<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Physiol.</journal-id>
<journal-title>Frontiers in Physiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Physiol.</abbrev-journal-title>
<issn pub-type="epub">1664-042X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1633251</article-id>
<article-id pub-id-type="doi">10.3389/fphys.2025.1633251</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Physiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Activation of Piezo1 and TRPV4 channels contributes to hCMEC/D3 cell mechano-sensing</article-title>
<alt-title alt-title-type="left-running-head">An et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphys.2025.1633251">10.3389/fphys.2025.1633251</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>An</surname>
<given-names>Wenhan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3186170/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Sun</surname>
<given-names>Min</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3186082/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Xiulin</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1032585/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Laigang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3186158/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Liu</surname>
<given-names>Hanwen</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2789565/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Cui</surname>
<given-names>Baojuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3183826/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Rehabilitation Medicine, The Second Hospital of Shandong University</institution>, <addr-line>Jinan</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Rehabilitation Medicine, The Affiliated Yantai Yuhuangding Hospital of Qingdao University</institution>, <addr-line>Yantai</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Urology, The Second Hospital of Shandong University</institution>, <addr-line>Jinan</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/157204/overview">Susumu Ohya</ext-link>, Nagoya City University, Japan</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/135053/overview">Olivia Garc&#xed;a Su&#xe1;rez</ext-link>, University of Oviedo, Spain</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/580590/overview">Maria Velasco-Estevez</ext-link>, Spanish National Cancer Research Center, Spain</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Hanwen Liu, <email>liuhanwen161616@163.com</email>; Baojuan Cui, <email>randomdarkbluetea@163.com</email>
</corresp>
<fn fn-type="equal" id="fn001">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>08</day>
<month>09</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1633251</elocation-id>
<history>
<date date-type="received">
<day>22</day>
<month>05</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>25</day>
<month>08</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 An, Sun, Zhang, Huang, Liu and Cui.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>An, Sun, Zhang, Huang, Liu and Cui</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>TRPV4 and Piezo1 channels have been considered two important mechanical sensors. To examine the role of these two channels in blood brain barrier (BBB) mechano-sensing, the expression and function of TRPV4 and PIEZO1 in hCMEC/D3, an <italic>in vitro</italic> model for human BBB endothelial cells, were investigated.</p>
</sec>
<sec>
<title>Methods</title>
<p>TRPV4 and PIEZO1 mRNA and protein expression were analysed by RT-PCR, immunofluorescence and western blot, respectively, while their mechano-sensing function was investigated by calcium imaging.</p>
</sec>
<sec>
<title>Results</title>
<p>Among the four mechano-sensing channels examined (TRPV2, TRPV4, PIEZO1 and Piezo2), TRPV4 and PIEZO1 were the two most abundantly expressed in hCMEC/D3 cells at the mRNA level. TRPV4 and PIEZO1 proteins were detected by immunofluorescence, western blot. The calcium imaging using channel-specific agonists/antagonists provided evidence of their function. Mechanical stimuli (poke or flow shear stress) induced a prominent increase in intracellular Ca<sup>2&#x2b;</sup>([Ca<sup>2&#x2b;</sup>]<sub>i</sub>) in hCMEC/D3 cells, which was significantly inhibited by application of selective TRPV4 or Piezo1 antagonists. Activation of PIEZO1 and TRPV4 using selective agonists resulted in the release of adenosine triphosphate (ATP) but not nitric oxide (NO). Extracellular ATP hydrolysis with apyrase, or blocking of P2X and P2Y purinoceptors with PPADS, significantly reduced mechanical stimulus-induced increases in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in both the stimulated cell and neighboring cells.</p>
