<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Physiol.</journal-id>
<journal-title>Frontiers in Physiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Physiol.</abbrev-journal-title>
<issn pub-type="epub">1664-042X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1647275</article-id>
<article-id pub-id-type="doi">10.3389/fphys.2025.1647275</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Physiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Integrated bioinformatic analysis reveals the underlying mitochondria-associated endoplasmic reticulum membranes-related biomarkers for atrial fibrillation</article-title>
<alt-title alt-title-type="left-running-head">Wang et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphys.2025.1647275">10.3389/fphys.2025.1647275</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Youcheng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Song</surname>
<given-names>Mengyang</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Huanting</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Fang</surname>
<given-names>Sini</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lei</surname>
<given-names>Yumeng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1979477/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Jiulin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Jiayuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Ke</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mao</surname>
<given-names>Ying</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Yan</surname>
<given-names>Liqiu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1185213/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Cardiology, The Affiliated Dongguan Songshan Lake Central Hospital, Guangdong Medical University</institution>, <addr-line>Dongguan</addr-line>, <addr-line>Guangdong</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Dongguan Key Laboratory of Cardiovascular Aging and Myocardial Regeneration, Dongguan Cardiovascular Research Institute</institution>, <addr-line>Dongguan</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>School of Medicine, Wuhan University of Science and Technology</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1339381/overview">Yang Yang</ext-link>, First Affiliated Hospital of Zhengzhou University, China</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1555542/overview">Shengshan Xu</ext-link>, Jiangmen Central Hospital, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1773140/overview">Zheng Liu</ext-link>, Xiangtan Central Hospital, China</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Liqiu Yan, <email>yanliqiu110@163.com</email>
</corresp>
<fn fn-type="equal" id="fn001">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>09</day>
<month>09</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1647275</elocation-id>
<history>
<date date-type="received">
<day>15</day>
<month>06</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>28</day>
<month>08</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Wang, Song, Liu, Fang, Lei, Liu, Zhang, Zhang, Mao and Yan.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Wang, Song, Liu, Fang, Lei, Liu, Zhang, Zhang, Mao and Yan</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Purpose</title>
<p>To provide novel insights into the diagnosis of atrial fibrillation (AF), we aimed to identify mitochondria-associated endoplasmic reticulum membranes (MAMs)-related biomarkers for AF.</p>
</sec>
<sec>
<title>Methods</title>
<p>The training and validation datasets of AF were sourced from the Gene Expression Omnibus (GEO) database. A comprehensive analysis was conducted to identify MAM-related biomarkers, including support vector machine-recursive feature elimination (SVM-RFE) and differentially expressed analysis. Moreover, causal effects of biomarkers on AF were assessed through the two-sample Mendelian randomization (MR) analysis. Functional enrichment, immune infiltration, and single-cell analyses were conducted to investigate the possible mechanisms of biomarkers regulating AF. Finally, the expression of biomarkers was validated at the mRNA and protein levels by developing an <italic>in-vivo</italic> canine AF model.</p>
</sec>
<sec>
<title>Results</title>
<p>Through the comprehensive analysis, TP53, HLA-G, and MAPKAPK5 were identified, which were highly expressed in atrial tissues of AF samples. Notably, MAPKAPK5 was a risk factor for occurrence of AF (<italic>P</italic> &#x3d; 0.022, OR &#x3d; 1.065, 95%CI &#x3d; 1.009&#x2013;1.125). Enrichment analysis revealed that three biomarkers were associated with immune-related pathways. Immune infiltration further demonstrated that a total of infiltration abundance of 18 immune cells was significantly different between AF and controls, and all biomarkers had marked positive associations with these immune cells. Moreover, at the cellular level, the expression of TP53 and MAPKAPK5 was markedly different in lymphoid cells and neutrophils between AF and controls. At the experimental levels, the expression of three biomarkers was significantly higher in the AF model than that in the control model, consistent with the bioinformatics results.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>We identified three potential MAMs-related biomarkers (TP53, HLA-G, and MAPKAPK5) for AF, thereby providing novel insights for the prevention and treatment of AF.</p>
</sec>
</abstract>
<kwd-group>
<kwd>atrial fibrillation</kwd>
<kwd>mitochondria-associated endoplasmic reticulum membranes</kwd>
<kwd>biomarker</kwd>
<kwd>immune infiltration</kwd>
<kwd>bioinformactics analysis</kwd>
</kwd-group>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Computational Physiology and Medicine</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>Atrial fibrillation (AF) is one of the most prevalent arrhythmias, accounting for approximately one-third of all hospitalizations due to arrhythmias. Epidemiological studies indicate that the global prevalence of AF ranges from 1% to 2%, increasing gradually with age (<xref ref-type="bibr" rid="B3">Brundel et al., 2022</xref>). AF can lead to reduced cardiac and cognitive function, and an elevated risk of stroke and other thromboembolic events, all of which substantially contribute to increased mortality and disability rates. Clinically, most AF patients progress from initial paroxysmal to persistent AF, and ultimately to permanent AF (<xref ref-type="bibr" rid="B11">de Vos et al., 2010</xref>). The underlying pathophysiological mechanisms are complex and remain incompletely understood. Despite various available treatments, including pharmacotherapy, catheter ablation, and surgical interventions, the outcomes are often unsatisfactory, particularly in patients with persistent atrial fibrillation, who exhibit a high long-term recurrence rate (<xref ref-type="bibr" rid="B2">Bosch et al., 2018</xref>). Therefore, further elucidation of the pathogenesis of AF is essential for enhancing early diagnosis and developing personalized treatment strategies for affected patients.</p>
<p>The mitochondria-associated endoplasmic reticulum membranes (MAMs) are a dynamic membrane structure formed between the endoplasmic reticulum (ER) and the mitochondrial membranes through a series of protein connections. This structure serves not only as a physical contact point between the two organelles but also as a platform for material exchange and signal transmission, participating in various physiological and pathological processes such as lipid metabolism, calcium signaling pathways, apoptosis, and autophagy in cells (<xref ref-type="bibr" rid="B40">Luan et al., 2021</xref>; <xref ref-type="bibr" rid="B41">Luan et al., 2022</xref>). In recent years, emerging evidence has indicated that MAMs-related proteins play significant roles in various cardiovascular diseases. FUNDC1, a mitogenic receptor, is enriched at the contact sites between mitochondria and the ER, facilitating the formation of MAMs, thereby modulating cytosolic Ca<sup>2&#x2b;</sup> homeostasis and mitochondrial dynamics, and averting cardiac dysfunction (<xref ref-type="bibr" rid="B35">Li et al., 2021</xref>). SUMOylation of Drp1 (a dynamin-related GTPase that critically mediates fission) enhances mitochondrial autophagy during reperfusion, thereby preventing reactive oxygen species (ROS), myocardial apoptosis, and myocardial injury (<xref ref-type="bibr" rid="B60">Tong et al., 2020</xref>). However, little research has yet addressed the relationship between MAMs and AF.</p>
<p>Mendelian randomization (MR) has arisen as a robust analytical method for deducing causal links between exposures and outcomes by utilizing genetic variants as instrumental variables, a design that is less prone to confounding and reverse causation biases. This methodology signifies a progressive advancement in causal inference, enhancing observational studies&#x2014;such as those employing extensive databases with weighted regression, subgroup analyses, and multivariate adjustments&#x2014;that initially discern potential associations and establish the foundation for causal hypotheses (<xref ref-type="bibr" rid="B20">Guo et al., 2024b</xref>). Observational studies function as essential preliminary frameworks by identifying potential links, whereas MR serves as a rigorous subsequent tool to confirm causality, addressing challenges such as residual confounding and reverse causation that sometimes obscure observational results. This methodological advancement has been extensively utilized to analyze causative relationships in intricate disorders, demonstrating efficacy in clarifying disease mechanisms (<xref ref-type="bibr" rid="B18">Guo and He, 2024</xref>; <xref ref-type="bibr" rid="B70">Xu et al., 2025b</xref>). Building on such methodological advancements, this study aims to investigate the connection between MAMs-related genes (MAMRGs) and AF through bioinformatics analysis, as well as to assess the causal relationship between these genes and the onset of AF using MR analysis, thereby strengthening the rationale. Additionally, we conduct functional enrichment analysis, immune infiltration analysis, drug prediction, and single-cell analysis to preliminarily explore the potential functional pathways and pathogenesis associated with these biomarkers. This comprehensive approach aims to enhance our understanding of the molecular mechanisms underlying AF and provide new insights into its clinical diagnosis and treatment.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Data acquisition and preprocessing</title>
<p>Gene expression datasets (GSE14975, GSE41177, and GSE79768) for AF were retrieved from the Gene Expression Omnibus (GEO) database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</ext-link>). The transcriptional profiling in GSE14975 (Platform: GPL570) comprises left atrial myocardium from 5 AF patients and 5 matched samples of patients in sinus rhythm (controls) (<xref ref-type="bibr" rid="B1">Adam et al., 2010</xref>). GSE41177 (Platform: GPL570) consists of 19 left atrial appendage samples from 16 AF patients and 3 controls (<xref ref-type="bibr" rid="B74">Yeh et al., 2013</xref>). These two datasets were merged (the clinical information of these two datasets was displayed in <xref ref-type="sec" rid="s12">Supplementary Table 1</xref>), yielding a training set of 21 AF cases and 8 controls, after which the &#x201c;sva&#x201d; package (<xref ref-type="bibr" rid="B34">Leek et al., 2012</xref>) was employed to eliminate batch effects, hence ensuring data uniformity. GSE79768 (Platform: GPL570) was the validation set in this study, which included 13 left atrial samples from 7 AF patients and 6 controls (<xref ref-type="bibr" rid="B61">Tsai et al., 2016</xref>). Besides, a total of 68 mitochondria-associated ER membrane-related genes (MAMRGs) were extracted from the early research (<xref ref-type="bibr" rid="B36">Li H. M. et al., 2024</xref>).</p>
</sec>
<sec id="s2-2">
<title>Identification of AF-related and MAMs-related genes in AF (AF-MAMRGs)</title>
<p>To identify AF-related genes, the &#x201c;limma&#x201d; R package (version 3.54.0) was employed to discover the differentially expressed genes (DEGs) between AF and controls in the training set (<xref ref-type="bibr" rid="B53">Ritchie et al., 2015</xref>). The &#x7c;logFoldChange&#x7c; &#x3e; 1 and adjusted <italic>P</italic>-value &#x3c;0.05 were screening thresholds. Moreover, results were displayed as a volcano plot [using the &#x201c;ggplot&#x201d; R package (version 3.4.1) (<xref ref-type="bibr" rid="B65">Wickham, 2016</xref>)] and a heatmap [using the &#x201c;ComplexHeatmap&#x201d; R package (version 2.14.0) (<xref ref-type="bibr" rid="B17">Gu et al., 2016</xref>)]. Subsequently, AF-MAMRGs were determined through utilizing a Venn diagram to link the AF-related genes and MAMRGs. The STRING database (<ext-link ext-link-type="uri" xlink:href="https://cn.string-db.org/">https://cn.string-db.org/</ext-link>) was applied to construct the protein-protein interaction (PPI) network to explore the direct and indirect associations among the AF-MAMRGs (parameter setting: Low confidence &#x3d; 0.4).</p>
</sec>
<sec id="s2-3">
<title>Functional enrichment analysis</title>
<p>To comprehend the potential biological functions of AF-MRMRGs, the functional enrichment analysis was conducted with the &#x201c;clusterProfiler&#x201d; R package (version 4.2.2), including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses (<italic>P</italic> &#x3c; 0.05) (<xref ref-type="bibr" rid="B66">Wu et al., 2021</xref>). GO analysis comprised three components: Biological Process (BP), Cellular Component (CC), and Molecular Function (MF).</p>
</sec>
<sec id="s2-4">
<title>Identification of MAMs-related biomarkers for AF</title>
<p>The support vector machine-recursive feature elimination (SVM-RFE) is a technique for feature selection that recursively eliminates the least important features using SVM. To evaluate the significance of AF-MRMRGs in the diagnosis of AF, SVM-RFE was first utilized to screen characteristic genes by the &#x201c;e1071&#x201d; R package. Simultaneously, a least absolute shrinkage and selection operator (LASSO) regression model with 10-fold cross-validation was constructed using the glmnet R package (v4.1.7) to enhance confidence in the identified genes (<xref ref-type="bibr" rid="B25">Huang et al., 2024</xref>). After that, the expression of characteristic genes between AF and controls was analyzed in both training and validation sets, which with the significant alterations and consistent expression trends in two sets were denoted as biomarkers for AF.</p>
