Mohebinejad et al., 2025</xref>; <xref ref-type="bibr" rid="B20">Li et al., 2022</xref>).</p>
</sec>
<sec id="s2-3">
<label>2.3</label>
<title>Cardiac-function assessment</title>
<p>The day after the 4-week training period, mice were anaesthetised with isoflurane, fixed supine and depilated. M-mode echocardiography was performed with a small-animal probe to measure the left-ventricular internal diameter in systole (LVIDs) and diastole (LVIDd), and to calculate ejection fraction (EF) and fractional shortening (FS). For each parameter, the mean of six consecutive cardiac cycles was recorded.</p>
</sec>
<sec id="s2-4">
<label>2.4</label>
<title>Histopathological examination of kidney</title>
<p>Immediately after the final session, kidneys were rapidly excised, rinsed in ice-cold saline, and partly fixed in 4% paraformaldehyde for 48 h. Samples were dehydrated through a graded ethanol series, cleared in chloroform, embedded in paraffin and sectioned serially at 5 &#xb5;m. Sections were stained with haematoxylin&#x2013;eosin (HE; Shanghai Solarbio, G1120) and periodic-acid&#x2013;Schiff (PAS; Shanghai Solarbio, G1280), dehydrated, cleared with xylene and mounted with neutral resin. Tubular epithelial swelling, cell desquamation, nucleocytoplasmic separation and tubular atrophy were examined and photographed under an Olympus BX51 light microscope, and quantitative analysis was performed with Image-Pro Plus software.</p>
</sec>
<sec id="s2-5">
<label>2.5</label>
<title>RT-qPCR analysis of renal tissue</title>
<p>Total RNA from renal tissues and cells was extracted with an RNA Rapid Extraction Kit (Beijing Polymed Biosciences). Reverse transcription was carried out using the M5 Super Plus qPCR RT Kit with gDNA Remover in a 20 &#xb5;L reaction to generate cDNA. Real-time quantitative PCR was performed with 2&#xd7; M5 HiPer SYBR Premix EsTaq in a 20 &#xb5;L system under the following programme: 95 &#xb0;C for 3 min, then 40 cycles of 95 &#xb0;C for 10 s and 51 &#xb0;C for 30 s. GAPDH served as the internal control, and relative expression was calculated by the 2&#x5e;-&#x394;&#x394;Ct method. All qPCR primers were designed by Beijing Qingke Biotechnology; sequences are listed in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Sequence list of RT-qPCR primers.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Gene</th>
<th align="left">Forward sequence 5&#x2018;&#x2013;3&#x2019;</th>
<th align="left">Reverse sequence 5&#x2018;&#x2013;3&#x2019;</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">GAPDH</td>
<td align="left">TCACCATCTTCCAGGAGCGAGAC</td>
<td align="left">TGAGCCCTTCCACAATGCCAAAG</td>
</tr>
<tr>
<td align="left">AKT</td>
<td align="left">GAGGCGGAAAGAGTGTGTGA</td>
<td align="left">CCAGTGTGAGCCAGAAGTCA</td>
</tr>
<tr>
<td align="left">Bax</td>
<td align="left">GTGGAGATGAACTGGACAGCA</td>
<td align="left">GCCACAAAGATGGTCACGGT</td>
</tr>
<tr>
<td align="left">Bcl-2</td>
<td align="left">GGTGAACTGGGGGAGGATTG</td>
<td align="left">CGGTTCAGGTACTCAGTCATCC</td>
</tr>
<tr>
<td align="left">C-Caspase-3</td>
<td align="left">GGAGTCTGACTGGAAAGCCGAA</td>
<td align="left">CTTCTGGCAAGCCATCTCCTCA</td>
</tr>
<tr>
<td align="left">FOXO3a</td>
<td align="left">CAAGAACACCAGCAGCAAAG</td>
<td align="left">TCCTTCCAGCTCCATCTCCT</td>
</tr>
<tr>
<td align="left">HO-1</td>
<td align="left">TGCCACCAAGGACCCATAC</td>
<td align="left">TGTGTGCTTGCAATGAGAGTGT</td>
</tr>
<tr>
<td align="left">IGF-1</td>
<td align="left">CAGCACTGGGCAGCTCCAT</td>
<td align="left">GGCACTTGCCTCAGAGCACT</td>
</tr>
<tr>
<td align="left">IGF-1R</td>
<td align="left">TGGGACAGATCTTGGACTGG</td>
<td align="left">AGTGTCGTCTGCCAAGGTCT</td>
</tr>
<tr>
<td align="left">IL-1&#x3b2;</td>
<td align="left">GCAACTGTTCCTGAACTCAACT</td>
<td align="left">ATCTTTTGGGGTCCGTCAACT</td>
</tr>
<tr>
<td align="left">IL-6</td>
<td align="left">GAGGATACCACTCCCAACAGACC</td>
<td align="left">AAGTGCATCATCGTTGTTCATACA</td>
</tr>
<tr>
<td align="left">KIM-1</td>
<td align="left">TGCCTGGTCTGCACTGTCTA</td>
<td align="left">AGGGTGATGATGGTGACGGA</td>
</tr>
<tr>
<td align="left">NF-&#x3ba;B</td>
<td align="left">CGATCAGTACCGGCAGTTGA</td>
<td align="left">GTAGGAGATGGGGTTGGTCTG</td>
</tr>
<tr>
<td align="left">Nrf2</td>
<td align="left">GGGATCCCAACTTCCCTGAT</td>
<td align="left">CTGGATCTGGGATGACTGGA</td>
</tr>
<tr>
<td align="left">PI3K</td>
<td align="left">ATGGAGAGCCAGTTGGAAAAG</td>
<td align="left">CAGGTTCCCTCAGCTCCATA</td>
</tr>
<tr>
<td align="left">SOD1</td>
<td align="left">GGTGTCCGTGTTGTGTTGGT</td>
<td align="left">TCTCGGTGGGTTTCCAGTTA</td>
</tr>
<tr>
<td align="left">TNF-&#x3b1;</td>
<td align="left">GGTGCCTATGTCTCAGCCTCTT</td>
<td align="left">GCCATAGAACTGATGAGAGGGAG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-6">
<label>2.6</label>
<title>Western-blot protein expression analysis</title>
<p>Approximately 50 mg of kidney tissue was homogenised on ice in lysis buffer (RIPA:PMSF: phosphatase inhibitor &#x3d; 100:1:1). After centrifugation at 12,000 rpm for 15 min, supernatants were quantified by the BCA method, adjusted to 4 ng &#x3bc;L<sup>&#x2212;1</sup> and denatured at 100 &#xb0;C for 10 min. Samples were separated on SDS&#x2013;PAGE gels and transferred to NC membranes at 300 mA under cooling. Membranes were blocked with 3% BSA for 2 h, then probed with primary antibodies against IGF-1 (Abcam, ab133542), IGF-1R (Abcam, ab182408), PI3K (CST, 4257S), AKT (CST, 9272S), TNF-&#x3b1; (CST, 11948S), IL-6 (Abcam, ab9324), Cleaved Caspase-3 (CST, 9661) and GAPDH (Abcam, ab181602). After 2 h at room temperature, membranes were incubated with HRP-conjugated secondary antibodies, washed five times with TBST and developed with ECL; band intensities were quantified using a multicolour imaging system.</p>
</sec>
<sec id="s2-7">
<label>2.7</label>
<title>Kit-based biochemical assays</title>
<p>For biochemical assays, reagents were added sequentially to 96-well plates, and absorbance was measured on a microplate reader at kit-specified wavelengths: SOD (Nanjing Jiancheng, A001-3, 550 nm), MDA (Nanjing Jiancheng, A003-1, 532 nm) and BUN (Nanjing Jiancheng, C013-2, 520 nm) were measured in kidney homogenates, while IGF-1 (R&#x26;D Systems, MIG100, 450 nm) was determined in serum.</p>
</sec>
<sec id="s2-8">
<label>2.8</label>
<title>Data processing and statistical analysis</title>