</sec>
</abstract>
<kwd-group>
<kwd>ATP</kwd>
<kwd>human brain microvascular endothelial cells</kwd>
<kwd>mechanosensory transduction</kwd>
<kwd>Piezo1 channel</kwd>
<kwd>TRPV4 channel</kwd>
</kwd-group>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Cell Physiology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>The blood-brain barrier (BBB) is a highly selective lipophilic barrier located between the systemic circulation and brain tissue (<xref ref-type="bibr" rid="B1">Abbott, 2005</xref>); it is the largest interface for blood-brain exchange and has important roles in maintaining central nervous system (CNS) homeostasis. The BBB is mainly composed of human brain microvascular endothelial cells (HBMECs), pericytes, an astrocytic capillary layer surrounding the endothelium, and the basement membrane (<xref ref-type="bibr" rid="B43">Sweeney et al., 2019</xref>). HBMECs are important for BBB morphology, and at least 85% of the BBB surface area is derived from these cells, which have crucial functions in controlling BBB permeability and regulating brain microcirculation. Further, HBMECs have unique morphological, structural, and functional features that distinguish them from endothelial cells situated elsewhere in the body (<xref ref-type="bibr" rid="B12">Daneman and Prat, 2015</xref>).</p>
<p>The BBB can respond to various mechanical cues, such as blood flow induced shear stress (SS), pressure, and substrate stiffness (<xref ref-type="bibr" rid="B8">Choublier et al., 2022</xref>; <xref ref-type="bibr" rid="B49">Weksler et al., 2013</xref>; <xref ref-type="bibr" rid="B51">Yan et al., 2023</xref>). HBMECs detect and respond to this mechanical force by triggering several downstream biochemical signaling pathways that control different cellular properties under physiological and pathophysiological conditions (<xref ref-type="bibr" rid="B17">Fang et al., 2019</xref>). Thus, mechanical force on HBMECs has a key role in maintaining the structural and functional integrity of the BBB (<xref ref-type="bibr" rid="B19">Garcia-Polite et al., 2017</xref>; <xref ref-type="bibr" rid="B47">Wang et al., 2020</xref>); however, the molecular mechanism underlying BMEC sensing of mechanical force remains elusive.</p>
<p>Transient receptor potential (TRP) channels are important sensors of cellular responses to mechanical and chemical stimuli and temperature changes in various cell types. Among all the TRP channels, TRPV4 is considered a mechanical sensor, and the role of TRPV4 in sensing SS has been demonstrated in vascular endothelial cells (<xref ref-type="bibr" rid="B26">Li et al., 2015</xref>; <xref ref-type="bibr" rid="B38">Sonkusare et al., 2012</xref>; <xref ref-type="bibr" rid="B39">Sonkusare et al., 2014</xref>; <xref ref-type="bibr" rid="B52">Yang et al., 2020</xref>). For example, blood flow SS induces TRPV4 activation in endothelial cells, leading to carotid diastole, an effect that can be blocked using a selective TRPV4 antagonist. TRPV4 channels are abundantly expressed in the human BBB (<xref ref-type="bibr" rid="B31">Luo et al., 2021</xref>), and have a critical regulatory role in human BBB integrity (<xref ref-type="bibr" rid="B24">Kumar et al., 2020</xref>; <xref ref-type="bibr" rid="B31">Luo et al., 2021</xref>; <xref ref-type="bibr" rid="B30">Luo et al., 2020</xref>; <xref ref-type="bibr" rid="B33">Michinaga et al., 2021</xref>; <xref ref-type="bibr" rid="B36">Rosenkranz et al., 2020</xref>). TRPV4 expression in rat or human HBMECs has also been demonstrated (<xref ref-type="bibr" rid="B4">Berra-Romani et al., 2019</xref>; <xref ref-type="bibr" rid="B30">Luo et al., 2020</xref>); however, its role in mechano-transduction in HBMECs has yet to be examined.</p>