</sec>
<sec id="s2-5">
<title>Construction and assessment of a nomogram</title>
<p>A nomogram is a graphical tool widely used to predict the probability of a particular outcome based on a set of variables. Therefore, based on the expression levels of the identified biomarkers, a nomogram was developed to predict the probability of AF. Moreover, the calibration curve, receiver operating characteristic (ROC) curve, and decision curve analysis (DCA) curve were plotted to assess the predictive performance of the nomogram.</p>
</sec>
<sec id="s2-6">
<title>Gene set enrichment analysis (GSEA) and gene set variation analysis (GSVA)</title>
<p>The GSEA (<xref ref-type="bibr" rid="B19">Guo et al., 2024a</xref>; <xref ref-type="bibr" rid="B69">Xu et al., 2025a</xref>; <xref ref-type="bibr" rid="B72">Yang et al., 2025</xref>) and GSVA analyses were conducted to investigate the potential mechanisms of biomarkers in the occurrence of AF. For GSEA, the &#x201c;c2. cp.kegg.v7.4. symbols.gmt&#x201d; was extracted from the MSigDB database (<ext-link ext-link-type="uri" xlink:href="https://www.gsea-msigdb.org/gsea/msigdb">https://www.gsea-msigdb.org/gsea/msigdb</ext-link>) as the reference set. The correlations between biomarkers and all genes were calculated, and correlation coefficients were ranked. GSEA was carried out by the &#x201c;clusterProfiler&#x201d; R package (version 4.2.2) with a <italic>P</italic>-value &#x3c;0.05. Additionally, the samples in the training set were categorized into high- and low-expression groups according to the expression of each biomarker. With &#x201c;h.all.v7.4. symbols.gmt&#x201d; downloaded from the MSigDB database as the reference set, the GSVA score of each pathway in two expression groups was calculated by the &#x201c;GSVA&#x201d; R package (<xref ref-type="bibr" rid="B37">Li J. et al., 2024</xref>), and the differences in GSVA scores between the two groups were assessed via the &#x201c;limma&#x201d; R package with &#x7c;t&#x7c; &#x3e; 2 and <italic>P</italic>-value &#x3c;0.05.</p>
</sec>
<sec id="s2-7">
<title>Immune infiltration</title>
<p>Previous studies have demonstrated that the immune system undergoes significant changes during AF and interacts with the environment and cells involved in the initiation and maintenance of AF (<xref ref-type="bibr" rid="B73">Yao et al., 2022</xref>). Consequently, the infiltration abundance of 28 immune cells in AF and controls was evaluated by single-sample gene set enrichment analysis (ssGSEA) (<xref ref-type="bibr" rid="B10">Cui et al., 2025</xref>), and the differences between AF and controls were analyzed via the Wilcoxon test (<italic>P</italic> &#x3c; 0.05). To further explore the correlations between biomarkers and immune infiltration, the Spearman algorithm was applied.</p>
</sec>
<sec id="s2-8">
<title>Prediction of potential drugs for AF treatment</title>
<p>The DGIdb database (<ext-link ext-link-type="uri" xlink:href="https://www.dgidb.org/">https://www.dgidb.org/</ext-link>) (<xref ref-type="bibr" rid="B5">Cannon et al., 2024</xref>) is an online database of drug-gene interactions, with data sourced from multiple drug databases (DrugBank, PharmGKB, ChEMBL), clinical trial databases, and PubMed literature. The potential drugs were predicted for AF using biomarkers as the keywords. To further investigate the specific mechanism, molecular docking was conducted by AutoDock Vina (<xref ref-type="bibr" rid="B13">Eberhardt et al., 2021</xref>). The 3D structures of drugs were downloaded from the PubChem database (SDF file) (<xref ref-type="bibr" rid="B32">Kim et al., 2025</xref>), and the SDF files were transferred into PDB files via Babel GUI(<xref ref-type="bibr" rid="B44">O&#x27;Boyle et al., 2011</xref>). Moreover, the 3D structures of proteins were extracted from the Protein Data Bank Database (<xref ref-type="bibr" rid="B4">Burley et al., 2025</xref>). Finally, the PyMol software (<xref ref-type="bibr" rid="B43">Mooers and Brown, 2021</xref>) was employed to view and visualize the results.</p>
</sec>
<sec id="s2-9">
<title>Collection and analysis of the single-cell RNA sequence (scRNA-seq) data</title>
<p>The scRNA-seq dataset of AF (GSE224959, GPL18573) was also retrieved from the GEO database, collecting left atrial tissue from 7 AF samples and 5 controls (<xref ref-type="bibr" rid="B27">Hulsmans et al., 2023</xref>). The processing of data was performed via the &#x201c;Seurat&#x201d; R package (<xref ref-type="bibr" rid="B54">Satija et al., 2015</xref>) according to the following criteria: (1) cells were removed with less than 200 genes expressed; (2) genes were excluded with less than 3 cells covered; (3) cells were excluded with more than 20% mitochondrial genes; (4) cells were removed with 200 &#x2264; gene numbers &#x2264;3,000; and (5) genes were excluded with 200 &#x2264; count numbers &#x2264;10,000. After identification of the top 2,000 highly variable genes and PCA dimensionality reduction analysis, the cluster analysis was conducted for remaining cells using the FindNeighbors and FindCluster functions (<xref ref-type="bibr" rid="B12">Di et al., 2022</xref>) in the &#x201c;Seurat&#x201d; R package. Subsequently, cell clusters were annotated through comparing the differentially expressed genes of each cluster with the marker genes of each cell type in the CellMarker database (<xref ref-type="bibr" rid="B76">Zhang et al., 2019</xref>). Afterwards, the percentage of each cell type was counted, and the expression of each biomarker in each cell type between AF cases and controls was measured. Moreover, the pseudotime analysis of the cell type where the expression of biomarkers between AF and controls was at significant levels was conducted to investigate the change of biomarker expression during cell differentiation. Finally, to reveal interactions among these cell types, CellPhoneDB (<xref ref-type="bibr" rid="B15">Efremova et al., 2020</xref>) was employed.</p>
</sec>
<sec id="s2-10">
<title>Mendelian randomization (MR) analysis</title>
<p>To further investigate the causal effect of biomarkers on AF, MR analysis was carried out using TwoSampleMR R package (<xref ref-type="bibr" rid="B24">Hemani et al., 2018</xref>). The data of the exposure and outcome were sourced from the IEU OpenGWAS database, including eqtl-a-ENSG00000089022 (MAPKAPK5) (31,470 samples and 15,599 single nucleotide polymorphisms (SNPs)), eqtl-a-ENSG00000141510 (TP53) (31,684 samples and 18,457 SNPs), eqtl-a-ENSG00000204632 (HLA-G) (25,690 samples and 28,777 SNPs), and bbj-a-71 (AF) (36,792 samples (8,180 AF and 28,612 control) and 5,018,048 SNPs). To satisfy the three assumptions of MR analysis, SNPs employed as IVs must meet the following criteria: (1) IVs must be significantly relevant to the exposure with P &#x3c; 5 &#xd7; 10<sup>&#x2212;6</sup>; (2) the SNPs with linkage disequilibrium (LD) were removed (parameter settings: <italic>r</italic>
<sup>2</sup> &#x3d; 0.01, kb &#x3d; 100); (3) the F statistic value was calculated to evaluate the strength of SNPs, and those with F less than 10 were excluded. Afterwards, the two-sample MR analysis was conducted through combining the harmonise_data and mr functions with five methods (Weighted median, MR Egger, Simple mode, Inverse variance weighted (IVW), and Weighted mode), and among these methods, the IVW was the main method. Causal effects were represented by odds ratios (OR) and their 95% confidence intervals (CIs), and statistical significance was defined as <italic>P</italic> less than 0.05. Furthermore, to measure the robustness of results, the sensitivity analysis was conducted through the heterogeneity test, horizontal pleiotropy test, and leave-one-out (LOO) test. The choice between IVW-fixed effects (IVW-FE) and IVW-random effects (IVW-RE) was determined by the presence of heterogeneity. Specifically, IVW-RE was selected when heterogeneity existed, whereas IVW-FE was adopted in the absence of such heterogeneity. The mr_heterogeneity () function was employed to detect heterogeneity. Horizontal pleiotropy was identified using the MR-Egger intercept method: a significant difference between the intercept term of MR-Egger regression and 0 (P &#x3c; 0.05) indicated the existence of horizontal pleiotropy. Additionally, the LOO method was used to evaluate the impact on the MR results after excluding each individual SNP.</p>
</sec>
<sec id="s2-11">
<title>AF model establishing and electrophysiological measurement</title>
<p>The AF model was established by rapid atrial pacing using canines. The sham group received pacemaker implantation procedure under sterile conditions without atrial pacing. The pacing group underwent pacemaker implantation with continuous rapid atrial pacing (450 beats/min) for 2 months before the electrophysiological measurements. All electrophysiological measurements were recorded in a computerized electrophysiology system (Lead 7,000, Jinjiang Inc., China). An S1S1 programmed stimulus method (with cycle length of 120 ms, 100 ms, and 75 ms; 5 s each, performed 3 times per frequency) was used to evaluate AF durations. AF was characterized as an irregular atrial rate exceeding 500 bpm and that lasts for more than 5 s.</p>
<p>All trial protocols were approved by the Laboratory Animal Welfare &#x26; Ethics Committee of Dongguan Songshan Lake Central Hospital. The experiments involving live vertebrates were carried out in strict accordance with the relevant guidelines and regulations. All methods were reported in accordance with ARRIVE guidelines.</p>
</sec>
<sec id="s2-12">
<title>Quantitative real-time polymerase chain reaction (qRT-PCR)</title>
<p>Total RNA was isolated from canine atrial tissue samples utilizing RNA extraction solution (G3013, Saiwei Biotechnology, CN) in accordance with the procedure. Tissue homogenization was conducted using a three-dimensional cryogenic grinder (KZ-5F-3D, Saiwei Biotechnology, CN), followed by purification processes involving chloroform extraction, isopropanol precipitation, and washing with 75% ethanol solution. The purity and concentration of RNA were evaluated using a Nanodrop 2000, and the concentration was standardized to 200 ng/&#x3bc;L cDNA synthesis was performed utilizing SweScript All-in-One RT SuperMix for qPCR (One-Step gDNA Remover, G3337, Saiwei Biotechnology, CN) to reverse transcribe RNA into cDNA, with the reaction protocol established at 25 &#xb0;C for 5 min, 42 &#xb0;C for 30 min, and 85 &#xb0;C for 5 s. The 2&#xd7;Universal Blue SYBR Green qPCR Master Mix (G3326, Saiwei Biotechnology, CN) was utilized for qPCR, with each 15 &#x3bc;L reaction comprising the master mix, primer mixs for HLA-G, TP53, and MAPKAPK5, cDNA template, and nuclease-free water. Primer sequences are presented in <xref ref-type="table" rid="T1">Table 1</xref>. Each sample was run in triplicate. The amplification was performed on a CFX Connect Real-Time PCR System (CFX Connect, Bio-Rad, CN) with the thermal cycling conditions: initial denaturation at 95 &#xb0;C for 30 s, followed by 40 cycles of 95 &#xb0;C for 15 s and 60 &#xb0;C for 30 s, and a melting curve stage from 65 &#xb0;C to 95 &#xb0;C. Relative gene expression levels were calculated using the 2<sup>(&#x2212;&#x394;&#x394;CT)</sup> method.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>The primer sequences of biomarkers.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">Gene</th>
<th align="center">Primer sequences (5&#x2032;-3&#x2032;)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center">GAPDH-S</td>
<td align="center">GGGTGATGCTGGTGCTGAGTAT</td>
</tr>
<tr>
<td align="center">GAPDH-A</td>
<td align="center">TTGCTGACAATCTTGAGGGAGTT</td>
</tr>
<tr>
<td align="center">HLA-G</td>
<td align="center">ACTGCAGAGCACGATAGGAAC</td>
</tr>
<tr>
<td align="center">HLA-G</td>
<td align="center">GATCTCCGCAGGGTAGAAGC</td>
</tr>
<tr>
<td align="center">TP53-S</td>
<td align="center">CTGAGGAGGAGAATTTCCACAAG</td>
</tr>
<tr>
<td align="center">TP53-A</td>
<td align="center">CTTCAGCTCCAAGGCTTCATTC</td>
</tr>
<tr>
<td align="center">MAPKAPK5-S</td>
<td align="center">GAAATCTGGCATCATACCTACCTC</td>
</tr>
<tr>
<td align="center">MAPKAPK5-A</td>
<td align="center">CCACTCTTCTTCTGGGAACTCAA</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-13">
<title>Western blotting</title>
<p>The expression levels of TP53, MAPKAPK5, and HLA-G in atria were detected by Western blotting. After atrial tissues were washed with PBS, lysis buffer prepared with proteinase inhibitors and RIPA strong lysis buffer was added. Tissues were homogenized on ice for 30 min using a liquid nitrogen grinder. Samples were centrifuged at 4 &#xb0;C, 12,000 rpm for 20 min using a refrigerated high-speed centrifuge. After centrifugation, collect the supernatant and measure the protein concentration using the BSA kit. An appropriate amount of 5&#xd7; loading buffer was added to the remaining supernatant, and heat at 95 &#xb0;C in a metal bath for 10 min. Electrophoresis of protein samples was performed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After electrophoresis, proteins were transferred onto a PVDF membrane and blocked with 5% non-fat dry milk for 2 h. After blocking, the membrane was washed 5 times with TBST solution, each for 6 min. The membrane was then incubated with primary antibodies: anti-TP53 (IPD-ANP1072, IPODIX, China, dilution 1:500), anti-MAPKAPK5 (IPD-ANP9498, IPODIX, China, dilution 1:500), anti-HLA-G (GB115645, Servicebio, China, dilution 1:500), and anti-GAPDH (GB15004, Servicebio, China, dilution 1:10,000) at 4 &#xb0;C for at least 12 h. After the blocking period, wash the membrane 5 times with TBST, each for 6 min. Next, add the corresponding secondary antibody working solution and incubate for 2 h at room temperature. After incubation, wash the membrane 3 times with TBST, each for 6 min. To ensure that the loaded samples were of equal concentration, the ratio of band intensity to GAPDH was calculated to quantify the relative expression levels of these proteins.</p>
</sec>
<sec id="s2-14">
<title>Statistical analysis</title>