<p>Images were processed with ImageJ, Western blot data with Image Lab, and statistical analysis with GraphPad Prism 9. One-way ANOVA or linear regression was applied; multiple comparisons used Tukey&#x2019;s test. Data are presented as mean &#xb1; SD. &#x2a;<italic>p</italic> &#x3c; 0.05 indicated statistical significance, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01 high significance and &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001 very high significance.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<label>3</label>
<title>Results</title>
<sec id="s3-1">
<label>3.1</label>
<title>Cardiac-function results in mice</title>
<p>Myocardial echocardiography showed that ventricular systolic motion was weakened in the MI group compared with the S group, whereas the ME group displayed an improvement (<xref ref-type="fig" rid="F2">Figure 2A</xref>). LVIDs (3.21 &#xb1; 0.15 mm) and LVIDd (4.58 &#xb1; 0.12 mm) were significantly increased, while EF (42.3% &#xb1; 3.5%) and FS (21.8% &#xb1; 2.1%) decreased compared with S mice (EF 68.5% &#xb1; 2.9%, FS 36.2% &#xb1; 1.8%; <italic>p</italic> &#x3c; 0.001). In contrast, the ME group exhibited smaller LVIDs and LVIDd and higher EF and FS than the MI group (<italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F2">Figure 2B</xref>). These findings confirm successful construction of the MI model&#x2014;cardiac function declined in MI mice&#x2014;while intermittent exercise safely and effectively improved cardiac performance in the ME group.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Evaluation of cardiac function in MI mice subjected to intermittent exercise. <bold>(A,B)</bold> Representative echocardiographic images and quantitative measurements of cardiac parameters. Data are presented as mean &#xb1; SD. n &#x3d; 4 mice per group. Each experiment was repeated at least four times independently. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001. LVIDd, left ventricular internal diameter during diastole; LVIDs, left ventricular internal diameter during systole; EF, ejection fraction; FS, fractional shortening. Groups: Sham-sham-operated; SE, sham &#x2b; exercise; MI, myocardial infarction; ME, myocardial infarction &#x2b; exercise.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g002.tif">
<alt-text content-type="machine-generated">Panel A shows ultrasound images of hearts under four conditions: Sham, SE, MI, and ME. Panel B features bar graphs comparing four parameters (LVIDs, LVIDd, EF, and FS) across these conditions, with statistically significant differences indicated by asterisks. LVIDs and LVIDd measurements show increases in MI, while EF and FS percentages decrease. Statistical significance is marked as follows: &#x2a;&#x2a; denotes p &#x3C; 0.01, and &#x2a;&#x2a;&#x2a; denotes p &#x3C; 0.001.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<label>3.2</label>
<title>Intermittent exercise improves MI-induced renal injury in mice</title>
<p>Histopathology of the kidney revealed intact architecture with no evident injury in S and SE mice on both HE and PAS staining. In MI mice, tubular epithelial swelling and detachment, interstitial oedema and tissue damage were observed; In ME mice, pathological changes were attenuated, with relatively preserved tubular structure and less interstitial damage (<xref ref-type="fig" rid="F3">Figure 3A</xref>). Biochemically, MI mice displayed significantly higher serum BUN and MDA levels and lower SOD activity and IGF-1 concentrations than controls (<italic>p</italic> &#x3c; 0.001). Intermittent exercise reduced BUN and MDA while elevating SOD and IGF-1, all with high statistical significance (<italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F3">Figures 3B&#x2013;E</xref>). Thus, MI induces renal injury and dysfunction, whereas intermittent exercise substantially alleviates kidney damage and restores renal function.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Histological and biochemical evaluation of renal injury following MI and intermittent exercise. <bold>(A)</bold> Hematoxylin&#x2013;eosin (HE; magnifications 10&#xd7;, 20&#xd7;) and periodic acid&#x2013;Schiff (PAS) staining of kidney sections. <bold>(B&#x2013;E)</bold> Quantitative determination of SOD activity, MDA levels, BUN concentration, and IGF-1 content. Data are presented as mean &#xb1; SD. n &#x3d; 4 mice per group. Each experiment was repeated at least six times independently. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001. SOD, superoxide dismutase; MDA, malondialdehyde; BUN, blood urea nitrogen; IGF-1, insulin-like growth factor-1.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g003.tif">
<alt-text content-type="machine-generated">The image contains two sections. Section A shows microscopic images of tissue samples stained with hematoxylin and eosin (HE) and periodic acid-Schiff (PAS) at different magnifications (10X for HE, 20X for HE, 10X for PAS), across different conditions: Sham, SE, MI, and ME. Section B displays bar graphs comparing SOD, MDA, BUN, and Serum IGF-1 levels among the same conditions, with statistical significance indicated by asterisks.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3">
<label>3.3</label>
<title>Intermittent exercise upregulates renal IGF-1 and its pathway in MI mice and modulates genes for inflammation, apoptosis and oxidative stress</title>
<p>Pro-apoptotic genes, pro-inflammatory genes and the kidney-injury marker KIM-1 were significantly upregulated in the MI group versus the S group (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001), whereas the anti-apoptotic gene Bcl-2, antioxidant genes and genes in the IGF-1/IGF-1R/PI3K/AKT pathway were downregulated (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001). Compared with the MI group, the ME group showed reductions in pro-apoptotic, pro-inflammatory and injury-related transcripts (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001) and significant increases in anti-apoptotic, antioxidant and IGF-1-pathway transcripts (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F4">Figures 4A&#x2013;D</xref>). These results indicate that MI suppresses renal IGF-1 expression and its downstream anti-inflammatory, anti-apoptotic and anti-oxidative signalling, whereas intermittent exercise re-activates the IGF-1 axis and mitigates MI-induced renal injury, thereby conferring renoprotection.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Relative mRNA expression of IGF-1 pathway components and related molecular markers in renal tissue. <bold>(A)</bold> IGF-1 and downstream signaling genes. <bold>(B)</bold> Apoptosis-related genes. <bold>(C)</bold> Oxidative stress markers. <bold>(D)</bold> Inflammatory cytokines. Data are presented as mean &#xb1; SD. n &#x3d; 4 mice per group. Each experiment was repeated at least six times independently. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g004.tif">