<p>Piezo1 and Piezo2 are mammalian mechano-transduction ion channels whose roles in various cell types, including endothelial cells, have been extensively studied in recent years (<xref ref-type="bibr" rid="B3">Beech and Kalli, 2019</xref>; <xref ref-type="bibr" rid="B10">Coste et al., 2012</xref>; <xref ref-type="bibr" rid="B13">Delmas et al., 2022</xref>; <xref ref-type="bibr" rid="B14">Douguet et al., 2019</xref>; <xref ref-type="bibr" rid="B48">Wang et al., 2022</xref>). In addition to sensing mechanical force, Piezo1 channels can be activated by the chemical agonist compound, Yoda1 (<xref ref-type="bibr" rid="B6">Botello-Smith et al., 2019</xref>); however, no specific agonist of Piezo2 has been discovered. Piezo1 channels mediate transient Ca<sup>2&#x2b;</sup> release in arterial endothelial cells and mice capillary endothelial cells in response to mechanical stimuli, such as SS (<xref ref-type="bibr" rid="B3">Beech and Kalli, 2019</xref>); a recent study showed that Piezo1 channels act as mechanosensors in central nervous system capillaries in mice (<xref ref-type="bibr" rid="B21">Harraz et al., 2022</xref>). However, to our knowledge, no study has investigated the expression and function of PIEZO1 channels in human HBMECs.</p>
<p>The immortalized human brain microvascular endothelial cell line, hCMEC/D3, exhibits key features of the BBB, has been proposed as a suitable <italic>in vitro</italic> model for BBB endothelial cells (<xref ref-type="bibr" rid="B49">Weksler et al., 2013</xref>), and is the most widely-used and best-characterized human BMEC cell line. In the present study, expression of TRPV4 and PIEZO1 channels in hCMEC/D3 cells at the mRNA, protein, and functional levels were examined using RT-PCR, immunohistochemistry, and Ca<sup>2&#x2b;</sup> imaging approaches, respectively. Most importantly, their roles in hCMEC/D3 mechano-sensing were also investigated.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Cell preparation</title>
<p>The hCMEC/D3 cell line was obtained from Jennio Bio (Guangzhou, China). Cells were plated in cell culture flasks, incubated in a 5% CO<sub>2</sub> atmosphere at 37 &#xb0;C, and culture medium (90% Dulbecco&#x2019;s Modified Eagle Medium High Glucose &#x2b; 10% fetal bovine serum; Gibco) changed every 2 days. Cells were used for experiments at passage 2&#x2013;8. For intracellular Ca<sup>2&#x2b;</sup> [Ca<sup>2&#x2b;</sup>]<sub>i</sub> measurement and immunofluorescence experiments, cells were plated onto glass coverslips (8 mm diameter) and grown to 80% and 50% confluence, respectively.</p>
</sec>
<sec id="s2-2">
<title>Single cell mechanical stimulation by poke</title>
<p>Cells on glass coverslips were placed in a chamber perfused with normal Hanks&#x2019; buffered saline solution (HBSS) containing (in mM): 138 NaCl, 5 KCl, 0.3 KH<sub>2</sub>PO<sub>4</sub>, 4 NaHCO<sub>3</sub>, 2 CaCl<sub>2</sub>, 1 MgCl<sub>2</sub>, 10 HEPES, and 5.6 glucose (pH 7.4). Mechanical stimulation of single cells was performed as described by <xref ref-type="bibr" rid="B34">Neuhaus et al. (2020)</xref>. To mechanically stimulate single cells, glass micropipettes with closed and rounded tips (approximately 2 &#x3bc;m) were used to deflect the plasma membrane. Glass micropipette movement was controlled using a motorized MP-285 micromanipulator (Sutter Instruments, Novato, CA, United States); when the tip was close to the cell, the micropipette was dropped in 2 &#x3bc;m increments, to induce membrane deflection.</p>
</sec>
<sec id="s2-3">
<title>Mechanical stimulation by flow SS</title>
<p>Cells on glass coverslips were perfused with a PE10 tube filled with HBSS. One end of the PE10 tube was connected to a 50 mL syringe pump (Genie touch, Kent Scientific Co.) and the other end was mounted on the probe of a patch-clamp recording platform (EPC10, HEKA Electronik, Lambrecht/Pfalz). The probe approached the cells at a 45&#xb0; angle, controlled using a MP-285 micromanipulator (Sutter Instrument) and with the tip of the PE10 tube 30&#x2013;50 &#x3bc;m away from the stimulated cells (<xref ref-type="fig" rid="F1">Figure 1C</xref>). Flow SS was induced by changing the perfusion flow rate from 2 to 20 mL/min.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Poke and flow shear stress evoked an [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase in hCMEC/D3 cells. <bold>(A,B)</bold> A single hCMEC/D3 cell (Cell 1) was stimulated with a finely closed round glass micropipette tip (indicated by the star), which evoked an increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in the stimulated cell and in surrounding cells (cells 2 and 3). The amplitude of the [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase reduced with distance from the stimulated cell (that in cell 2 was greater than that in cell 3). <bold>(C,D)</bold> Flow shear stress (SS) stimulation evoked an [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase in a group of hCMEC/D3 cells. SS was administered by changing the flow rate from 2 to 20 mL/min. [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase is expressed as the ratio of fluorescence at 340 and 380 nm (F340/F380). Scale bar &#x3d; 20 &#x3bc;m.</p>