<p>All statistical analyses were conducted employing R software (version 4.2.2). The disparities were analyzed via the Wilcoxon test (n &#x3d; 2). The data obeyed normal distribution characteristics and are shown as the mean &#xb1; standard deviation (SD). Two-sample independent Student&#x2019;s t-test was used to compare the means of two groups. A statistically significant <italic>P-</italic>value is less than 0.05.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Identification and enrichment analysis of AF-MAMRGs</title>
<p>After removing the batch effects, PCA demonstrated that AF samples could be clearly separated from control samples (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Through differentially expressed analysis, a total of 4,384 DEGs between AF and controls were obtained, including 4,380 upregulated and 4 downregulated genes (<xref ref-type="fig" rid="F1">Figures 1B,C</xref>). Subsequently, through combination of MAMRGs and DEGs, there were 18 AF-MAMRGs obtained (<xref ref-type="fig" rid="F1">Figure 1D</xref>). The PPI network of AF-MAMRGs included 16 nodes and 23 edges (<xref ref-type="fig" rid="F1">Figure 1E</xref>), with TP53 had interactions with most proteins, such as MIF, MAPKAPK5, and SPI1. Additionally, the enrichment analysis illustrated that a total of 958 GO items and 75 KEGG pathways were markedly enriched (<xref ref-type="sec" rid="s12">Supplementary Table 2</xref>). The top 10 GO items and the top 5 KEGG pathways were displayed, including &#x201c;cellular senescence (GO-BP item),&#x201d; &#x201c;integral component of lumenal side of endoplasmic reticulum membrane (GO-CC item),&#x201d; &#x201c;DNA-binding transcription factor binding (GO-MF item),&#x201d; and &#x201c;Human T-cell leukemia virus 1 infection (KEGG)&#x201d; (<xref ref-type="fig" rid="F1">Figures 1F,G</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Identification and enrichment analysis of atrial fibrillation (AF)-related and mitochondria-associated endoplasmic reticulum membrane (MAM)-related genes (AF-MAMRGs) <bold>(A)</bold> Scatter plot suggesting principal component analysis (PCA) distribution for each sample after batch correction <bold>(B,C)</bold> The differentially expressed genes (DEGs) between AF and controls <bold>(B)</bold> The valcano plot <bold>(C)</bold> The heatmap <bold>(D)</bold> Venn diagram showing the overlap of genes between DEGs and MAMRGs <bold>(E)</bold> The protein-protein interaction (PPI) network of AF-MAMRGs <bold>(F,G)</bold> Functional enrichment analysis <bold>(F)</bold> Gene ontology (GO) <bold>(G)</bold> Kyoto Encyclopedia of Gene and Genomes (KEGG).</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g001.tif">
<alt-text content-type="machine-generated">Panel A shows a PCA plot with cases and controls clustered separately. Panel B displays a volcano plot highlighting upregulated and downregulated genes. Panel C is a circular heatmap indicating gene expression levels. Panel D features a Venn diagram of DEGs and MAMRGs with an overlap of 18 genes. Panel E is a network diagram linking genes related to MAMRGs. Panel F presents a dot plot for gene ontology enrichment analysis with varying dot sizes and colors. Panel G illustrates a network of gene interactions related to different infections and cellular processes.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<title>Determination of MAMs-related biomarkers for AF</title>
<p>To discover the genes with diagnostic value for AF among AF-MAMRGs, we first identified 15 characteristic genes through SVM-RFE and these 15 genes were incorporated in the LASSO results (17 genes) to ensure robustness (<xref ref-type="fig" rid="F2">Figures 2A,B</xref>). For the expression examination, in both training and validation sets, TP53, MAPKAPK5, and HLA-G were significantly upregulated in AF compared to controls (<xref ref-type="fig" rid="F2">Figures 2C,D</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Identification of MAM-related biomarkers for AF <bold>(A)</bold> Selection of characteristic genes based on the support vector machine recursive feature elimination (SVM-RFE) algorithm <bold>(B)</bold> Selection of characteristic genes based on the least absolute shrinkage and selection operator (LASSO) regression algorithm <bold>(C,D)</bold> The expression of 15 characteristic genes in AF and controls in training and validation sets <bold>(C)</bold> The training set <bold>(D)</bold> The validation set <bold>(E&#x2013;H)</bold> The causal effect of MAPKAPK5 on AF <bold>(E)</bold> The scatter plot <bold>(F)</bold> The forest plot <bold>(G)</bold> The funnel plot <bold>(H)</bold> The leave-out-out (LOO) method ns: not significance &#x2a;<italic>P</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001.</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g002.tif">
<alt-text content-type="machine-generated">Panel A shows a line plot of 10x cross-validation error against the number of features. Panel B has plots of binomial deviance and coefficients versus log lambda with marked lambda values. Panel C displays box plots comparing control and case groups for expression levels across various categories. Panel D features box plots for deviations in control and case groups. Panel E and F are scatter plots showing SNP effects with multiple MR test lines. Panel G is a scatter plot of inverse variance weighted and MR Egger results. Panel H shows a forest plot for MR leave-one-out sensitivity analysis.</alt-text>
</graphic>
</fig>
<p>Consequently, these three genes were identified as biomarkers for AF. To further analyze the causal effect of biomarkers on AF, a two-sample MR analysis was conducted. Since the number of SNPs of TP53 and HLA-G were less than 3 after IV selection, only the causal effect of MAPKAPK5 on AF was measured. Results illustrated that MAPKAPK5 had a significant causal association with AF (<italic>P</italic> &#x3d; 0.022) and was a risk factor for AF onset (OR &#x3d; 1.065, 95%CI &#x3d; 1.009&#x2013;1.125) (<xref ref-type="table" rid="T2">Table 2</xref>). Moreover, the scatter plot, forest plot, and funnel plot also demonstrated the consistency and reliability of the findings (<xref ref-type="fig" rid="F2">Figures 2E&#x2013;G</xref>). The Q statistic P-values for MR in this analysis were all below 0.05, which prompted the selection of a fixed-effect model. No heterogeneity and horizontal pleiotropy was detected (Q value &#x3d; 0.415; Egger_intercept &#x3d; 0.074; <italic>P</italic> &#x3d; 0.143), and removal of any individual SNP had no effect on results, suggesting that the results were reliable and robust (<xref ref-type="table" rid="T3">Table 3</xref>; <xref ref-type="fig" rid="F2">Figure 2H</xref>).</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>MR analysis.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">Exposure</th>
<th align="center">Outcome</th>
<th align="center">Method</th>
<th align="center">nsnp</th>
<th align="center">b</th>
<th align="center">se</th>
<th align="center">P-value</th>
<th align="center">OR</th>
<th align="center">or-lci95</th>
<th align="center">or-uci95</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="5" align="center">MAPKAPK5&#x7c;&#x7c; id:eqtl-a-ENSG00000089022</td>
<td rowspan="5" align="center">AF&#x7c;&#x7c;id:bbj-a-71</td>
<td align="center">MR Egger</td>
<td align="center">5</td>
<td align="center">&#x2212;0.103</td>
<td align="center">0.089</td>
<td align="center">0.33</td>
<td align="center">0.902</td>
<td align="center">0.759</td>
<td align="center">1.073</td>
</tr>
<tr>
<td align="center">Weighted median</td>
<td align="center">5</td>
<td align="center">0.043</td>
<td align="center">0.032</td>
<td align="center">0.179</td>
<td align="center">1.044</td>
<td align="center">0.98</td>
<td align="center">1.113</td>
</tr>
<tr>
<td align="center">Inverse variance weighted (fixed effects)</td>
<td align="center">5</td>
<td align="center">0.063</td>
<td align="center">0.028</td>
<td align="center">0.022</td>
<td align="center">1.065</td>
<td align="center">1.009</td>
<td align="center">1.125</td>
</tr>
<tr>
<td align="center">Simple mode</td>
<td align="center">5</td>
<td align="center">0.041</td>
<td align="center">0.036</td>
<td align="center">0.328</td>
<td align="center">1.041</td>
<td align="center">0.97</td>
<td align="center">1.119</td>
</tr>
<tr>
<td align="center">Weighted mode</td>
<td align="center">5</td>
<td align="center">0.041</td>
<td align="center">0.035</td>
<td align="center">0.311</td>
<td align="center">1.041</td>
<td align="center">0.972</td>
<td align="center">1.116</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>nsnp, number of single nucleotide polymorphism; se, standard error; OR, odd ratio; CI, confidence interval.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T3" position="float">
<label>TABLE 3</label>
<caption>
<p>Heterogeneity and pleiotropy analyses.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th rowspan="2" align="center">Outcome</th>
<th rowspan="2" align="center">Exposure</th>
<th colspan="4" align="center">Heterogeneity</th>
<th colspan="3" align="center">Pleiotropy</th>
</tr>
<tr>
<th align="center">Method</th>
<th align="center">Q</th>
<th align="center">Q_df</th>
<th align="center">Q_pval</th>
<th align="center">Egger_ intercept</th>
<th align="center">se</th>
<th align="center">Pval</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="2" align="center">AF&#x7c;&#x7c;id:bbj-a-71</td>
<td rowspan="2" align="center">MAPKAPK5&#x7c;&#x7c; id:eqtl-a-ENSG00000089022</td>
<td align="center">MR Egger</td>
<td align="center">0.038</td>
<td align="center">3</td>
<td align="center">0.998</td>
<td rowspan="2" align="center">0.074</td>
<td rowspan="2" align="center">0.038</td>
<td rowspan="2" align="center">0.143</td>
</tr>
<tr>
<td align="center">Inverse variance weighted</td>
<td align="center">3.934</td>
<td align="center">4</td>
<td align="center">0.415</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Q, Cochran&#x2019;s Q test estimate; Q_df, Q_degree of freedom; Q_pval, significance; se, standard error.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-3">
<title>Development of a nomogram with predicting efficacy for AF</title>
<p>We enhanced the nomogram in both training and validation cohorts to forecast the occurrence of AF based on the expression of three biomarkers (<xref ref-type="fig" rid="F3">Figures 3A,E</xref>). Both calibration curves indicated that the slopes were approximately 1 (<xref ref-type="fig" rid="F3">Figures 3B,F</xref>). The area under the ROC curves were 0.821 and 1, respectively (<xref ref-type="fig" rid="F3">Figures 3C,G</xref>). Furthermore, the DCA indicated that the nomogram exhibited the highest net benefit (<xref ref-type="fig" rid="F3">Figures 3D,H</xref>). These results indicated that the nomogram had high accuracy and robustness for predicting AF.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Development and assessment of the nomogram. The four figures in the upper row represent the results of the training set, while the figures in the lower row correspond to the results of the validation set. <bold>(A&#x2013;E)</bold> The visualization of the nomogram with diagnostic value for AF patients <bold>(B&#x2013;H)</bold> The assessment of the nomogram <bold>(B,F)</bold> The calibration curve <bold>(C,G)</bold> The receiver operating characteristic (ROC) curve <bold>(D,H)</bold> The decision curve analysis (DCA).</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g003.tif">
<alt-text content-type="machine-generated">Nomograms and performance graphs related to the analysis of HLA-G, TP53, and MAPKAPK5. Panels A and E show nomograms to calculate risk based on specific predictor values. Panels B and F display calibration curves for observed versus predicted overall survival percentages. Panels C and G present ROC curves showing sensitivity and specificity, with AUC values of 82.1 percent and 100.0 percent, respectively. Panels D and H depict decision curve analyses indicating net benefit across different high-risk thresholds.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<title>Enrichment analyses for biomarkers</title>
<p>Next, we analyzed the specific signaling pathways involved in the three biomarkers and explored the impact of the biomarkers on the signaling pathways associated with AF progression. GSEA results demonstrated that three biomarkers were involved in immune-related pathways, such as &#x201c;cytokine-cytokine receptor interaction,&#x201d; &#x201c;chemokine signaling pathway,&#x201d; &#x201c;TOLL like receptor signaling pathway,&#x201d; &#x201c;MAPK signaling pathway,&#x201d; &#x201c;natural killer cell mediated cytotoxicity&#x201d; (<xref ref-type="fig" rid="F4">Figures 4A&#x2013;C</xref>) (<xref ref-type="sec" rid="s12">Supplementary Table 3</xref>). Moreover, these biomarkers were also involved in metabolism-related pathways, including &#x201c;glycerophospholipid metabolism&#x201d; and &#x201c;propanoate metabolism&#x201d; (<xref ref-type="sec" rid="s12">Supplementary Table 3</xref>). Results of GSVA illustrated that the HALLMARK pathways enriched of the two expression groups of TP53 and HLA-G were identical. The high-expression group was enriched in &#x201c;mitotic spindle,&#x201d; &#x201c;oxidative phosphorylation,&#x201d; &#x201c;UV response DN&#x201d; and other 13 pathways (<xref ref-type="fig" rid="F4">Figure 4D</xref>; <xref ref-type="sec" rid="s12">Supplementary Table 3</xref>). The low-expression group was enriched in &#x201c;allograft rejection,&#x201d; &#x201c;inflammatory response,&#x201d; &#x201c;IL6-JAK-STAT3 signaling&#x201d; and other 6 pathways (<xref ref-type="fig" rid="F4">Figure 4D</xref>; <xref ref-type="sec" rid="s12">Supplementary Table 3</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Exploration of possible mechanisms by which biomarkers modulate AF <bold>(A&#x2013;D)</bold> Functional enrichment analysis <bold>(A&#x2013;C)</bold> Gene set enrichment analysis (GSEA) <bold>(A)</bold> TP53 <bold>(B)</bold> MAPKAPK5 <bold>(C)</bold> HLA-G <bold>(D)</bold> Gene set variation analysis (GSVA) for biomarkers <bold>(E&#x2013;G)</bold> Immune infiltration analysis <bold>(E)</bold> The percentage of infiltration abundance of each immune cell in AF and controls <bold>(F)</bold> The differences in infiltration abundance of each immune cell between AF and controls <bold>(G)</bold> Correlations between biomarkers and immune cells with significant differences in infiltration abundance ns: not significance &#x2a;<italic>P</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001.</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g004.tif">