<alt-text content-type="machine-generated">Bar graphs labeled A to D compare mRNA expression levels across conditions: Sham, SE, MI, and ME. Graph A examines IGF-1, IGF-1R, AKT, PI3K; Graph B evaluates Bax, Bcl-2, C-Caspase-3, KIM-1; Graph C assesses SOD1, HO-1, NRF2, FOXO3a; Graph D measures IL-6, TNF-&#x3B1;, IL-1&#x3B2;, NF-&#x3BA;B. Each bar pair indicates significant differences, marked by asterisks.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<label>3.4</label>
<title>Intermittent exercise enhances renal IGF-1 signalling and regulates inflammatory proteins in MI mice</title>
<p>Protein analysis showed that IGF-1, IGF-1R, PI3K and AKT were reduced in MI mice compared with S mice (<italic>p</italic> &#x3c; 0.001), whereas the inflammatory proteins TNF-&#x3b1; and IL-6 were significantly elevated (<italic>p</italic> &#x3c; 0.001). In ME mice, IGF-1, IGF-1R, PI3K and AKT protein levels were significantly higher, and TNF-&#x3b1; and IL-6 lower, than in MI mice (<italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F5">Figures 5A,B</xref>). These findings confirm that MI depresses the renal IGF-1 pathway and its anti-inflammatory capacity, while intermittent exercise re-activates this pathway and alleviates MI-induced kidney damage. Western blot analysis was performed for both total and phosphorylated forms of pathway proteins where available. Total protein levels were used as an indirect indicator of signaling activation, consistent with previous studies reporting parallel changes in phosphorylation status.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Protein expression of IGF-1/PI3K/AKT signaling components and inflammatory cytokines in renal tissue. <bold>(A,B)</bold> Immunoblotting results for IGF-1, IGF-1R, PI3K, AKT, TNF-&#x3b1;, and IL-6. Data are presented as mean &#xb1; SD. n &#x3d; 4 mice per group. Each experiment was repeated nine times independently. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001. IGF-1R, insulin-like growth factor-1 receptor; TNF-&#x3b1;, tumor necrosis factor-alpha; IL-6, interleukin-6.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g005.tif">
<alt-text content-type="machine-generated">Western blot and bar graphs comparing protein expression levels in four groups: Sham, SE, MI, and ME. Panel A displays bands for proteins like IGF-1, IGF-1R, PI3K, AKT, TNF-&#x3B1;, and IL-6, with GAPDH as a control. Panel B shows corresponding bar graphs indicating significant differences marked by asterisks, illustrating protein-to-GAPDH ratios.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<label>3.5</label>
<title>Exogenous AICAR and rhIGF-1 activate PI3K/AKT and suppress H<sub>2</sub>O<sub>2</sub>-induced cellular inflammation</title>
<p>Compared with the control group (C), the H<sub>2</sub>O<sub>2</sub> group showed a marked reduction in p-PI3K and p-AKT expression, accompanied by significant elevations in the inflammatory factors IL-6 and Cleaved Caspase-3 (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001). Both the H<sub>2</sub>O<sub>2</sub> &#x2b; AICAR and H<sub>2</sub>O<sub>2</sub> &#x2b; rhIGF-1 treatments significantly increased p-PI3K and p-AKT levels while lowering IL-6 and Cleaved Caspase-3 (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F6">Figure 6</xref>). These findings indicate that H<sub>2</sub>O<sub>2</sub> exposure in NRK cells mimics MI-related renal injury, whereas exogenous rhIGF-1 or AICAR enhances IGF-1 signalling and activates the downstream PI3K/AKT pathway, thereby attenuating H<sub>2</sub>O<sub>2</sub>-induced inflammation and cellular damage.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Effects of ALCAR and rhIGF-1 on PI3K/AKT pathway activation and inflammation in H<sub>2</sub>O<sub>2</sub>-treated NRK cells. <bold>(A,B)</bold> Protein levels of p-PI3K, p-AKT, Cleaved Caspase-3, and IL-6 after AICAR &#xb1; rhIGF-1 treatment. Data are presented as mean &#xb1; SD. n &#x3d; 4 wells per group. Each experiment was repeated at least four times independently. &#x2a; <italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a; <italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a; <italic>p</italic> &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g006.tif">
<alt-text content-type="machine-generated">Western blot and bar graph analysis showing the effects of treatments on protein levels. Panel A displays Western blot results for p-PI3K, GAPDH, p-AKT, C-Caspase-3, IL-6, and &#x3B2;-tubulin under different conditions: H&#x2082;O&#x2082;, ALCAR, and rhIGF-1. Panel B presents quantified bar graphs comparing protein levels of p-PI3K, p-AKT, C-Caspase-3, and IL-6 normalized to GAPDH or &#x3B2;-tubulin, with significant differences marked by asterisks.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-6">
<label>3.6</label>
<title>Exogenous NVP-AEW541 inhibits PI3K/AKT and exacerbates H<sub>2</sub>O<sub>2</sub>-induced cellular inflammation</title>
<p>In the H<sub>2</sub>O<sub>2</sub> &#x2b; AICAR group, p-PI3K and p-AKT were strongly upregulated, whereas IL-6 and Cleaved Caspase-3 were suppressed (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001). When the IGF-1R inhibitor NVP-AEW541 was added (H<sub>2</sub>O<sub>2</sub> &#x2b; NVP-AEW541), p-PI3K and p-AKT levels fell sharply and IL-6 and Cleaved Caspase-3 rebounded (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F7">Figure 7</xref>). Thus, the cytoprotective effect of AICAR, which mimics exercise, depends largely on IGF-1R-mediated activation of the PI3K/AKT pathway to exert anti-inflammatory actions.</p>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption>
<p>Influence of IGF-1R inhibition on AICAR-mediated effects in H<sub>2</sub>O<sub>2</sub>-treated NRK cells. <bold>(A,B)</bold> p-PI3K, p-AKT, Cleaved Caspase-3, and IL-6 expression after AICAR &#xb1; NVP-AEW541 treatment. Data are presented as mean &#xb1; SD. n &#x3d; 4 wells per group. Each experiment was repeated at least four times independently. &#x2a; <italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a; <italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a; <italic>p</italic> &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g007.tif">