</caption>
<graphic xlink:href="fphys-16-1633251-g001.tif">
<alt-text content-type="machine-generated">A set of scientific images showing fluorescence micrographs and corresponding line graphs. Panel A shows two fluorescence micrographs with blue stains, featuring labeled regions marked with numbers one to three. Panel B displays line graphs depicting the ratio of 340/380 wavelengths over ten seconds for the labeled regions in panel A. Panel C includes another set of fluorescence micrographs, with labeled areas one to three, and an indication marked &#x22;PE10.&#x22; Panel D presents line graphs corresponding to panel C, showing similar data over ten seconds.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s2-4">
<title>Ca<sup>2&#x2b;</sup> imaging</title>
<p>Ca<sup>2&#x2b;</sup> imaging experiment was conducted as described in our previous study (<xref ref-type="bibr" rid="B50">Wen et al., 2018</xref>). In brief, hCMEC/D3 cells on glass coverslips (n &#x3d; 50&#x2013;60 cells) were loaded with 1 &#xb5;M fura-2/AM for 30&#x2013;45 min at 37 &#xb0;C in normal HBSS. Subsequently, cells were washed with HBSS to remove excessive external fura-2 dye. The glass coverslip was then mounted on a stage equipped with an inverted fluorescence microscope and HCMEC/D3 cells continuously perfused with HBSS driven by gravity. Cells were exposed to alternating 340- and 380-nm wavelength (bandwidth, 10 nm) ultraviolet light (1/s). Excitation time and image acquisition were controlled using Meta Fluor R (Molecular Devices, Sunnyvale, CA, United States). Data were analyzed using program C-Imaging (Compix). Background was subtracted to minimize camera dark noise. The ratio of fluorescence signal measured at 340 nm divided by the fluorescence signal measured at 380 nm was used to measure the increase of intracellular Ca<sup>2&#x2b;</sup>. Baseline intracellular Ca<sup>2&#x2b;</sup> concentration was determined from the average of five to eight measurements obtained before drug application. Amplitudes of peak Ca<sup>2&#x2b;</sup> responses were computed as the difference between the peak value and the baseline value (&#x394;340/380). A significant increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> was considered if the ratio changed by &#x3e;0.1.</p>
</sec>
<sec id="s2-5">
<title>RT-qPCR</title>
<p>Total RNA was extracted from cultured cells using an RNA Simple Total RNA kit (YISHAN, Shanghai, China), according to the manufacturer&#x2019;s instructions. An ultraviolet spectrophotometer was used to determine RNA concentrations. Reverse transcription was conducted using 1 &#xb5;g RNA with the HiScript III RT SuperMix kit (Vazyme, Nanjing, China), and complimentary-DNA was used for RT-qPCR amplification. TRP and Piezo1 channel mRNA levels were measured by qPCR using SYBR qPCR Master Mix (Vazyme) and a QuantStudio&#x2122; 5 system (Thermo Fisher, Waltham, MA, United States), with the following cycling conditions: initial denaturation at 95 &#xb0;C (2 min) followed by 40 cycles of denaturation at 95 &#xb0;C (15 s) and combined annealing and extension at 60 &#xb0;C (30 s). Primers for TRP and Piezo channels were generated by Sangon Biotech (Shanghai, China); the sequences are shown in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Oligonucleotide primer sets for quantitative real-time PCR.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Name</th>
<th align="center">Sequence (5&#x2032;&#x2013;3&#x2032;)</th>
<th align="center">Length (nt)</th>
<th align="center">T<sub>m</sub>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Piezo1 F</td>
<td align="center">ACTTTCCCATCAGCACTCGG</td>
<td align="center">20</td>
<td align="center">64</td>
</tr>
<tr>
<td align="left">Piezo1 R</td>
<td align="center">CCACGAAGTCCTTGAGACCC</td>
<td align="center">20</td>
<td align="center">64</td>
</tr>
<tr>
<td align="left">TRPV2 F</td>
<td align="center">TCGCTGTATGACCTGGCTTC</td>
<td align="center">20</td>
<td align="center">62</td>
</tr>
<tr>
<td align="left">TRPV2 R</td>
<td align="center">GCTCCAAAACGACCATTCGG</td>
<td align="center">20</td>
<td align="center">62</td>
</tr>
<tr>
<td align="left">TRPV4 F</td>
<td align="center">TCTCACCGCCTACTACCAGC</td>
<td align="center">20</td>
<td align="center">62</td>
</tr>
<tr>
<td align="left">TRPV4 R</td>
<td align="center">GTAGAGGGCTGCTGAGACGA</td>
<td align="center">20</td>
<td align="center">64</td>
</tr>
<tr>
<td align="left">&#x3b2;-Actin F</td>
<td align="center">CATGTACGTTGCTATCCAGGC</td>
<td align="center">21</td>
<td align="center">57.6</td>