<alt-text content-type="machine-generated">Panel A to C display enrichment scores for gene sets related to TP53, MAPKAPK5, and HLA-G. Panel D shows a bar chart of GSVA scores for various KEGG pathways. Panel E is a stacked bar chart comparing immune cell composition in case vs. control groups. Panel F presents box plots of immune cell content across different cell types. Panel G is a correlation heatmap between gene expressions and immune cell types.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<title>Assessment of immune infiltration</title>
<p>Previous studies have demonstrated that the immune response may play an important role in the development and maintenance of AF. Moreover, results of GSEA revealed that three biomarkers were relevant to immune-related pathways in our study. Therefore, we further measured the infiltration abundance of 28 immune cells in AF and controls, and group differences were analyzed (<xref ref-type="fig" rid="F4">Figures 4E,F</xref>). Between AF and control groups, the infiltration abundance of 18 immune cells was considerably increased in the AF group compared to the control group, including macrophages, activated dendritic cells, neutrophils, monocytes, etc.(<xref ref-type="fig" rid="F4">Figure 4F</xref>). Both activated CD4<sup>&#x2b;</sup>/CD8<sup>&#x2b;</sup> T cells and central memory CD4<sup>&#x2b;</sup>/CD8<sup>&#x2b;</sup> T cells exhibited significant differences in infiltration levels between groups, highlighting the involvement of diverse T cell subsets. Moreover, all biomarkers had marked positive relevance to these immune cells, and the highest correlation was between TP53 and monocytes (cor &#x3d; 0.91, <italic>P</italic> &#x3d; 7.495e-12), meanwhile, myeloid-derived suppressor cells (MDSC) was highly correlated with all biomarkers (cor &#x3e;0.95) (<xref ref-type="fig" rid="F4">Figure 4G</xref>).</p>
</sec>
<sec id="s3-6">
<title>Drug prediction and molecular docking simulation</title>
<p>To find drugs for AF therapy, we searched the DGIdb database. Results demonstrated that two potential drugs interacted with HLA-G, two potential drugs interacted with MAPKAPK5, and 49 potential drugs interacted with TP53 (<xref ref-type="fig" rid="F5">Figure 5A</xref>). Moreover, according to the ranking of interaction scores, the drug with the highest interaction score for each biomarker was selected for molecular docking. Results demonstrated that the docking energy between MAPKAPK5 and GLPG-0259 was &#x2212;9.5 kcal/mol, and SIMVASTATIN had a strong binding affinity with residues LYS-6 and GLU-232 of HLA-G through hydrogen bonding, with a docking energy of &#x2212;5.74 kcal/mol (<xref ref-type="fig" rid="F5">Figures 5B,C</xref>). These results indicate a stable binding capacity between MAPKAPK5 and HLA-G and their respective targeted drugs, suggesting their potential as therapeutic candidates for further investigation in related pathways. However, the docking energy between TP53 and THIOUREIDOBUTYRONITRILE was &#x2212;3.84 kcal/mol, indicating that the bond between them was not stable.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Prediction of drugs with interacting with biomarkers <bold>(A)</bold> The drug-mRNA nework Blue represents mRNAs and purple represents drugs <bold>(B,C)</bold> The molecular docking between biomarkers and drug with the highest interaction score <bold>(B)</bold> The molecular docking between GLPG-0259 and MAPKAPK5 <bold>(C)</bold> The molecular docking between SIMVASTATIN and HLA-G.</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g005.tif">
<alt-text content-type="machine-generated">Diagram showing three panels: A) A network map linking TP53 with various compounds (e.g., Rebemadlin, L-744,832) and proteins (e.g., MAPKAPK5, HLA-G). B) A protein structure with highlighted binding sites in green, detailed in a magnified inset. C) Another protein structure with highlighted regions in green, also shown in an inset.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-7">
<title>Expression of biomarkers at the single-cell level</title>
<p>Following quality control of scRNA-seq data, the top 2,000 highly variable genes were determined, and the top 30 principal components (PCs) were selected (<xref ref-type="sec" rid="s12">Supplementary Figure S1</xref>). Through cluster analysis, a total of 16 cell clusters were determined, which were annotated as 6 cell types: mononuclear phagocytes and dendritic cells (MP/DCs), lymphoid cells, mural cells, neutrophils, endothelial cells, and fibroblasts (<xref ref-type="fig" rid="F6">Figures 6A&#x2013;C</xref>). Among these cell types, MP/DCs accounted for the highest proportion in both AF and controls (<xref ref-type="fig" rid="F6">Figure 6D</xref>). Expression analysis illustrated that between AF and controls, the expression of TP53 in lymphoid cells, neutrophils, and endothelial cells and the expression of MAPKAPK5 in lymphoid cells and neutrophils were significantly different (<xref ref-type="fig" rid="F6">Figure 6E</xref>). However, between AF and control groups, the expression of HLA-G in each cell type did not differ significantly (<xref ref-type="fig" rid="F6">Figure 6E</xref>). Afterwards, the pseudotime analysis was employed on lymphoid cells and neutrophils. Results demonstrated that TP53 and MAPKAPK5 were expressed throughout cell differentiation (<xref ref-type="fig" rid="F7">Figures 7A,B</xref>). Additionally, cell-cell interaction analysis illustrated communication patterns among 6 cell types in the AF microenvironment. Compared to the control group, the bidirectional interaction between neutrophils and endothelial cells in AF was increased (<xref ref-type="fig" rid="F7">Figure 7C</xref>), which thus drew our focus. Further analysis of ligand-receptor pairs revealed an increased signaling intensity of the APP-CD74 axis, a key communication pathway between neutrophils and endothelial cells. This suggests that the pathway may exacerbate immune activation and local atrial inflammatory responses by enhancing the &#x201c;recruitment signals&#x201d; from endothelial cells to neutrophils. In contrast, the ITGB2-ICAM2 axis between neutrophils and endothelial cells was diminished in the AF group. Unlike controls, the interactions between lymphoid cells and mural cells as well as between lymphoid cells and neutrophils in AF were decreased (<xref ref-type="fig" rid="F7">Figure 7C</xref>).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Single-cell analysis <bold>(A)</bold> UMAP distribution of 16 independent clusters <bold>(B)</bold> Bubble diagram shows the expression of marker genes in each annotated cell types <bold>(C)</bold> UMAP distribution of 6 cell types <bold>(D)</bold> The proportions of each cell type <bold>(E)</bold> The expression of biomarkers in each cell type in AF and controls From top to bottom: HLA-G; TP53; MAPKAPK5.</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g006.tif">
<alt-text content-type="machine-generated">Composite image of five panels showing cell type analysis. Panel A: UMAP plot with clusters labeled by color and numbers from zero to fifteen. Panel B: Dot plot indicating gene expression levels across cell types. Panel C: UMAP plot with annotated cell types such as MPASDCs, lymphoid cells, and fibroblasts. Panel D: Stacked bar chart comparing cell type percentages between control and case groups. Panel E: Box plots of expression levels for HLA-G, TP53, and MAPKAPK5 across different cell types, distinguishing between control and case groups.</alt-text>
</graphic>
</fig>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption>
<p>Pseudotime analysis and cell communication analyses <bold>(A,B)</bold> Pseudotime analysis <bold>(A)</bold> Lymphoid cells <bold>(B)</bold> Neutrophils From left to right: The cells are coloured according to pseudotime value; The cells are coloured according to cell states; The cells are coloured according to different samples; The cells are coloured according to the expression of biomarkers <bold>(C)</bold> Cellular communication network illustrating the number and strength of interactions.</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g007.tif">
<alt-text content-type="machine-generated">Panel A and B display scatter plots of pseudotime and state analysis for HLA_G, TP53, and MAPKAPK5, showing data distributions across components with color gradients. Panel C features circular diagrams illustrating cell interactions, comparing number and strength between control and case groups, with nodes representing different cell types and colored lines indicating interactions.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-8">
<title>Animal model validation</title>
<p>AF model was established by rapid atrial pacing in canines to further investigate the expression of TP53, MAPKAPK5 and HLA-G in atria. As shown in <xref ref-type="fig" rid="F8">Figures 8A,B</xref>, electrophysiological measurements demonstrated that both the induction times and duration of AF were significantly higher in the AF canine model. Consistent with these findings, electrocardiographic (ECG) recordings revealed characteristic changes in the AF model (<xref ref-type="fig" rid="F8">Figure 8C</xref>). Subsequently, Western blotting (<xref ref-type="fig" rid="F8">Figures 8D&#x2013;G</xref>) and qRT-PCR (<xref ref-type="fig" rid="F8">Figures 8H&#x2013;J</xref>) were employed to ascertain the expression levels of TP53, MAPKAPK5, and HLA-G in both the AF group and the sham group. The findings demonstrated that TP53, MAPKAPK5, and HLA-G were markedly overexpressed in the canine model of AF. The alignment between transcriptional and protein levels enhances our assurance in the differential expression of these genes in the etiology of AF.</p>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption>
<p>AF model validation in canines <bold>(A,B)</bold> The electrophysiological results of the AF induction <bold>(A)</bold> and duration <bold>(B,C)</bold> electrocardiographic (ECG) image illustrating AF induction <bold>(D&#x2013;G)</bold> Western blotting image and quantative results for detecting three biomarkers expression between atriums from sham and AF groups <bold>(H&#x2013;J)</bold> quantitative real-time polymerase chain reaction (qRT-PCR) results.</p>
</caption>
<graphic xlink:href="fphys-16-1647275-g008.tif">
<alt-text content-type="machine-generated">Graphs and an electrophysiological recording illustrate differences between sham and atrial fibrillation (AF) groups. Bar graphs A and B show greater AF induction times and duration in AF. Graphs D, E, and F indicate increased TP53, MAPKAPK5, and HLA-G levels in AF. Panel C displays burst activity and atrial fibrillation in a recording. Panel G presents protein expression analysis, with TP53, MAPKAPK5, HLA-G, and GAPDH bands; AF shows higher expression. Bar graphs H, I, and J indicate elevated relative mRNA levels of TP53, MAPKAPK5, and HLA-G in AF. Significant differences are marked by p-values.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>MAMs are critical hubs for interorganelle communication, regulating calcium homeostasis, mitochondrial dynamics, and ER stress&#x2014;processes that are highly relevant to atrial remodeling and arrhythmogenesis (<xref ref-type="bibr" rid="B46">Patergnani et al., 2011</xref>; <xref ref-type="bibr" rid="B42">Mohan and Talwar, 2025</xref>). Atrial remodeling, central to AF initiation and maintenance, involves electrical/structural changes like altered myocyte electrophysiology, apoptosis, and fibrosis, thereby facilitating the induction and duration of AF. Calcium imbalance triggers AF via afterdepolarizations. Subsequently, rapid irregular ventricular rates overwhelm myocardial calcium regulatory mechanisms, causing ER calcium leakage, accelerated fibrosis, and heterogeneous electrical conduction&#x2014;fostering reentrant circuits that sustain AF (<xref ref-type="bibr" rid="B21">Guo Shuang et al., 2024</xref>). ER-mitochondria contacts (ERMCs), including MAMs, also underpin myocardial physiology. ER-mitochondrial calcium signaling is vital for contraction and energy metabolism in cardiomyocytes. ERMC abnormalities (e.g., ER stress, mitochondrial dysfunction) disrupt metabolism, induce calcium overload and mitochondrial apoptosis, promoting cardiomyocyte death and cardiomyopathy (<xref ref-type="bibr" rid="B62">Wang et al., 2021</xref>). Several studies have demonstrated the role of MAMs-related proteins in cardiovascular diseases (<xref ref-type="bibr" rid="B7">Chen et al., 2022</xref>; <xref ref-type="bibr" rid="B23">He et al., 2025</xref>); however, no research has reported the association between MAMs-related proteins and AF. Our identification of TP53, MAPKAPK5, and HLA-G as MAMs-related biomarkers provides novel insights into how MAM dysfunction contributes to AF pathogenesis, particularly the intersection of MAM dysfunction, immune dysregulation, and atrial remodeling.</p>
<p>TP53, a crucial regulator of cellular stress responses, exerts its effects via p53, which participates in cell cycle regulation, DNA repair, apoptosis, and cellular senescence. Notably, p53 modulates mitochondrial dynamics at MAMs through interactions with key mediators: it influences OPA1 (a core mediator of mitochondrial fusion and cristae structure) via Bak/Bax and OMA1, representing a mechanism linked to mitochondrial dysfunction and apoptosis in cardiomyopathies that may extend to atrial myocytes in AF (<xref ref-type="bibr" rid="B77">Zhang et al., 2022</xref>). Additionally, p53-induced mitochondrial fusion promotes cellular senescence by impairing mitochondrial function, as seen in vascular smooth muscle cell calcification&#x2014;paralleling senescence-related atrial remodeling in AF (<xref ref-type="bibr" rid="B48">Phadwal et al., 2023</xref>). Previous studies have demonstrated that TP53 expression is correlates with AF severity, with activation associated with increased atrial fibrosis (<xref ref-type="bibr" rid="B28">Jesel et al., 2019</xref>). Moreover, an animal study has confirmed that inhibiting the p53 pathway can suppress cardiac fibroblast activation and mitigate the progression of myocardial fibrosis following myocardial infarction (<xref ref-type="bibr" rid="B59">Tamaki et al., 2013</xref>). Additionally, p53 enhances atrial inflammation, damaging cardiomyocytes and further driving atrial remodeling to form a vicious cycle in AF (<xref ref-type="bibr" rid="B52">Rennison et al., 2021</xref>), aligning with its association with immune-related pathways in our GSEA. It also regulates endogenous metabolites such as BNIP3 and BNIP3L, which mediate mitophagy&#x2014;linking p53 to metabolic regulation in AF pathogenesis (<xref ref-type="bibr" rid="B77">Zhang et al., 2022</xref>). Collectively, TP53 integrates MAM-mediated mitochondrial dynamics, senescence, and mitophagy with fibrotic and inflammatory mechanisms, driving atrial remodeling and arrhythmogenesis in AF.</p>