<alt-text content-type="machine-generated">Panel A shows a Western blot analysis displaying protein expression of p-PI3K, p-AKT, C-Caspase-3, and IL-6, with loading controls GAPDH and &#x3B2;-tubulin. The samples are treated with different combinations of H&#x2082;O&#x2082;, AICAR, and NVP-AEW541. Panel B presents bar graphs quantifying the protein levels of p-PI3K, p-AKT, C-Caspase-3, and IL-6 relative to controls, with significant differences indicated.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-7">
<label>3.7</label>
<title>Exogenous LY294002 blocks PI3K/AKT and worsens H<sub>2</sub>O<sub>2</sub>-induced cellular inflammation</title>
<p>The H<sub>2</sub>O<sub>2</sub> group suppressed p-IGF-1R and p-AKT while elevating IL-6 and Cleaved Caspase-3 (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001). In contrast, the H<sub>2</sub>O<sub>2</sub> &#x2b; AICAR group significantly increased p-IGF-1R and p-AKT and reduced IL-6 and Cleaved Caspase-3 (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001). When PI3K was blocked with LY294002 (H<sub>2</sub>O<sub>2</sub> &#x2b; LY294002), activation of p-AKT was impeded, IL-6 and Cleaved Caspase-3 rebounded, and p-IGF-1R was likewise suppressed (<italic>p</italic> &#x3c; 0.01 or <italic>p</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F8">Figure 8</xref>). These results demonstrate that the PI3K/AKT pathway is indispensable for IGF-1-mediated anti-inflammatory protection in renal cells.</p>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption>
<p>Effect of PI3K inhibition on AICAR-induced signaling changes in H<sub>2</sub>O<sub>2</sub>-treated NRK cells. <bold>(A,B)</bold> p-IGF-1R, p-AKT, Cleaved Caspase-3, and IL-6 protein expression following AICAR &#xb1; LY294002 treatment. Data are presented as mean &#xb1; SD. n &#x3d; 4 wells per group. Each experiment was repeated at least four times independently. &#x2a; <italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a; <italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a; <italic>p</italic>&#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g008.tif">
<alt-text content-type="machine-generated">Western blot and bar graph data displaying protein expression levels. Part A shows Western blots analyzing p-IGF-1R, p-AKT, C-Caspase-3, and IL-6. Part B presents bar graphs for p-IGF-1R/GAPDH, p-AKT/GAPDH, C-Caspase-3/&#x3B2;-tubulin, and IL-6/&#x3B2;-tubulin ratios. Conditions include controls and treatments with H&#x2082;O&#x2082;, AICAR, and LY294002. Statistical significance is indicated by asterisks.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<label>4</label>
<title>Discussion</title>
<p>The kidney plays a central role in metabolism and waste removal, and its health is vital to the maintenance of overall physiological stability. Clinical and experimental findings have shown that ischemia/reperfusion injury, oxidative stress, and inflammation can rapidly induce both structural and functional damage to renal tissue. MI often leads to secondary kidney impairment, presenting either as acute cardiogenic injury caused by hypoperfusion or as chronic congestive nephropathy resulting from persistent hypoxia; these conditions are collectively recognized as CRS (<xref ref-type="bibr" rid="B26">Rangaswami et al., 2019</xref>; <xref ref-type="bibr" rid="B34">Young and Eknoyan, 2024</xref>; <xref ref-type="bibr" rid="B35">Zannad and Rossignol, 2018</xref>). In clinical settings, this often manifests as edema, which elevates cardiac preload and sustains the detrimental cycle of heart&#x2013;kidney dysfunction (<xref ref-type="bibr" rid="B27">Schefold et al., 2016</xref>).</p>
<p>In this study, we employed a mouse model of acute MI combined with a program of intermittent exercise to evaluate whether physical training could counteract MI-induced kidney injury. We further investigated potential mechanisms by assessing the activation status of the renal IGF-1/IGF-1R/PI3K/AKT pathway, alongside markers of oxidative stress, inflammation, and apoptosis.</p>
<p>After MI, reduced cardiac output leads to inadequate systemic perfusion, causing structural and functional injury in peripheral organs, with the kidney particularly affected. Contributing factors include reduced renal blood flow, heightened sympathetic activation, and excessive stimulation of the RAAS, all of which promote tubular hypoxia and cellular damage, ultimately resulting in cardiogenic acute kidney injury (<xref ref-type="bibr" rid="B34">Young and Eknoyan, 2024</xref>; <xref ref-type="bibr" rid="B35">Zannad and Rossignol, 2018</xref>). In our model, MI mice exhibited significant cardiac dysfunction and biochemical signs of renal oxidative stress. Four weeks of intermittent exercise training reversed these changes, improving EF and FS, restoring ventricular dimensions, reducing BUN levels, increasing SOD activity, and lowering MDA concentrations. These results are consistent with previous findings demonstrating that exercise regulates oxidative balance, thereby exerting protective effects on renal function in diverse pathological conditions (<xref ref-type="bibr" rid="B31">Watson et al., 2022</xref>).</p>
<p>Renal tubular epithelial cells, essential for glomerular filtration and solute reabsorption, are highly sensitive to oxidative stress, inflammation, and apoptosis during MI-induced injury (<xref ref-type="bibr" rid="B37">Zhao et al., 2021</xref>). IGF-1, a multifunctional myokine secreted by numerous tissues, plays a key role in cellular protection. In the kidney, IGF-1 binding to its receptor (IGF-1R) activates the PI3K/AKT pathway, thereby counteracting oxidative damage and suppressing apoptotic signaling (<xref ref-type="bibr" rid="B15">Kamenick&#xfd; et al., 2014</xref>; <xref ref-type="bibr" rid="B16">Khan et al., 2025</xref>). Exercise combined with IGF-1 has been shown to reduce Sirt1 expression, thereby alleviating cellular senescence and attenuating myocardial injury (<xref ref-type="bibr" rid="B24">Meng et al., 2021</xref>). In our study, MI reduced IGF-1 expression, downregulated PI3K/AKT/FOXO3a activity, and diminished Sirt1 levels, while simultaneously elevating markers of oxidative stress, pro-inflammatory cytokines, and apoptotic proteins. Intermittent exercise restored IGF-1 and IGF-1R expression, enhanced PI3K/AKT signaling, increased FOXO3a phosphorylation, upregulated Sirt1 expression, and attenuated oxidative, inflammatory, and apoptotic responses, which is consistent with previous findings that exercise-induced IGF-1 upregulation mitigates multi-organ injury (<xref ref-type="bibr" rid="B6">Cui et al., 2020</xref>; <xref ref-type="bibr" rid="B14">Iba&#xf1;ez et al., 2025</xref>).</p>