</tr>
<tr>
<td align="left">&#x3b2;-Actin R</td>
<td align="center">CTCCTTAATGTCACGCACGAT</td>
<td align="center">21</td>
<td align="center">55.6</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>The relative expression of target genes was calculated by the 2<sup>&#x2212;&#x394;&#x394;CT</sup>, method. nt, nucleotides; T<sub>m</sub>, melting temperature.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2-6">
<title>Immunofluorescence staining</title>
<p>hCMEC/D3 cells were fixed with 4% paraformaldehyde for 10 min at room temperature, then washed three times at room temperature using phosphate-buffered saline (PBS) and blocked with 5% normal goat serum for 30 min at room temperature. Cells were mixed with Piezo1 antibody (1:100; 15939-1-AP; Proteintech, China), TRPV4 (1:100; DF8624; Affinity Biosciences, China) and LAT1 (1:100; sc-374232; Santa Cruz Biotechnology, United States) overnight at 4 &#xb0;C followed by 594-conjugated Goat Anti-Mouse IgG (H &#x2b; L, 1:100; ABclonal, China) and Plus 488-Goat Anti-Rabbit Recombinant Secondary Antibody (H &#x2b; L, 1:100; Proteintech, China) for 1 h at room temperature. Human brain tissue was obtained from one patient who underwent glioma resection surgery and written informed consent was provided by the patient. Brain tissue was fixed with 4% paraformaldehyde and 5 &#xb5;m tissue slices were prepared for immunofluorescence staining as for hCMEC/D3 cells. The specificity of the antibodies for TRPV4 and Piezo1 have already been verified by the companies and the literature reports (<xref ref-type="bibr" rid="B15">Eisenhoffer et al., 2012</xref>). The immunofluorescence staining was analyzed using the Olympus BX53 positive fluorescence microscope (Olympus Corporation, Japan).</p>
</sec>
<sec id="s2-7">
<title>Western blotting</title>
<p>The total protein was extracted using RIPA lysis buffer (NCM Biotech, China) containing proteinase inhibitors. The protein concentration was determined using bicinchoninic acid (BCA) kit (Epizyme Biotech, China). The samples were separated by sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene fluoride (PVDF) membranes by wet transfer. The membranes were incubated overnight at 4 &#xb0;C with primary antibodies against the following proteins: Piezo1 (1:1,000; A23380; ABclonal, China), TRPV4 (1:1,000; A5660; ABclonal, China) and &#x3b2;-actin (1:5,000, AC026; ABclonal, China). After incubation with specific secondary antibodies, proteins were detected with an enhanced chemiluminescence kit (Millipore, Germany).</p>
</sec>
<sec id="s2-8">
<title>Mechanical stress experiments</title>
<p>A custom-designed pressure system was employed to apply pressure stimulation. Briefly, the hCMEC/D3 cells were seeded on 6-well plates reached &#x3e; 90% confluence before pressure exposure. The cells were exposed to mechanical pressure of 100 cm H<sub>2</sub>O at a frequency of 1 Hz (induced by pneumatic elements). Previous research from our lab confirmed that the pH, pO2, and pCO2 of the culture supernatants were not affected by the application of hydrostatic pressure at levels similar to those used in this study.</p>
</sec>
<sec id="s2-9">
<title>Nitric oxide (NO) and ATP measurement</title>
<p>When cells cultured in 6-well plates reached &#x3e; 90% confluence, they were stimulated with mechanical and pharmacological stimulation. Culture supernatants were obtained 2 min before and 1 min after stimulation.</p>
<p>NO concentration was determined with NO Colorimetric Assay Kit (Elabscience, Wuhan, China). Color developer (80 &#x3bc;L) was added to 160 &#x3bc;L sample, according to the manufacturer&#x2019;s instructions. Samples were mixed and allowed to stand for 15 min and the absorbance values of each well at 550 nm measured following labelling with an enzyme marker. ATP concentration was determined with CellTiterGlo&#x2122; Luminescent Cell Viability Assay kit (Promega, Fitchburg, WI, United States). Samples were analyzed using a GloMax&#x2122; 20/20 luminometer (Promega).</p>
</sec>
<sec id="s2-10">
<title>Chemicals</title>
<p>The following drugs were used: Yoda1 (MCE, China), Dooku1 (TargetMOI, China), GSK (MCE, China), HC067047 (TargetMOI, China), PPADS (MCE, China), and apyrase (Sigma-Aldrich, China); drugs were stored at &#x2212;20 &#xb0;C before use. Dilutions were made with deionized water or DMSO on the day of experiments. The final concentrations of DMSO were &#x3c;0.1%. In all experimental groups, at least one parallel control experiment was performed in the presence of the carrier, which had no pharmacological effect on either tension or agonist-induced contraction of the preparations. Chemicals were used in concentrations shown to be effective in preliminary experiments or in concentrations used in previously published studies (<xref ref-type="bibr" rid="B42">Swain et al., 2020</xref>; <xref ref-type="bibr" rid="B53">Zhao et al., 2021</xref>).</p>