<p>MAPKAPK5, a key protein kinase in the mitogen-activated protein kinase (MAPK) signaling pathway, mediates intracellular signal transduction, cellular stress responses, cell growth, and apoptosis. While its direct association with AF remains understudied, its downstream MAPK pathways are critical in AF pathogenesis&#x2014;consistent with our GSEA results linking MAPKAPK5 to immune- and metabolism-related pathways, including MAPK signaling. Notably, MAPKAPK5 may influence AF via MAM-dependent mechanisms: Studies show that targeting MAPK pathways mitigates atrial remodeling: SMLC inhibits oxidative stress through the MsrA/p38 MAPK axis, protecting against atrial-ventricular remodeling in AF (<xref ref-type="bibr" rid="B68">Xu et al., 2024</xref>); &#x3b1;-BTX, an &#x3b1;7nAChR antagonist, suppresses the oxi-CaMKII/MAPK/AP-1 pathway to normalize calcium handling, alleviating mitochondrial dysfunction, apoptosis, and atrial fibrosis in AF models (<xref ref-type="bibr" rid="B78">Zhao et al., 2023</xref>). Our previous research also demonstrated that inhibiting the MAPK pathway can suppress cardiac macrophage pro-inflammatory polarization and fibroblast activation in canine AF, lowering atrial inflammation, improving atrial fibrosis, and delaying AF progression (<xref ref-type="bibr" rid="B22">He et al., 2021</xref>; <xref ref-type="bibr" rid="B63">Wang et al., 2022</xref>). Collectively, these findings suggest MAPKAPK5 contributes to AF by disrupting MAM-mediated calcium homeostasis, promoting mitochondrial dysfunction via oxidative stress, and amplifying inflammatory signaling&#x2014;ultimately driving atrial structural/electrical remodeling and arrhythmogenesis.</p>
<p>HLA-G, a non-classical human leukocyte antigen (HLA) molecule, primarily functions in immune regulation, with well-established roles in tumor immunity, pregnancy, and transplant immune tolerance (<xref ref-type="bibr" rid="B9">Contini et al., 2020</xref>). Studies have indicated a genetically predicted causal relationship between an increase in the number of peripheral immune cells and the occurrence of AF (<xref ref-type="bibr" rid="B16">Feng et al., 2022</xref>). HLA-G lacks direct links to AF but may contribute to AF pathogenesis via MAM-mediated mechanisms&#x2014;aligning with our GSEA results associating it with immune and calcium-related pathways: Mechanistically, soluble HLA-G (sHLA-G) interacts with CD8<sup>&#x2b;</sup> T cells via the CD8 coreceptor, triggering Fas/Fas-ligand-mediated apoptosis and inducing extracellular calcium influx (<xref ref-type="bibr" rid="B49">Puppo et al., 2002</xref>). Given MAMs&#x2019; role in calcium homeostasis, HLA-G may disrupt MAM-mediated calcium exchange in atrial myocytes, promoting calcium overload, abnormal electrical activity, and arrhythmogenesis. Immunologically, HLA-G-ILT2 interactions exert immunosuppressive effects by expanding MDSCs, which exacerbate atrial inflammation and fibrosis&#x2014;hallmarks of atrial remodeling in AF (<xref ref-type="bibr" rid="B75">Zhang et al., 2008</xref>; <xref ref-type="bibr" rid="B71">Yang et al., 2020</xref>; <xref ref-type="bibr" rid="B39">Lin and Yan, 2021</xref>). Our immune infiltration data reinforce this link: MDSCs are highly infiltrated in AF, and HLA-G expression strongly correlates with MDSC abundance (cor &#x3e;0.95), suggesting a functional axis where HLA-G promotes MDSC accumulation in atrial tissue to drive fibrotic remodeling and AF persistence. Additionally, HLA-G-expressing CD4<sup>&#x2b;</sup> T cells also regulate adaptive immunity, potentially linking to CD4<sup>&#x2b;</sup> lymphocyte changes in our AF patients (<xref ref-type="bibr" rid="B45">Pankratz et al., 2014</xref>). Collectively, these findings position HLA-G as a functional mediator linking MAM dysfunction (via calcium imbalance) to immune dysregulation, thereby driving atrial structural and electrical remodeling in AF, rather than a passive bystander.</p>
<p>Growing attention focuses on the critical role of immune responses in AF pathogenesis, involving immune cell infiltration into atria, interactions with atrial myocytes, and secretion of chemokines/cytokines to regulate the cardiac microenvironment. Precisely modulating immunity to promote myocardial recovery is a key goal in cardioimmunology (<xref ref-type="bibr" rid="B67">Xiao et al., 2021</xref>). Our immune-related analysis showed that all three genes correlated significantly with immune cells exhibiting differential infiltration between AF and control groups, particularly monocytes, dendritic cells, neutrophils, MDSC, and macrophages (<xref ref-type="bibr" rid="B56">Shi et al., 2023</xref>). Notably, TP53 strongly correlated with monocytes, MAPKAPK5 with dendritic cells, and HLA-G with macrophages. Studies indicate excessive monocyte activation (especially enhanced migration) contributes to atrial structural remodeling and post-ablation AF recurrence (<xref ref-type="bibr" rid="B58">Suehiro et al., 2021</xref>), whereas the CD14<sup>&#x2b;</sup>CD16<sup>&#x2b;</sup> monocyte subset may reduce AF susceptibility by inhibiting abnormal activation or maintaining immune homeostasis (<xref ref-type="bibr" rid="B64">Wang et al., 2024</xref>). Dendritic cell-mediated responses play a critical role in AF-Crohn&#x2019;s disease crosstalk (<xref ref-type="bibr" rid="B51">Qiu et al., 2024</xref>). Additionally, AF induces pro-inflammatory polarization of cardiac macrophages, driving neutrophil recruitment and macrophage accumulation; inhibiting macrophage polarization/migration alleviates myocardial inflammation and prevents AF progression (<xref ref-type="bibr" rid="B22">He et al., 2021</xref>; <xref ref-type="bibr" rid="B31">Ke et al., 2025</xref>). Activated and central memory CD4<sup>&#x2b;</sup>/CD8<sup>&#x2b;</sup> T cells also showed significant intergroup differences, reflecting concurrent effects of immune microenvironment abnormalities on multiple T cell subsets. Senescent CD8<sup>&#x2b;</sup> T cells (marked by CD28 loss) and their transition from persistently activated CD8<sup>&#x2b;</sup> T cells (<xref ref-type="bibr" rid="B14">Effros et al., 2005</xref>), along with CD28 loss in CD4<sup>&#x2b;</sup>CD28<sup>&#x2212;</sup> T cells and reduced PD-1 positivity in CD4<sup>&#x2b;</sup> lymphocytes (<xref ref-type="bibr" rid="B33">Kounis et al., 2020</xref>; <xref ref-type="bibr" rid="B6">Chang et al., 2022</xref>), are linked to AF pathogenesis. These changes in senescent T cells provide context for understanding differential T cell subset expression (<xref ref-type="bibr" rid="B30">Kazem et al., 2020</xref>; <xref ref-type="bibr" rid="B38">Li et al., 2025</xref>), suggesting their involvement in AF via shared immune regulatory networks. Collectively, our findings indicate the three genes may influence AF&#x2019;s immune microenvironment, underscoring immune regulation&#x2019;s crucial role in AF pathogenesis.</p>
<p>Cell communication analysis revealed that the activity of the APP-CD74 pathway from endothelial cells to neutrophils was enhanced in the disease group, suggesting a potential association with immune activation (<xref ref-type="bibr" rid="B50">Qian et al., 2025</xref>). CD74 is a cell surface receptor for the cytokine MIF(<xref ref-type="bibr" rid="B26">Huang et al., 2025</xref>), and studies have demonstrated that MIF can activate the p44/p42 MAPK signaling pathway and promote chemokine release through the CD74 receptor, thereby inducing MIP-2 secretion and ultimately leading to the recruitment and aggregation of neutrophils (<xref ref-type="bibr" rid="B47">Pellegrino et al., 2024</xref>). As a key kinase in the MAPK signaling pathway, MAPKAPK5 may be involved in signal transduction of this pathway. Combined with the findings that immune cell infiltration (e.g., CD8<sup>&#x2b;</sup> T cells and neutrophils) is significantly increased in AF patients, and the high expression of biomarkers TP53 and MAPKAPK5 shows a strong positive correlation with immune cell infiltration, it is suggested that the APP-CD74 pathway may exacerbate local atrial inflammatory responses by enhancing the &#x201c;recruitment signals&#x201d; from endothelial cells to neutrophils, thereby participating in atrial remodeling. This mechanism may be associated with the functional regulation of MAMs in AF (e.g., calcium exchange and changes in mitochondrial dynamics).</p>
<p>Moreover, potential interactions between drugs and biomarkers were predicted using the DGIdb database. The binding capabilities of these drugs to the biomarkers were further validated through molecular docking experiments. Notably, Pifithrin-&#x3b1;, a regulatory drug targeting TP53, has demonstrated its myocardial protective effects and its role in treating heart failure (<xref ref-type="bibr" rid="B55">Shao et al., 2021</xref>). However, there is no direct research on the application of TP53-related drugs in the AF treatment. Simvastatin, a commonly utilized statin, is primarily prescribed for lowering cholesterol and preventing cardiovascular diseases. Research have indicated that Simvastatin may have potential effects in the prevention and treatment of AF, likely due to its anti-inflammatory and antioxidative stress properties (<xref ref-type="bibr" rid="B57">Shiroshita-Takeshita et al., 2004</xref>; <xref ref-type="bibr" rid="B8">Cho et al., 2014</xref>). Our study showed an interaction between HLA-G and Simvastatin, suggesting that the drug may influence specific immune responses that are implicated in the pathogenesis of AF. However, the specific mechanisms underlying this interaction require further investigation.</p>
<p>In summary, our study identified TP53, MAPKAPK5, and HLA-G as MAMs-related biomarkers for AF and elucidated their potential mechanisms through a multi-dimensional analysis, providing new targets and insights for the prevention and treatment of AF. Noting that the limited sample size may restrict the generalizability of our findings, and larger, multi-center cohorts are needed for validation. In subsequent studies, we will further excavate the potential of these biomarkers and corresponding drugs through functional experiments and clinical trials. Moreover, MR analyses in this study were based on data from European populations. Although various GWAS databases offer data from diverse populations, the scarcity of high-quality GWAS data and the limited sample sizes in non-European populations impede the identification of crucial genetic variants, potentially compromising the accuracy of cross-ethnic result extrapolation. Future research should concentrate on Asian-ancestry-specific data collection and cross-ethnic comparisons to enhance the reliability of results.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="sec" rid="s12">Supplementary Material</xref>, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>Ethical approval was not required for the study involving humans in accordance with the local legislation and institutional requirements. Written informed consent to participate in this study was not required from the participants or the participants&#x2019; legal guardians/next of kin in accordance with the national legislation and the institutional requirements. The animal study was approved by the Laboratory Animal Welfare &#x26; Ethics Committee of Dongguan Songshan Lake Central Hospital (No.2024-158-01). The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>YW: Funding acquisition, Project administration, Writing &#x2013; original draft. MS: Project administration, Writing &#x2013; original draft. HL: Methodology, Software, Writing &#x2013; review and editing. SF: Data curation, Writing &#x2013; review and editing. YL: Data curation, Writing &#x2013; review and editing. JL: Data curation, Writing &#x2013; review and editing. JZ: Formal Analysis, Software, Writing &#x2013; review and editing. KZ: Formal Analysis, Software, Writing &#x2013; review and editing. YM: Writing &#x2013; review and editing, Project administration. LY: Conceptualization, Funding acquisition, Writing &#x2013; review and editing.</p>
</sec>
<sec sec-type="funding-information" id="s8">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by the Natural Science Foundation of Hubei Province, China (2023AFB409), Special Project for Clinical and Basic Sci&#x26;Tech Innovation of Guangdong Medical University (GDMULCJC2024112) and the Natural Science Foundation of Hebei Province, China (H20211100).</p>
</sec>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec sec-type="supplementary-material" id="s12">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fphys.2025.1647275/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fphys.2025.1647275/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material>
<label>SUPPLEMENTARY FIGURE 1</label>
<caption>
<p>Quality control (QC) of single-cell dataset <bold>(A)</bold> Distribution of cells in each sample after QC in terms of nFeature_RNA, nCount_RNA, and percent of mitochondrial genes <bold>(B)</bold> Screening of 2,000 highly variable genes <bold>(C)</bold> principal component analysis (PCA) dimensionality reduction analysis.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY FIGURE 2</label>
<caption>
<p>Cell communication analysis targeting interaction between neutrophils and endothelial cells <bold>(A,B)</bold> Cellular communication network illustrating strength of interactions of neutrophils/endothelial cells: control <bold>(A)</bold> case <bold>(B)</bold>. <bold>(C)</bold> Key ligand-receptor interactions between defined cell-type pairs.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY TABLE 1</label>
<caption>
<p>Clinical data in GSE14975 and GSE41177 datasets.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY TABLE 2</label>
<caption>
<p>List of GO items and KEGG pathways enriched of AF-MAMRGs.</p>
</caption>
</supplementary-material>
<supplementary-material>
<label>SUPPLEMENTARY TABLE 3</label>
<caption>
<p>List of KEGG pathways enriched through GSEA and list of HALLMARK pathways enriched through GSVA.</p>