<p>The IGF-1/IGF-1R/PI3K/AKT pathway is widely recognized as a major regulator of cell growth, differentiation, antioxidant defense, and anti-apoptotic responses, making it a key mediator in tissue repair (<xref ref-type="bibr" rid="B33">Ye et al., 2024</xref>; <xref ref-type="bibr" rid="B5">Cui and He, 2022</xref>). In this work, intermittent exercise not only reactivated this signaling cascade but also reduced inflammatory mediators, oxidative stress, and apoptotic markers, while lowering KIM-1 expression, indicating less renal injury. This study used group-based VO<sub>2max</sub> reference values to determine exercise intensity, which may not reflect individual physiological variation. In addition, total protein levels were used as proxies for pathway activation due to limited tissue availability, and future studies should incorporate phosphorylated protein assessment for confirmation.</p>
<p>Overall, our findings demonstrate that intermittent exercise alleviates MI-associated kidney damage through IGF-1/IGF-1R/PI3K/AKT pathway activation and the suppression of pathological oxidative, inflammatory, and apoptotic processes. These results provide mechanistic insight into the benefits of exercise for preserving kidney function after MI and support the translation of targeted exercise prescriptions into clinical practice for patients at risk of cardiorenal syndrome. Despite these promising findings, limitations include the use of total rather than phosphorylated protein analysis, the absence of individual VO<sub>2max</sub> testing, and lack of long-term follow-up. Future studies should address these issues to strengthen translational relevance.</p>
</sec>
<sec sec-type="conclusion" id="s5">
<label>5</label>
<title>Conclusion</title>
<p>Myocardial infarction triggers renal oxidative stress, inflammation and apoptosis, culminating in functional impairment. Intermittent exercise attenuates these pathological changes, an effect closely associated with upregulation of renal IGF-1 and activation of the IGF-1R/PI3K/AKT signalling axis. Activation of this pathway suppresses pro-inflammatory cytokine release, lowers oxidative-stress levels and inhibits apoptosis, thereby preserving renal structure and function (<xref ref-type="fig" rid="F9">Figure 9</xref>). These findings identify IGF-1 as a pivotal molecular target through which intermittent exercise mitigates MI-induced secondary kidney injury, offering new theoretical insight and potential therapeutic avenues for the management of cardiorenal syndrome.</p>
<fig id="F9" position="float">
<label>FIGURE 9</label>
<caption>
<p>Proposed mechanistic model.</p>
</caption>
<graphic xlink:href="fphys-16-1733425-g009.tif">
<alt-text content-type="machine-generated">Flowchart depicting the effect of exercise on myocardial infarction through the heart-kidney axis. Exercise induces IGF-1, which interacts with IGF-1R, activating PI3K and AKT. This reduces inflammation and apoptosis, leading to renal protection.</alt-text>
</graphic>
</fig>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s6">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec sec-type="ethics-statement" id="s7">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used. The animal study was approved by All procedures conformed to the Guide for the Care and Use of Laboratory Animals (8th&#x202f;ed., ISBN-10:&#x202f;0-309-15396-4) and were approved by the Animal Ethics Committee of Shaanxi Normal University. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s8">
<title>Author contributions</title>
<p>WZ: Writing &#x2013; original draft, Methodology, Data curation, Visualization, Investigation, Conceptualization. WB: Validation, Supervision, Writing &#x2013; review and editing. YM: Investigation, Project administration, Software, Writing &#x2013; review and editing.</p>
</sec>
<sec sec-type="COI-statement" id="s10">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s11">
<title>Generative AI statement</title>
<p>The authors declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s12">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1302368/overview">Hong-Bao Li</ext-link>, Xi&#x2019;an Jiaotong University, China</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2198244/overview">Qinqin Lin</ext-link>, Yanshan University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2874313/overview">Dandan Jia</ext-link>, Shanghai University of Sport, China</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bridgewater</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sauro</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Matsell</surname>
<given-names>D. G.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Insulin-like growth factors inhibit podocyte apoptosis through the PI3 kinase pathway</article-title>. <source>Kidney Int.</source> <volume>67</volume> (<issue>4</issue>), <fpage>1308</fpage>&#x2013;<lpage>1314</lpage>. <pub-id pub-id-type="doi">10.1111/j.1523-1755.2005.00208.x</pub-id>
<pub-id pub-id-type="pmid">15780083</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cai</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q. A.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Jia</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Effects of different types of exercise on skeletal muscle atrophy, antioxidant capacity and growth factors expression following myocardial infarction</article-title>. <source>Life Sci.</source> <volume>213</volume>, <fpage>40</fpage>&#x2013;<lpage>49</lpage>. <pub-id pub-id-type="doi">10.1016/j.lfs.2018.10.015</pub-id>
<pub-id pub-id-type="pmid">30312703</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chapuis</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Tamburini</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cornillet-Lefebvre</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Gillot</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Bardet</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Willems</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Autocrine IGF-1/IGF-1R signaling is responsible for constitutive PI3K/Akt activation in acute myeloid leukemia: therapeutic value of neutralizing anti-IGF-1R antibody</article-title>. <source>Haematologica</source> <volume>95</volume> (<issue>3</issue>), <fpage>415</fpage>&#x2013;<lpage>423</lpage>. <pub-id pub-id-type="doi">10.3324/haematol.2009.010785</pub-id>
<pub-id pub-id-type="pmid">20007139</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chow</surname>
<given-names>L. S.</given-names>
</name>
<name>
<surname>Gerszten</surname>
<given-names>R. E.</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Pedersen</surname>