</sec>
<sec id="s2-11">
<title>Statistical analyses</title>
<p>Continuous variables are expressed as mean &#xb1; SD. Differences between two groups were analyzed by paired or unpaired t-test. Excel&#x2122; (Microsoft, Redmond, WA, United States) and Prism 8.0.2 (GraphPad, San Diego, CA, United States) were used for analyses. Differences were considered statistically significant when p &#x3c; 0.05.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Mechanical stimulation evoked an [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase in hCMEC/D3 cells</title>
<p>To determine whether hCMEC/D3 cells are responsive to mechanical stimuli, we poked individual hCMEC/D3 cells with a glass micropipette (the tip of the pipette was indicated by the star in <xref ref-type="fig" rid="F1">Figure 1A</xref>) and recorded the change in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> using a Ca<sup>2&#x2b;</sup> imaging method. We found that poke stimulus evoked a rapid increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in stimulated cell (cell 1 in <xref ref-type="fig" rid="F1">Figure 1B</xref>). Surprisingly, cells neighboring the stimulated cell also exhibited increased [Ca<sup>2&#x2b;</sup>]<sub>i</sub> (cell 2 and cell 3 in <xref ref-type="fig" rid="F1">Figures 1A,B</xref>), and the [Ca<sup>2&#x2b;</sup>]<sub>i</sub> peak amplitude increase in neighboring cells reduced with distance from the stimulated cell (<xref ref-type="fig" rid="F1">Figure 1B</xref>). These data suggest that elevated [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in mechanically stimulated cells leads to release of a transmitter that acts on neighboring cells, thereby propagating a Ca<sup>2&#x2b;</sup> wave from one cell to the next.</p>
<p>hCMEC/D3 cells were also responsive to flow SS stimulation (<xref ref-type="fig" rid="F1">Figures 1C,D</xref>); however, the amplitude of [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase induced by SS was relatively less than that provoked by poke stimulation (<xref ref-type="fig" rid="F1">Figure 1B</xref> vs. <xref ref-type="fig" rid="F1">1D</xref>).</p>
</sec>
<sec id="s3-2">
<title>mRNA and protein expression of mechano-sensing channels in cultured hCMEC/D3 cells</title>
<p>To examine which channels mediate the [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase triggered by mechanical stimuli in hCMEC/D3 cells, the expression levels of several mechanical sensing channels were first investigated in cultured hCMEC/D3 cells at the mRNA level by RT-qPCR. RT-qPCR experiments showed that the relative mRNA expression levels of PIEZO1 and TRPV4 were highest, while those of TRPV2 and Piezo2 were relatively low (<xref ref-type="fig" rid="F2">Figure 2D</xref>). Accordingly, immunofluorescence and western bolt experiments revealed prominent staining for PIEZO1 and TRPV4 channels in cultured hCMEC/D3 cells (<xref ref-type="fig" rid="F2">Figures 2A,B</xref>) stained with L-type amino acid transporter 1 (LAT1), one specific marker of HBMECs. To note, prominent staining of Piezo1 and TRPV4 channels were also found on microvascular endothelial cells of the human brain tissue (<xref ref-type="fig" rid="F2">Figure 2C</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>mRNA and protein expression of Piezo1 and TRPV4 in cultured hCMEC/D3 cells. <bold>(A)</bold> Immunofluorescence labeling showing Piezo1 and TRPV4 channels (green) are expressed on hCMEC/D3 cells. hCMEC/D3 cells were marked with the specific marker LAT1 (red), and their co-expression is shown in yellow. The nucleus marker (DAPI) is stained in blue. Scale bar &#x3d; 100 &#x3bc;m. <bold>(B)</bold> Western blot showing Piezo1 and TRPV4 channels are expressed on hCMEC/D3 cells. <bold>(C)</bold> Immunofluorescence labeling showing Piezo1 and TRPV4 channels (green) are expressed on microvascular endothelial cells of human brain. The human brain microvascular endothelial cells were marked with the specific marker LAT1 (red), and their co-expression is shown in yellow. Scale bar &#x3d; 100 &#x3bc;m. <bold>(D)</bold> Relative mRNA expression of mechano-sensing Piezo1, Piezo2, TRPV2, and TRPV4 channels. Total RNA was extracted from cultured hCMEC/D3 cells and subjected to RT-qPCR. The relative mRNA expression levels of Piezo1 and TRPV4 were higher than those of TRPV2 and Piezo2. Because the expression level of the observed channels was much lower than that of beta-actin, the mRNA expression of each channel was expressed as a relative level to that of TRPV2.</p>