</caption>
</supplementary-material>
<supplementary-material xlink:href="Table2.xlsx" id="SM1" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table3.xlsx" id="SM2" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image2.tif" id="SM3" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.tif" id="SM4" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table1.xlsx" id="SM5" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Adam</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Lavall</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Theobald</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hohl</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Grube</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ameling</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Rac1-induced connective tissue growth factor regulates connexin 43 and N-cadherin expression in atrial fibrillation</article-title>. <source>J. Am. Coll. Cardiol.</source> <volume>55</volume> (<issue>5</issue>), <fpage>469</fpage>&#x2013;<lpage>480</lpage>. <pub-id pub-id-type="doi">10.1016/j.jacc.2009.08.064</pub-id>
<pub-id pub-id-type="pmid">20117462</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bosch</surname>
<given-names>N. A.</given-names>
</name>
<name>
<surname>Cimini</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Walkey</surname>
<given-names>A. J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Atrial fibrillation in the ICU</article-title>. <source>Chest</source> <volume>154</volume> (<issue>6</issue>), <fpage>1424</fpage>&#x2013;<lpage>1434</lpage>. <pub-id pub-id-type="doi">10.1016/j.chest.2018.03.040</pub-id>
<pub-id pub-id-type="pmid">29627355</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brundel</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ai</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Hills</surname>
<given-names>M. T.</given-names>
</name>
<name>
<surname>Kuipers</surname>
<given-names>M. F.</given-names>
</name>
<name>
<surname>Lip</surname>
<given-names>G. Y. H.</given-names>
</name>
<name>
<surname>de Groot</surname>
<given-names>N. M. S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Atrial fibrillation</article-title>. <source>Nat. Rev. Dis. Prim.</source> <volume>8</volume> (<issue>1</issue>), <fpage>21</fpage>. <pub-id pub-id-type="doi">10.1038/s41572-022-00347-9</pub-id>
<pub-id pub-id-type="pmid">35393446</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Burley</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Bhatt</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Bhikadiya</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Bi</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Biester</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Biswas</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Updated resources for exploring experimentally-determined PDB structures and computed structure models at the RCSB protein data bank</article-title>. <source>Nucleic Acids Res.</source> <volume>53</volume> (<issue>D1</issue>), <fpage>D564</fpage>&#x2013;<lpage>d574</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkae1091</pub-id>
<pub-id pub-id-type="pmid">39607707</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cannon</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Stevenson</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Stahl</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Basu</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Coffman</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kiwala</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>DGIdb 5.0: rebuilding the drug-gene interaction database for precision medicine and drug discovery platforms</article-title>. <source>Nucleic Acids Res.</source> <volume>52</volume> (<issue>D1</issue>), <fpage>D1227</fpage>&#x2013;<lpage>d1235</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkad1040</pub-id>
<pub-id pub-id-type="pmid">37953380</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ge</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>The PD-1 with PD-L1 axis is pertinent with the immune modulation of atrial fibrillation by regulating T cell excitation and promoting the secretion of inflammatory factors</article-title>. <source>J. Immunol. Res.</source> <volume>2022</volume>, <fpage>3647817</fpage>. <pub-id pub-id-type="doi">10.1155/2022/3647817</pub-id>
<pub-id pub-id-type="pmid">35600045</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xin</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Mitochondria-endoplasmic reticulum contacts: the promising regulators in diabetic cardiomyopathy</article-title>. <source>Oxidative Med. Cell. Longev.</source> <volume>2022</volume> (<issue>1</issue>), <fpage>2531458</fpage>. <pub-id pub-id-type="doi">10.1155/2022/2531458</pub-id>
<pub-id pub-id-type="pmid">35450404</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cho</surname>
<given-names>K. I.</given-names>
</name>
<name>
<surname>Koo</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Cha</surname>
<given-names>T. J.</given-names>
</name>
<name>
<surname>Heo</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>H. S.</given-names>
</name>
<name>
<surname>Jo</surname>
<given-names>G. B.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Simvastatin attenuates the oxidative stress, endothelial thrombogenicity and the inducibility of atrial fibrillation in a rat model of ischemic heart failure</article-title>. <source>Int. J. Mol. Sci.</source> <volume>15</volume> (<issue>8</issue>), <fpage>14803</fpage>&#x2013;<lpage>14818</lpage>. <pub-id pub-id-type="doi">10.3390/ijms150814803</pub-id>
<pub-id pub-id-type="pmid">25153633</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Contini</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Murdaca</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Puppo</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Negrini</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>HLA-G expressing immune cells in immune mediated diseases</article-title>. <source>Front. Immunol.</source> <volume>11</volume>, <fpage>1613</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2020.01613</pub-id>
<pub-id pub-id-type="pmid">32983083</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Huangfu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Kong</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Integrated analysis of single-cell RNA-Seq and bulk RNA-seq unravels the molecular feature of tumor-associated neutrophils of head and neck squamous cell carcinoma</article-title>. <source>BMC Cancer</source> <volume>25</volume> (<issue>1</issue>), <fpage>821</fpage>. <pub-id pub-id-type="doi">10.1186/s12885-025-14179-9</pub-id>
<pub-id pub-id-type="pmid">40312694</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Vos</surname>
<given-names>C. B.</given-names>
</name>
<name>
<surname>Pisters</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Nieuwlaat</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Prins</surname>
<given-names>M. H.</given-names>
</name>
<name>
<surname>Tieleman</surname>
<given-names>R. G.</given-names>
</name>
<name>
<surname>Coelen</surname>
<given-names>R. J.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Progression from paroxysmal to persistent atrial fibrillation clinical correlates and prognosis</article-title>. <source>J. Am. Coll. Cardiol.</source> <volume>55</volume> (<issue>8</issue>), <fpage>725</fpage>&#x2013;<lpage>731</lpage>. <pub-id pub-id-type="doi">10.1016/j.jacc.2009.11.040</pub-id>
<pub-id pub-id-type="pmid">20170808</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Di</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Single-cell and WGCNA uncover a prognostic model and potential oncogenes in colorectal cancer</article-title>. <source>Biol. Proced. Online</source> <volume>24</volume> (<issue>1</issue>), <fpage>13</fpage>. <pub-id pub-id-type="doi">10.1186/s12575-022-00175-x</pub-id>
<pub-id pub-id-type="pmid">36117173</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eberhardt</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Santos-Martins</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Tillack</surname>
<given-names>A. F.</given-names>
</name>
<name>
<surname>Forli</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>AutoDock vina 1.2.0: new docking methods, expanded force field, and python bindings</article-title>. <source>J. Chem. Inf. Model</source> <volume>61</volume> (<issue>8</issue>), <fpage>3891</fpage>&#x2013;<lpage>3898</lpage>. <pub-id pub-id-type="doi">10.1021/acs.jcim.1c00203</pub-id>
<pub-id pub-id-type="pmid">34278794</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Effros</surname>
<given-names>R. B.</given-names>
</name>
<name>
<surname>Dagarag</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Spaulding</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Man</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>The role of CD8&#x2b; T-cell replicative senescence in human aging</article-title>. <source>Immunol. Rev.</source> <volume>205</volume>, <fpage>147</fpage>&#x2013;<lpage>157</lpage>. <pub-id pub-id-type="doi">10.1111/j.0105-2896.2005.00259.x</pub-id>
<pub-id pub-id-type="pmid">15882351</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Efremova</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Vento-Tormo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Teichmann</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Vento-Tormo</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>CellPhoneDB: inferring cell-cell communication from combined expression of multi-subunit ligand-receptor complexes</article-title>. <source>Nat. Protoc.</source> <volume>15</volume> (<issue>4</issue>), <fpage>1484</fpage>&#x2013;<lpage>1506</lpage>. <pub-id pub-id-type="doi">10.1038/s41596-020-0292-x</pub-id>
<pub-id pub-id-type="pmid">32103204</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Causal association of peripheral immune cell counts and atrial fibrillation: a Mendelian randomization study</article-title>. <source>Front. Cardiovasc Med.</source> <volume>9</volume>, <fpage>1042938</fpage>. <pub-id pub-id-type="doi">10.3389/fcvm.2022.1042938</pub-id>
<pub-id pub-id-type="pmid">36684582</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Eils</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Schlesner</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Complex heatmaps reveal patterns and correlations in multidimensional genomic data</article-title>. <source>Bioinformatics</source> <volume>32</volume> (<issue>18</issue>), <fpage>2847</fpage>&#x2013;<lpage>2849</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/btw313</pub-id>
<pub-id pub-id-type="pmid">27207943</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Potential value of B7-H3 in sepsis diagnosis and prognosis: a Mendelian randomization study</article-title>. <source>Zhong Nan Da Xue Xue Bao Yi Xue Ban.</source> <volume>49</volume> (<issue>11</issue>), <fpage>1790</fpage>&#x2013;<lpage>1798</lpage>. <pub-id pub-id-type="doi">10.11817/j.issn.1672-7347.2024.240139</pub-id>
<pub-id pub-id-type="pmid">40177762</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Qiao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2024a</year>). <article-title>Hub genes, diagnostic model, and predicted drugs related to ferroptosis in chronic rhinosinusitis with nasal polyps</article-title>. <source>Med. Baltim.</source> <volume>103</volume> (<issue>48</issue>), <fpage>e40624</fpage>. <pub-id pub-id-type="doi">10.1097/md.0000000000040624</pub-id>
<pub-id pub-id-type="pmid">39612457</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Qiao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Dang</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2024b</year>). <article-title>The association between cardiovascular health and obstructive sleep apnea symptoms: findings from NHANES</article-title>. <source>Front. Cardiovasc Med.</source> <volume>11</volume>, <fpage>1466752</fpage>. <pub-id pub-id-type="doi">10.3389/fcvm.2024.1466752</pub-id>
<pub-id pub-id-type="pmid">39759500</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo Shuang</surname>
<given-names>L. S.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wenjing</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Jianchao</surname>
<given-names>Li</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Relationship between calcium homeostasis imbalance and atrial fibrillation-mediated cardiomyopathy</article-title>. <source>J. Pract. Cardio-Cerebrovascular Dis.</source> <volume>32</volume> (<issue>1</issue>), <fpage>121</fpage>&#x2013;<lpage>128</lpage>. <pub-id pub-id-type="doi">10.12114/j.issn.1008-5971.2023.00.287</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zi</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Inhibition of KCa3.1 channels suppresses atrial fibrillation <italic>via</italic> the attenuation of macrophage pro-inflammatory polarization in a canine model with prolonged rapid atrial pacing</article-title>. <source>Front. Cardiovasc Med.</source> <volume>8</volume>, <fpage>656631</fpage>. <pub-id pub-id-type="doi">10.3389/fcvm.2021.656631</pub-id>
<pub-id pub-id-type="pmid">34136541</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Mitochondria associated membranes in dilated cardiomyopathy: connecting pathogenesis and cellular dysfunction</article-title>. <source>Front. Cardiovasc Med.</source> <volume>12</volume>, <fpage>1571998</fpage>. <pub-id pub-id-type="doi">10.3389/fcvm.2025.1571998</pub-id>
<pub-id pub-id-type="pmid">40166597</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hemani</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Elsworth</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Wade</surname>
<given-names>K. H.</given-names>
</name>
<name>
<surname>Haberland</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Baird</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>The MR-Base platform supports systematic causal inference across the human phenome</article-title>. <source>Elife</source> <volume>7</volume>, <fpage>e34408</fpage>. <pub-id pub-id-type="doi">10.7554/eLife.34408</pub-id>
<pub-id pub-id-type="pmid">29846171</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Ge</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Exploring ferroptosis-associated gene signatures as diagnostic and therapeutic targets for sepsis-induced cardiomyopathy</article-title>. <source>Cureus</source> <volume>16</volume> (<issue>5</issue>), <fpage>e60439</fpage>. <pub-id pub-id-type="doi">10.7759/cureus.60439</pub-id>