<given-names>B. K.</given-names>
</name>
<name>
<surname>van Praag</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Trappe</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Exerkines in health, resilience and disease</article-title>. <source>Nat. Rev. Endocrinol.</source> <volume>18</volume> (<issue>5</issue>), <fpage>273</fpage>&#x2013;<lpage>289</lpage>. <pub-id pub-id-type="doi">10.1038/s41574-022-00641-2</pub-id>
<pub-id pub-id-type="pmid">35304603</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>IGF-1 ameliorates streptozotocin-induced pancreatic &#x3b2; cell dysfunction and apoptosis via activating IRS1/PI3K/Akt/FOXO1 pathway</article-title>. <source>Inflamm. Res.</source> <volume>71</volume>, <fpage>669</fpage>&#x2013;<lpage>680</lpage>. <pub-id pub-id-type="doi">10.1007/s00011-022-01557-3</pub-id>
<pub-id pub-id-type="pmid">35333936</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>ISLR regulates skeletal muscle atrophy via IGF1-PI3K/Akt-Foxo signaling pathway</article-title>. <source>Cell Tissue Res.</source> <volume>381</volume>, <fpage>479</fpage>&#x2013;<lpage>492</lpage>. <pub-id pub-id-type="doi">10.1007/s00441-020-03251-4</pub-id>
<pub-id pub-id-type="pmid">32696215</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Qian</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Zha</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>IGF-1/IGF-1R blockade ameliorates diabetic kidney disease through normalizing Snail1 expression in a mouse model</article-title>. <source>Am. J. Physiol. Endocrinol. Metab.</source> <volume>317</volume>, <fpage>E686</fpage>&#x2013;<lpage>E698</lpage>. <pub-id pub-id-type="doi">10.1152/ajpendo.00071.2019</pub-id>
<pub-id pub-id-type="pmid">31361542</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elgendy</surname>
<given-names>I. Y.</given-names>
</name>
<name>
<surname>Mahtta</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Pepine</surname>
<given-names>C. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Medical therapy for heart failure caused by ischemic heart disease</article-title>. <source>Circ. Res.</source> <volume>124</volume> (<issue>11</issue>), <fpage>1520</fpage>&#x2013;<lpage>1535</lpage>. <pub-id pub-id-type="doi">10.1161/CIRCRESAHA.118.313568</pub-id>
<pub-id pub-id-type="pmid">31120824</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>The role of insulin-like growth factor-1 in bone remodeling: a review</article-title>. <source>Int. J. Biol. Macromol.</source> <volume>238</volume>, <fpage>124125</fpage>. <pub-id pub-id-type="doi">10.1016/j.ijbiomac.2023.124125</pub-id>
<pub-id pub-id-type="pmid">36948334</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Xi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Aerobic exercise and resistance exercise alleviate skeletal muscle atrophy through IGF-1/IGF-1R-PI3K/Akt pathway in mice with myocardial infarction</article-title>. <source>Am. J. Physiol. Cell Physiol.</source> <volume>322</volume>, <fpage>C164</fpage>&#x2013;<lpage>C176</lpage>. <pub-id pub-id-type="doi">10.1152/ajpcell.00344.2021</pub-id>
<pub-id pub-id-type="pmid">34852207</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zucker</surname>
<given-names>I. H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Skeletal muscle Nrf2 contributes to exercise-evoked systemic antioxidant defense via extracellular vesicular communication</article-title>. <source>Exerc Sport Sci. Rev.</source> <volume>49</volume>, <fpage>213</fpage>&#x2013;<lpage>222</lpage>. <pub-id pub-id-type="doi">10.1249/jes.0000000000000257</pub-id>
<pub-id pub-id-type="pmid">33927165</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Higashi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Sukhanov</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Anwar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Shai</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Delafontaine</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>IGF-1, oxidative stress and atheroprotection</article-title>. <source>Trends Endocrinol. Metab.</source> <volume>21</volume> (<issue>4</issue>), <fpage>245</fpage>&#x2013;<lpage>254</lpage>. <pub-id pub-id-type="doi">10.1016/j.tem.2009.12.005</pub-id>
<pub-id pub-id-type="pmid">20071192</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Leng</surname>
<given-names>L. U.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>X. U.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Comparative effects of different exercise types on cardiovascular health and executive function in sedentary young individuals</article-title>. <source>Med. Sci. Sports Exerc</source> <volume>57</volume> (<issue>6</issue>), <fpage>1110</fpage>&#x2013;<lpage>1122</lpage>. <pub-id pub-id-type="doi">10.1249/MSS.0000000000003645</pub-id>
<pub-id pub-id-type="pmid">39780353</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Iba&#xf1;ez</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Godoy Coto</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mart&#xed;nez</surname>
<given-names>V. R.</given-names>
</name>
<name>
<surname>Del Milagro Yeves</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Dolcetti</surname>
<given-names>F. J. C.</given-names>
</name>
<name>
<surname>Cervellini</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Cardioprotection and neurobehavioral impact of swimming training in ovariectomized rats</article-title>. <source>Geroscience</source> <volume>47</volume>, <fpage>2317</fpage>&#x2013;<lpage>2334</lpage>. <pub-id pub-id-type="doi">10.1007/s11357-024-01422-7</pub-id>
<pub-id pub-id-type="pmid">39527177</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kamenick&#xfd;</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Mazziotti</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Lomb&#xe8;s</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Giustina</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Chanson</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Growth hormone, insulin-like growth factor-1, and the kidney: pathophysiological and clinical implications</article-title>. <source>Endocr. Rev.</source> <volume>35</volume>, <fpage>234</fpage>&#x2013;<lpage>281</lpage>. <pub-id pub-id-type="doi">10.1210/er.2013-1071</pub-id>
<pub-id pub-id-type="pmid">24423979</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname>
<given-names>M. Z.</given-names>
</name>
<name>
<surname>Zugaza</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Torres Aleman</surname>