</caption>
<graphic xlink:href="fphys-16-1633251-g002.tif">
<alt-text content-type="machine-generated">Panel A shows immunofluorescence images with TRPV4 and PIEZO1 in green, LAT1 in red, and merged images of cells. Panel B displays Western blot results for PIEZO1, TRPV4, and &#x3B2;-actin, with molecular weights labeled. Panel C presents immunofluorescence of TRPV4 and PIEZO1 with LAT1, highlighted in separate and merged colors. Panel D is a bar graph showing relative mRNA levels of Piezo1, Piezo2, TRPV2, and TRPV4, with Piezo1 and TRPV4 levels noticeably higher.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3">
<title>Piezo1 and TRPV4 channels are functionally expressed in cultured hCMEC/D3 cells</title>
<p>Functional expression of Piezo1 and TRPV4 channels was examined by Ca<sup>2&#x2b;</sup> imaging using specific selective agonists (<xref ref-type="fig" rid="F3">Figure 3</xref>). Treatment of cultured hCMEC/D3 cells (n &#x3d; 180) with the Piezo1-specific agonist, Yoda 1 (30 &#xb5;M), induced a significant increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> (<xref ref-type="fig" rid="F3">Figure 3A</xref>), and this effect of Yoda 1 on [Ca<sup>2&#x2b;</sup>]<sub>
<italic>i</italic>
</sub> was significantly diminished following pretreatment of cultured hCMEC/D3 cells with DooKu1 (10 &#xb5;M), a Piezo1 antagonist (<xref ref-type="bibr" rid="B16">Evans et al., 2018</xref>) (<xref ref-type="fig" rid="F3">Figures 3B,C</xref>). Application of GSK1016790A (GSK, 500 nM), a specific agonist of the TRPV4 channel, to cultured hCMEC/D3 cells (n &#x3d; 165), induced a significant increase in [Ca<sup>2&#x2b;</sup>]<sub>I</sub> (<xref ref-type="fig" rid="F3">Figure 3D</xref>), which was significantly blocked after pretreatment of cells with the TRPV4 specific antagonist, HC-067047 (1 &#xb5;M) (<xref ref-type="fig" rid="F3">Figures 3E,F</xref>). Together, the above findings suggest that Piezo1 and TRPV4 channels may be responsible for sensing mechanical stimuli in cultured hCMEC/D3 cells.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Piezo1 and TRPV4 channels are functional in hCMEC/D3 cells. <bold>(A&#x2013;C)</bold> The specific agonist of Piezo1 channels, Yoda 1 (30 &#xb5;M), evoked an increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> <bold>(A)</bold>, which was significantly inhibited by pretreatment with Dooku1 (10 &#xb5;M), a specific antagonist of Piezo1 channels <bold>(B)</bold>. Summary data are shown in <bold>(C)</bold>. <bold>(D&#x2013;F)</bold> The specific agonist of TRPV4 channels, GSK1016790A (GSK, 500 nM), evoked an [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase <bold>(D)</bold> in hCMEC/D3 cells, which was significantly inhibited by pretreatment with HC067047 (10 &#xb5;M), a specific antagonist of TRPV4 channels <bold>(E)</bold>. Summary data are shown in <bold>(F)</bold>. Numbers above each column indicate the numbers of cells. &#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001.</p>
</caption>
<graphic xlink:href="fphys-16-1633251-g003.tif">
<alt-text content-type="machine-generated">Graphs showing the effect of Yoda1 and GSK on the 340/380 ratio over time. Panels A and D depict increases in the ratio with Yoda1 (30 &#x3BC;M) and GSK (500 nM) respectively. Panels B and E illustrate reduced changes when Dooku1 or HC067047 are added alongside Yoda1 and GSK. Scatter plots C and F display statistical comparisons, indicating significant differences (&#x2a;&#x2a;&#x2a;&#x2a;) between treatments.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<title>Inhibition of Piezo1 and TRPV4 channels reduced poke-and SS-induced increases in [Ca<sup>2&#x2b;</sup>]<sub>i</sub>
</title>