<pub-id pub-id-type="pmid">38887322</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>L. X.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>Z. X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X. X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z. L.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Endothelial cells expressing CPE and vWF are involved in the immunopathogenesis of primary biliary cholangitis</article-title>. <source>Sci. Rep.</source> <volume>15</volume> (<issue>1</issue>), <fpage>22640</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-025-07311-z</pub-id>
<pub-id pub-id-type="pmid">40596471</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hulsmans</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Schloss</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>I. H.</given-names>
</name>
<name>
<surname>Bapat</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Iwamoto</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Vinegoni</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Recruited macrophages elicit atrial fibrillation</article-title>. <source>Science</source> <volume>381</volume> (<issue>6654</issue>), <fpage>231</fpage>&#x2013;<lpage>239</lpage>. <pub-id pub-id-type="doi">10.1126/science.abq3061</pub-id>
<pub-id pub-id-type="pmid">37440641</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jesel</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Abbas</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Matsushita</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Kindo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hasan</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Atrial fibrillation progression is associated with cell senescence burden as determined by p53 and p16 expression</article-title>. <source>J. Clin. Med.</source> <volume>9</volume> (<issue>1</issue>), <fpage>36</fpage>. <pub-id pub-id-type="doi">10.3390/jcm9010036</pub-id>
<pub-id pub-id-type="pmid">31878008</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kazem</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Sulzgruber</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Thaler</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Baumgartner</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Koller</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Laufer</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>CD8&#x2b;CD28null T lymphocytes are associated with the development of atrial fibrillation after elective cardiac surgery</article-title>. <source>Thromb. Haemost.</source> <volume>120</volume> (<issue>8</issue>), <fpage>1182</fpage>&#x2013;<lpage>1187</lpage>. <pub-id pub-id-type="doi">10.1055/s-0040-1713096</pub-id>
<pub-id pub-id-type="pmid">32594507</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ke</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>K(Ca)3.1 promotes the migration of macrophages from epicardial adipose tissue to induce vulnerability to atrial fibrillation during rapid pacing</article-title>. <source>Can. J. Cardiol.</source> <volume>41</volume> (<issue>2</issue>), <fpage>195</fpage>&#x2013;<lpage>209</lpage>. <pub-id pub-id-type="doi">10.1016/j.cjca.2024.08.266</pub-id>
<pub-id pub-id-type="pmid">39147322</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Gindulyte</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>PubChem 2025 update</article-title>. <source>Nucleic Acids Res.</source> <volume>53</volume> (<issue>D1</issue>), <fpage>D1516</fpage>&#x2013;<lpage>d1525</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkae1059</pub-id>
<pub-id pub-id-type="pmid">39558165</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kounis</surname>
<given-names>N. G.</given-names>
</name>
<name>
<surname>Koniari</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Tzanis</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Soufras</surname>
<given-names>G. D.</given-names>
</name>
<name>
<surname>Velissaris</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hahalis</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Anaphylaxis-induced atrial fibrillation and anesthesia: pathophysiologic and therapeutic considerations</article-title>. <source>Ann. Card. Anaesth.</source> <volume>23</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>6</lpage>. <pub-id pub-id-type="doi">10.4103/aca.ACA_100_19</pub-id>
<pub-id pub-id-type="pmid">31929239</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leek</surname>
<given-names>J. T.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>W. E.</given-names>
</name>
<name>
<surname>Parker</surname>
<given-names>H. S.</given-names>
</name>
<name>
<surname>Jaffe</surname>
<given-names>A. E.</given-names>
</name>
<name>
<surname>Storey</surname>
<given-names>J. D.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The sva package for removing batch effects and other unwanted variation in high-throughput experiments</article-title>. <source>Bioinformatics</source> <volume>28</volume> (<issue>6</issue>), <fpage>882</fpage>&#x2013;<lpage>883</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/bts034</pub-id>
<pub-id pub-id-type="pmid">22257669</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>FUNDC1: a promising mitophagy regulator at the mitochondria-associated membrane for cardiovascular diseases</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>9</volume>, <fpage>788634</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2021.788634</pub-id>
<pub-id pub-id-type="pmid">35096821</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>H. M.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Tong</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2024a</year>). <article-title>Correlation between mitochondria-associated endoplasmic reticulum membrane-related genes and cellular senescence-related genes in osteoarthritis</article-title>. <source>ACS Omega</source> <volume>9</volume> (<issue>17</issue>), <fpage>19169</fpage>&#x2013;<lpage>19181</lpage>. <pub-id pub-id-type="doi">10.1021/acsomega.3c10316</pub-id>
<pub-id pub-id-type="pmid">38708239</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Tong</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2024b</year>). <article-title>Deciphering anoikis resistance and identifying prognostic biomarkers in clear cell renal cell carcinoma epithelial cells</article-title>. <source>Sci. Rep.</source> <volume>14</volume> (<issue>1</issue>), <fpage>12044</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-024-62978-0</pub-id>
<pub-id pub-id-type="pmid">38802480</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Bao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Senescent CD8&#x2b; T cells: a novel risk factor in atrial fibrillation</article-title>. <source>Cardiovasc Res.</source> <volume>121</volume> (<issue>1</issue>), <fpage>97</fpage>&#x2013;<lpage>112</lpage>. <pub-id pub-id-type="doi">10.1093/cvr/cvae222</pub-id>
<pub-id pub-id-type="pmid">39382426</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>W. H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Perspective of HLA-G induced immunosuppression in SARS-CoV-2 infection</article-title>. <source>Front. Immunol.</source> <volume>12</volume>, <fpage>788769</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2021.788769</pub-id>
<pub-id pub-id-type="pmid">34938296</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Luan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>R. X.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Structure and function of mitochondria-associated endoplasmic reticulum membranes (MAMs) and their role in cardiovascular diseases</article-title>. <source>Oxid. Med. Cell Longev.</source> <volume>2021</volume>, <fpage>4578809</fpage>. <pub-id pub-id-type="doi">10.1155/2021/4578809</pub-id>
<pub-id pub-id-type="pmid">34336092</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Mitochondria-associated endoplasmic reticulum membranes and cardiac hypertrophy: molecular mechanisms and therapeutic targets</article-title>. <source>Front. Cardiovasc Med.</source> <volume>9</volume>, <fpage>1015722</fpage>. <pub-id pub-id-type="doi">10.3389/fcvm.2022.1015722</pub-id>
<pub-id pub-id-type="pmid">36337896</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mohan</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Talwar</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>MAM kinases: physiological roles, related diseases, and therapeutic perspectives-a systematic review</article-title>. <source>Cell Mol. Biol. Lett.</source> <volume>30</volume> (<issue>1</issue>), <fpage>35</fpage>. <pub-id pub-id-type="doi">10.1186/s11658-025-00714-w</pub-id>
<pub-id pub-id-type="pmid">40148800</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mooers</surname>
<given-names>B. H. M.</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>M. E.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Templates for writing PyMOL scripts</article-title>. <source>Protein Sci.</source> <volume>30</volume> (<issue>1</issue>), <fpage>262</fpage>&#x2013;<lpage>269</lpage>. <pub-id pub-id-type="doi">10.1002/pro.3997</pub-id>
<pub-id pub-id-type="pmid">33179363</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>O&#x27;Boyle</surname>
<given-names>N. M.</given-names>
</name>
<name>
<surname>Banck</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>James</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Morley</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Vandermeersch</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hutchison</surname>
<given-names>G. R.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Open babel: an open chemical toolbox</article-title>. <source>J. Cheminform</source> <volume>3</volume>, <fpage>33</fpage>. <pub-id pub-id-type="doi">10.1186/1758-2946-3-33</pub-id>
<pub-id pub-id-type="pmid">21982300</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pankratz</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bittner</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Herrmann</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Schuhmann</surname>
<given-names>M. K.</given-names>
</name>
<name>
<surname>Ruck</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Meuth</surname>
<given-names>S. G.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Human CD4&#x2b; HLA-G&#x2b; regulatory T cells are potent suppressors of graft-versus-host disease <italic>in vivo</italic>
</article-title>. <source>Faseb J.</source> <volume>28</volume> (<issue>8</issue>), <fpage>3435</fpage>&#x2013;<lpage>3445</lpage>. <pub-id pub-id-type="doi">10.1096/fj.14-251074</pub-id>
<pub-id pub-id-type="pmid">24744146</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Patergnani</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Suski</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Agnoletto</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Bononi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bonora</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>De Marchi</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Calcium signaling around mitochondria associated membranes (MAMs)</article-title>. <source>Cell Commun. Signal</source> <volume>9</volume>, <fpage>19</fpage>. <pub-id pub-id-type="doi">10.1186/1478-811x-9-19</pub-id>
<pub-id pub-id-type="pmid">21939514</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pellegrino</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>David</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Rabani</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lampert</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Tran</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Doherty</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>CD74 promotes the formation of an immunosuppressive tumor microenvironment in triple-negative breast cancer in mice by inducing the expansion of tolerogenic dendritic cells and regulatory B cells</article-title>. <source>PLoS Biol.</source> <volume>22</volume> (<issue>11</issue>), <fpage>e3002905</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pbio.3002905</pub-id>
<pub-id pub-id-type="pmid">39576827</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Phadwal</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>Q. Y.</given-names>
</name>
<name>
<surname>Luijten</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J. F.</given-names>
</name>
<name>
<surname>Corcoran</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Semple</surname>
<given-names>R. K.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>p53 regulates mitochondrial dynamics in vascular smooth muscle cell calcification</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume> (<issue>2</issue>), <fpage>1643</fpage>. <pub-id pub-id-type="doi">10.3390/ijms24021643</pub-id>
<pub-id pub-id-type="pmid">36675156</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Puppo</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Contini</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Ghio</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Indiveri</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Soluble HLA class I molecules/CD8 ligation trigger apoptosis of CD8&#x2b; cells by Fas/fas-Ligand interaction</article-title>. <source>ScientificWorldJournal</source> <volume>2</volume>, <fpage>421</fpage>&#x2013;<lpage>423</lpage>. <pub-id pub-id-type="doi">10.1100/tsw.2002.122</pub-id>
<pub-id pub-id-type="pmid">12806026</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qian</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shou</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Single-cell transcriptomic and m6A methylation analyses reveal platelet-mediated immune regulatory mechanisms in sepsis</article-title>. <source>Front. Immunol.</source> <volume>16</volume>, <fpage>1607732</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2025.1607732</pub-id>
<pub-id pub-id-type="pmid">40625751</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qiu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Teng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Transcriptomic analysis reveals the potential crosstalk genes and immune relationship between crohn&#x27;s disease and atrial fibrillation</article-title>. <source>J. Thorac. Dis.</source> <volume>16</volume> (<issue>2</issue>), <fpage>1247</fpage>&#x2013;<lpage>1261</lpage>. <pub-id pub-id-type="doi">10.21037/jtd-23-1078</pub-id>