<given-names>I.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>The signaling landscape of insulin-like growth factor 1</article-title>. <source>J. Biol. Chem.</source> <volume>301</volume> (<issue>1</issue>), <fpage>108047</fpage>. <pub-id pub-id-type="doi">10.1016/j.jbc.2024.108047</pub-id>
<pub-id pub-id-type="pmid">39638246</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khetarpal</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Lerchenm&#xfc;ller</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Rhee</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Rosenzweig</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Molecular mediators of the cardiac benefits of exercise</article-title>. <source>Circ. Res.</source> <volume>137</volume>, <fpage>163</fpage>&#x2013;<lpage>183</lpage>. <pub-id pub-id-type="doi">10.1161/CIRCRESAHA.125.325762</pub-id>
<pub-id pub-id-type="pmid">40608861</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kouidi</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Hanssen</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Anding-Rost</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Cupisti</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Deligiannis</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Grupp</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>The role of exercise training on cardiovascular risk factors and heart disease in patients with chronic kidney disease G3-G5 and G5D: a clinical consensus statement of the european association of preventive cardiology of the ESC and the european association of rehabilitation in chronic kidney disease</article-title>. <source>Eur. J. Prev. Cardiol.</source> <volume>31</volume>, <fpage>1493</fpage>&#x2013;<lpage>1515</lpage>. <pub-id pub-id-type="doi">10.1093/eurjpc/zwae130</pub-id>
<pub-id pub-id-type="pmid">38593202</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname>
<given-names>W. S.</given-names>
</name>
<name>
<surname>Abel</surname>
<given-names>E. D.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>New insights into IGF-1 signaling in the heart</article-title>. <source>Physiology</source> <volume>39</volume> (<issue>5</issue>), <fpage>0</fpage>. <pub-id pub-id-type="doi">10.1152/physiol.00003.2024</pub-id>
<pub-id pub-id-type="pmid">38713091</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Effects of different modes of exercise on skeletal muscle mass and function and IGF-1 signaling during early aging in mice</article-title>. <source>J. Exp. Biol.</source> <volume>225</volume>, <fpage>jeb244650</fpage>. <pub-id pub-id-type="doi">10.1242/jeb.244650</pub-id>
<pub-id pub-id-type="pmid">36205111</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liao</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Insulin-like growth factor-1 activates PI3K/Akt signalling to protect human retinal pigment epithelial cells from amiodarone-induced oxidative injury</article-title>. <source>Br. J. Pharmacol.</source> <volume>175</volume> (<issue>1</issue>), <fpage>125</fpage>&#x2013;<lpage>139</lpage>. <pub-id pub-id-type="doi">10.1111/bph.14078</pub-id>
<pub-id pub-id-type="pmid">29057462</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martinez</surname>
<given-names>M. W.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Shah</surname>
<given-names>A. B.</given-names>
</name>
<name>
<surname>Phelan</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Emery</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Wasfy</surname>
<given-names>M. M.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Exercise-induced cardiovascular adaptations and approach to exercise and cardiovascular disease: JACC state-of-the-art review</article-title>. <source>J. Am. Coll. Cardiol.</source> <volume>78</volume> (<issue>14</issue>), <fpage>1453</fpage>&#x2013;<lpage>1470</lpage>. <pub-id pub-id-type="doi">10.1016/j.jacc.2021.08.003</pub-id>
<pub-id pub-id-type="pmid">34593128</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>McCallum</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Sarnak</surname>
<given-names>M. J.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Cardiorenal syndrome in the hospital</article-title>. <source>Clin. J. Am. Soc. Nephrol.</source> <volume>18</volume> (<issue>7</issue>), <fpage>933</fpage>&#x2013;<lpage>945</lpage>. <pub-id pub-id-type="doi">10.2215/CJN.0000000000000064</pub-id>
<pub-id pub-id-type="pmid">36787124</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meng</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hei</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>PI3K/AKT activation attenuates acute kidney injury following liver transplantation by inducing FoxO3a nuclear export and deacetylation</article-title>. <source>Life Sci.</source> <volume>272</volume>, <fpage>119119</fpage>. <pub-id pub-id-type="doi">10.1016/j.lfs.2021.119119</pub-id>
<pub-id pub-id-type="pmid">33508296</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mohebinejad</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kazeminasab</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Ghanbari Rad</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bagheri</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Razi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Willoughby</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>The combined effect of high-intensity interval training and time-restricted feeding on the Akt-IGF-1-mTOR signaling pathway in the muscle tissue of type 2 diabetic rats</article-title>. <source>Nutrients</source> <volume>17</volume> (<issue>9</issue>), <fpage>1404</fpage>. <pub-id pub-id-type="doi">10.3390/nu17091404</pub-id>
<pub-id pub-id-type="pmid">40362714</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rangaswami</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Bhalla</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Blair</surname>
<given-names>J. E. A.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>T. I.</given-names>
</name>
<name>
<surname>Costa</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lentine</surname>
<given-names>K. L.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Cardiorenal syndrome: classification, pathophysiology, diagnosis, and treatment strategies: a scientific statement from the American heart association</article-title>. <source>Circulation</source> <volume>139</volume> (<issue>16</issue>), <fpage>e840</fpage>&#x2013;<lpage>e878</lpage>. <pub-id pub-id-type="doi">10.1161/CIR.0000000000000664</pub-id>
<pub-id pub-id-type="pmid">30852913</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schefold</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Filippatos</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Hasenfuss</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Anker</surname>
<given-names>S. D.</given-names>
</name>
<name>
<surname>von Haehling</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Heart failure and kidney dysfunction: epidemiology, mechanisms and management</article-title>. <source>Nat. Rev. Nephrol.</source> <volume>12</volume> (<issue>10</issue>), <fpage>610</fpage>&#x2013;<lpage>623</lpage>. <pub-id pub-id-type="doi">10.1038/nrneph.2016.113</pub-id>
<pub-id pub-id-type="pmid">27573728</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sprick</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Mammino</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Jeong</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>DaCosta</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Morison</surname>
<given-names>D. G.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Aerobic exercise training improves endothelial function and attenuates blood pressure reactivity during maximal exercise in chronic kidney disease</article-title>. <source>J. Appl. Physiol.</source> <volume>132</volume>, <fpage>785</fpage>&#x2013;<lpage>793</lpage>. <pub-id pub-id-type="doi">10.1152/japplphysiol.00808.2021</pub-id>
<pub-id pub-id-type="pmid">35142559</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vinciguerra</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Santini</surname>
<given-names>M. P.</given-names>
</name>
<name>
<surname>Martinez</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Pazienza</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Claycomb</surname>
<given-names>W. C.</given-names>
</name>
<name>
<surname>Giuliani</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>mIGF-1/JNK1/SirT1 signaling confers protection against oxidative stress in the heart</article-title>. <source>Aging Cell</source> <volume>11</volume>, <fpage>139</fpage>&#x2013;<lpage>149</lpage>. <pub-id pub-id-type="doi">10.1111/j.1474-9726.2011.00766.x</pub-id>
<pub-id pub-id-type="pmid">22051242</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>IGF-1R inhibition induces MEK phosphorylation to promote survival in colon carcinomas</article-title>. <source>Signal Transduct. Target Ther.</source> <volume>5</volume> (<issue>1</issue>), <fpage>153</fpage>. <pub-id pub-id-type="doi">10.1038/s41392-020-0204-0</pub-id>
<pub-id pub-id-type="pmid">32843616</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Watson</surname>
<given-names>E. L.</given-names>
</name>
<name>
<surname>Baker</surname>
<given-names>L. A.</given-names>
</name>
<name>
<surname>Wilkinson</surname>
<given-names>T. J.</given-names>
</name>
<name>
<surname>Gould</surname>
<given-names>D. W.</given-names>
</name>
<name>
<surname>Xenophontos</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Graham-Brown</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Inflammation and physical dysfunction: responses to moderate intensity exercise in chronic kidney disease</article-title>. <source>Nephrol. Dial. Transpl.</source> <volume>37</volume> (<issue>5</issue>), <fpage>860</fpage>&#x2013;<lpage>868</lpage>. <pub-id pub-id-type="doi">10.1093/ndt/gfab333</pub-id>
<pub-id pub-id-type="pmid">35090033</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Xi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Aerobic exercise alleviates oxidative stress-induced apoptosis in kidneys of myocardial infarction mice by inhibiting ALCAT1 and activating FNDC5/irisin signaling pathway</article-title>. <source>Free Radic. Biol. Med.</source> <volume>158</volume>, <fpage>171</fpage>&#x2013;<lpage>180</lpage>. <pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2020.06.038</pub-id>
<pub-id pub-id-type="pmid">32726688</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ye</surname>
<given-names>Y. L.</given-names>
</name>
<name>
<surname>Kuai</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Qian</surname>
<given-names>D. D.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Y. T.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>K. F.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>GLP-2 ameliorates D-galactose induced muscle aging by IGF-1/PI3K/Akt/FoxO3a signaling pathway in C2C12 cells and mice</article-title>. <source>Arch. Gerontol. Geriatr.</source> <volume>124</volume>, <fpage>105462</fpage>. <pub-id pub-id-type="doi">10.1016/j.archger.2024.105462</pub-id>
<pub-id pub-id-type="pmid">38692155</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Young</surname>
<given-names>J. B.</given-names>
</name>
<name>
<surname>Eknoyan</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Cardiorenal syndrome: an evolutionary appraisal</article-title>. <source>Circ. Heart Fail</source> <volume>17</volume> (<issue>6</issue>), <fpage>e011510</fpage>. <pub-id pub-id-type="doi">10.1161/CIRCHEARTFAILURE.123.011510</pub-id>
<pub-id pub-id-type="pmid">38757274</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zannad</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Rossignol</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Cardiorenal syndrome revisited</article-title>. <source>Circulation</source> <volume>138</volume>, <fpage>929</fpage>&#x2013;<lpage>944</lpage>. <pub-id pub-id-type="doi">10.1161/CIRCULATIONAHA.117.028814</pub-id>
<pub-id pub-id-type="pmid">30354446</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zeng</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ruan</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Thyroid hormone mediates cardioprotection against postinfarction remodeling and dysfunction through the IGF-1/PI3K/AKT signaling pathway</article-title>. <source>Life Sci.</source> <volume>267</volume>, <fpage>118977</fpage>. <pub-id pub-id-type="doi">10.1016/j.lfs.2020.118977</pub-id>
<pub-id pub-id-type="pmid">33383053</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Circulating exosomal miR-1-3p from rats with myocardial infarction plays a protective effect on contrast-induced nephropathy <italic>via</italic> targeting ATG13 and activating the AKT signaling pathway</article-title>. <source>Int. J. Biol. Sci.</source> <volume>17</volume>, <fpage>972</fpage>&#x2013;<lpage>985</lpage>. <pub-id pub-id-type="doi">10.7150/ijbs.55887</pub-id>
<pub-id pub-id-type="pmid">33867822</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</article>