<pub-id pub-id-type="pmid">38505024</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rennison</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>C. R.</given-names>
</name>
<name>
<surname>Lovano</surname>
<given-names>B. S.</given-names>
</name>
<name>
<surname>Castel</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wass</surname>
<given-names>S. Y.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Atrial fibrillation rhythm is associated with marked changes in metabolic and myofibrillar protein expression in left atrial appendage</article-title>. <source>Pflugers Arch.</source> <volume>473</volume> (<issue>3</issue>), <fpage>461</fpage>&#x2013;<lpage>475</lpage>. <pub-id pub-id-type="doi">10.1007/s00424-021-02514-5</pub-id>
<pub-id pub-id-type="pmid">33454842</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ritchie</surname>
<given-names>M. E.</given-names>
</name>
<name>
<surname>Phipson</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Law</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Limma powers differential expression analyses for RNA-Sequencing and microarray studies</article-title>. <source>Nucleic Acids Res.</source> <volume>43</volume> (<issue>7</issue>), <fpage>e47</fpage>. <pub-id pub-id-type="doi">10.1093/nar/gkv007</pub-id>
<pub-id pub-id-type="pmid">25605792</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Satija</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Farrell</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Gennert</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Schier</surname>
<given-names>A. F.</given-names>
</name>
<name>
<surname>Regev</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Spatial reconstruction of single-cell gene expression data</article-title>. <source>Nat. Biotechnol.</source> <volume>33</volume> (<issue>5</issue>), <fpage>495</fpage>&#x2013;<lpage>502</lpage>. <pub-id pub-id-type="doi">10.1038/nbt.3192</pub-id>
<pub-id pub-id-type="pmid">25867923</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shao</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zhai</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Mukai</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Sciarretta</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Del Re</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Lats2 promotes heart failure by stimulating p53-mediated apoptosis during pressure overload</article-title>. <source>Sci. Rep.</source> <volume>11</volume> (<issue>1</issue>), <fpage>23469</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-021-02846-3</pub-id>
<pub-id pub-id-type="pmid">34873220</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>PILRA is associated with immune cells infiltration in atrial fibrillation based on bioinformatics and experiment validation</article-title>. <source>Front. Cardiovasc Med.</source> <volume>10</volume>, <fpage>1082015</fpage>. <pub-id pub-id-type="doi">10.3389/fcvm.2023.1082015</pub-id>
<pub-id pub-id-type="pmid">37396579</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shiroshita-Takeshita</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Schram</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Lavoie</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Nattel</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Effect of simvastatin and antioxidant vitamins on atrial fibrillation promotion by atrial-tachycardia remodeling in dogs</article-title>. <source>Circulation</source> <volume>110</volume> (<issue>16</issue>), <fpage>2313</fpage>&#x2013;<lpage>2319</lpage>. <pub-id pub-id-type="doi">10.1161/01.Cir.0000145163.56529.D1</pub-id>
<pub-id pub-id-type="pmid">15477401</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suehiro</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Kiuchi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Fukuzawa</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Yoshida</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Takami</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Watanabe</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Circulating intermediate monocytes and atrial structural remodeling associated with atrial fibrillation recurrence after catheter ablation</article-title>. <source>J. Cardiovasc Electrophysiol.</source> <volume>32</volume> (<issue>4</issue>), <fpage>1035</fpage>&#x2013;<lpage>1043</lpage>. <pub-id pub-id-type="doi">10.1111/jce.14929</pub-id>
<pub-id pub-id-type="pmid">33533109</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamaki</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Iwanaga</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Niizuma</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kawashima</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kato</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Inuzuka</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Metastasis-associated protein, S100A4 mediates cardiac fibrosis potentially through the modulation of p53 in cardiac fibroblasts</article-title>. <source>J. Mol. Cell Cardiol.</source> <volume>57</volume>, <fpage>72</fpage>&#x2013;<lpage>81</lpage>. <pub-id pub-id-type="doi">10.1016/j.yjmcc.2013.01.007</pub-id>
<pub-id pub-id-type="pmid">23352991</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tong</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zablocki</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Sadoshima</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The role of Drp1 in mitophagy and cell death in the heart</article-title>. <source>J. Mol. Cell Cardiol.</source> <volume>142</volume>, <fpage>138</fpage>&#x2013;<lpage>145</lpage>. <pub-id pub-id-type="doi">10.1016/j.yjmcc.2020.04.015</pub-id>
<pub-id pub-id-type="pmid">32302592</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsai</surname>
<given-names>F. C.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>G. J.</given-names>
</name>
<name>
<surname>Hsu</surname>
<given-names>Y. J.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y. M.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Differential left-to-right atria gene expression ratio in human sinus rhythm and atrial fibrillation: implications for arrhythmogenesis and thrombogenesis</article-title>. <source>Int. J. Cardiol.</source> <volume>222</volume>, <fpage>104</fpage>&#x2013;<lpage>112</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijcard.2016.07.103</pub-id>
<pub-id pub-id-type="pmid">27494721</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Endoplasmic reticulum-mitochondria contacts: a potential therapy target for cardiovascular remodeling-associated diseases</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>9</volume>, <fpage>774989</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2021.774989</pub-id>
<pub-id pub-id-type="pmid">34858991</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Blockade of SK4 channels suppresses atrial fibrillation by attenuating atrial fibrosis in canines with prolonged atrial pacing</article-title>. <source>Int. J. Med. Sci.</source> <volume>19</volume> (<issue>14</issue>), <fpage>1995</fpage>&#x2013;<lpage>2007</lpage>. <pub-id pub-id-type="doi">10.7150/ijms.69626</pub-id>
<pub-id pub-id-type="pmid">36483596</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Q.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Causality of genetically proxied immunophenotypes on cardiovascular diseases: a Mendelian randomization study</article-title>. <source>Front. Immunol.</source> <volume>15</volume>, <fpage>1344773</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2024.1344773</pub-id>
<pub-id pub-id-type="pmid">38887301</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Wickham</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2016</year>). <source>ggplot2: elegant graphics for data analysis</source>. <publisher-loc>New York</publisher-loc>: <publisher-name>Springer-Verlag</publisher-name>.</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>clusterProfiler 4.0: a universal enrichment tool for interpreting omics data</article-title>. <source>Innov. (Camb)</source> <volume>2</volume> (<issue>3</issue>), <fpage>100141</fpage>. <pub-id pub-id-type="doi">10.1016/j.xinn.2021.100141</pub-id>
<pub-id pub-id-type="pmid">34557778</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiao</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Uncovering potential novel biomarkers and immune infiltration characteristics in persistent atrial fibrillation using integrated bioinformatics analysis</article-title>. <source>Math. Biosci. Eng.</source> <volume>18</volume> (<issue>4</issue>), <fpage>4696</fpage>&#x2013;<lpage>4712</lpage>. <pub-id pub-id-type="doi">10.3934/mbe.2021238</pub-id>
<pub-id pub-id-type="pmid">34198460</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Meng</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Hong</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>S-Methyl-L-cysteine targeting MsrA attenuates ang II-induced oxidative stress and atrial remodeling <italic>via</italic> the p38 MAPK signaling pathway</article-title>. <source>Food Funct.</source> <volume>15</volume> (<issue>18</issue>), <fpage>9165</fpage>&#x2013;<lpage>9175</lpage>. <pub-id pub-id-type="doi">10.1039/d4fo03078h</pub-id>
<pub-id pub-id-type="pmid">39157962</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2025a</year>). <article-title>Interplay of disulfidptosis and the tumor microenvironment across cancers: implications for prognosis and therapeutic responses</article-title>. <source>BMC Cancer</source> <volume>25</volume> (<issue>1</issue>), <fpage>1113</fpage>. <pub-id pub-id-type="doi">10.1186/s12885-025-14246-1</pub-id>
<pub-id pub-id-type="pmid">40597807</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2025b</year>). <article-title>Causal links between immune cells and asthma: insights from a mendelian randomization analysis</article-title>. <source>J. Asthma</source> <volume>62</volume> (<issue>2</issue>), <fpage>346</fpage>&#x2013;<lpage>353</lpage>. <pub-id pub-id-type="doi">10.1080/02770903.2024.2403740</pub-id>
<pub-id pub-id-type="pmid">39269201</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Lv</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Umbilical cord blood-derived mesenchymal stromal cells promote myeloid-derived suppressor cell proliferation by secreting HLA-G to reduce acute graft-versus-host disease after hematopoietic stem cell transplantation</article-title>. <source>Cytotherapy</source> <volume>22</volume> (<issue>12</issue>), <fpage>718</fpage>&#x2013;<lpage>733</lpage>. <pub-id pub-id-type="doi">10.1016/j.jcyt.2020.07.008</pub-id>
<pub-id pub-id-type="pmid">32811747</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>The role of PLIN3 in prognosis and tumor-associated macrophage infiltration: a pan-cancer analysis</article-title>. <source>J. Inflamm. Res.</source> <volume>18</volume>, <fpage>3757</fpage>&#x2013;<lpage>3777</lpage>. <pub-id pub-id-type="doi">10.2147/jir.S509245</pub-id>
<pub-id pub-id-type="pmid">40098998</pub-id>
</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Q.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Immune remodeling and atrial fibrillation</article-title>. <source>Front. Physiol.</source> <volume>13</volume>, <fpage>927221</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2022.927221</pub-id>
<pub-id pub-id-type="pmid">35936905</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yeh</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Kuo</surname>
<given-names>C. T.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>Y. S.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y. M.</given-names>
</name>
<name>
<surname>Nattel</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>F. C.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Region-specific gene expression profiles in the left atria of patients with valvular atrial fibrillation</article-title>. <source>Heart rhythm.</source> <volume>10</volume> (<issue>3</issue>), <fpage>383</fpage>&#x2013;<lpage>391</lpage>. <pub-id pub-id-type="doi">10.1016/j.hrthm.2012.11.013</pub-id>
<pub-id pub-id-type="pmid">23183193</pub-id>
</citation>
</ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Horuzsko</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Human inhibitory receptor immunoglobulin-like transcript 2 amplifies CD11b&#x2b;Gr1&#x2b; myeloid-derived suppressor cells that promote long-term survival of allografts</article-title>. <source>Transplantation</source> <volume>86</volume> (<issue>8</issue>), <fpage>1125</fpage>&#x2013;<lpage>1134</lpage>. <pub-id pub-id-type="doi">10.1097/TP.0b013e318186fccd</pub-id>
<pub-id pub-id-type="pmid">18946352</pub-id>
</citation>
</ref>
<ref id="B76">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Quan</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>CellMarker: a manually curated resource of cell markers in human and mouse</article-title>. <source>Nucleic Acids Res.</source> <volume>47</volume> (<issue>D1</issue>), <fpage>D721-D728</fpage>&#x2013;<lpage>d728</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gky900</pub-id>
<pub-id pub-id-type="pmid">30289549</pub-id>
</citation>
</ref>
<ref id="B77">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Sehgal</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>The multifaceted regulation of mitophagy by endogenous metabolites</article-title>. <source>Autophagy</source> <volume>18</volume> (<issue>6</issue>), <fpage>1216</fpage>&#x2013;<lpage>1239</lpage>. <pub-id pub-id-type="doi">10.1080/15548627.2021.1975914</pub-id>
<pub-id pub-id-type="pmid">34583624</pub-id>
</citation>
</ref>
<ref id="B78">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Xue</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Diminished &#x3b1;7 nicotinic acetylcholine receptor (&#x3b1;7nAChR) rescues amyloid-&#x3b2; induced atrial remodeling by oxi-CaMKII/MAPK/AP-1 axis-mediated mitochondrial oxidative stress</article-title>. <source>Redox Biol.</source> <volume>59</volume>, <fpage>102594</fpage>. <pub-id pub-id-type="doi">10.1016/j.redox.2022.102594</pub-id>
<pub-id pub-id-type="pmid">36603528</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>