<p>To investigate the involvement of Piezo1 and TRPV4 in hCMEC/D3 cell mechanical responses, the effects of Piezo1 and TRPV4 antagonists on poke- or SS-induced [Ca<sup>2&#x2b;</sup>]<sub>i</sub> were analyzed. As expected, poke-induced [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increases was significantly reduced in the presence of Piezo1 (DooKu1, 10 &#x3bc;M) and TRPV4 (HC-067047, 1 &#x3bc;M) antagonists (<xref ref-type="fig" rid="F4">Figures 4A&#x2013;D</xref>) in both stimulated and neighboring cells. SS-induced increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> were also significantly reduced in the presence of Piezo1 and TRPV4 antagonists (<xref ref-type="fig" rid="F4">Figures 4E,F</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Inhibition of Piezo1 and TRPV4 channels attenuated poke-or SS-evoked increases in [Ca<sup>2&#x2b;</sup>]<sub>i</sub>. <bold>(A,B)</bold> Typical traces <bold>(A)</bold> and summary data <bold>(B)</bold> showing that pretreatment with Piezo1 antagonist (Dooku1, 10 &#xb5;M) reduced the increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> induced by poke stimulation in stimulated and neighboring cells. <bold>(C,D)</bold> Typical traces <bold>(C)</bold> and summary data <bold>(D)</bold> show that pretreatment with TRPV4 antagonist (HC067047, 1 &#xb5;M) reduced the increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> induced by poke stimulation in stimulated and neighboring cells. <bold>(E,F)</bold> Typical traces <bold>(E)</bold> and summary data <bold>(F)</bold> indicating that pretreatment with Piezo1 (Dooku1, 10 &#xb5;M) or TRPV4 (HC067047, 1 &#xb5;M) antagonists reduced SS stimulation evoked increases in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in hCMEC/D3 cells. &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001.</p>
</caption>
<graphic xlink:href="fphys-16-1633251-g004.tif">
<alt-text content-type="machine-generated">Graphs illustrate calcium signaling measurements. A) Line graphs show stimulated and neighboring cell responses post-poke and with Dooku1 treatment. B) Dot plots compare &#x394;Ratio 340/380 of stimulated and neighboring cells under poke and Dooku1 conditions, showing significant differences.C) Line graphs similar to A, adding HC067047 treatment.D) Dot plots as in B, with HC067047 conditions. E) Line graphs display responses with Dooku1 and HC067047 over 60 seconds multiple trials.F) Dot plots show &#x394;Ratio 340/380 with self stimulation (SS), Dooku1, and HC067047, indicating significance levels.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<title>Agonists of TRPV4 and Piezo1 channels evoked ATP secretion from cultured hCMEC/D3 cells</title>
<p>As demonstrated by the results presented in <xref ref-type="fig" rid="F1">Figure 1</xref>, cells surrounding poked cells also showed increases in [Ca<sup>2&#x2b;</sup>]<sub>i</sub>, suggesting the release of a transmitter from the poked cell that influences the surrounding cells in a paracrine manner.</p>
<p>NO is considered a transmitter in cerebrovascular endothelial cells, and is released in response to [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase (<xref ref-type="bibr" rid="B5">Boedtkjer et al., 2011</xref>; <xref ref-type="bibr" rid="B23">Kawano et al., 2007</xref>; <xref ref-type="bibr" rid="B28">Lin et al., 2013</xref>). To determine whether NO was involved, we measured NO concentrations in culture supernatants before and after TRPV4 and piezo1 agonist stimulation. Unexpectedly, no significant change in NO concentration was detected after stimulation with the Piezo1 agonist, Yoda1 (30 &#x3bc;M), or the TRPV4 agonist, GSK (500 nM) (<xref ref-type="fig" rid="F5">Figure 5A</xref>).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Activation of TRPV4 and Piezo1 channels evoked ATP release from cultured hCMEC/D3 cells. <bold>(A,B)</bold> Supernatant samples were collected 2 min before and 1 min after stimulation with Yoda-1 (30 &#xb5;M) and GSK (500 nM) for 2 min and NO <bold>(A)</bold> and ATP <bold>(B)</bold> concentrations in the culture supernatants measured. <bold>(C,D)</bold> Supernatant samples were collected 2 min before and 1 min after stimulation with hydrostatic pressure (100 cmH<sub>2</sub>O for 1 min) and NO <bold>(C)</bold> and ATP <bold>(D)</bold> concentrations in the culture supernatants measured. Data presented in each graph are mean values from five culture dishes. &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001.</p>
</caption>
<graphic xlink:href="fphys-16-1633251-g005.tif">
<alt-text content-type="machine-generated">Bar graphs showing concentration measurements. (A) NO concentration in control, Yoda1, and GSK groups, with no significant difference. (B) ATP concentration significantly higher in Yoda1 and GSK groups compared to control. (C) NO concentration in control and hydrostatic pressure groups, showing no significant difference. (D) ATP concentration significantly higher in hydrostatic pressure group compared to control. Data represented with individual dots for values, error bars, and significance markers.</alt-text>
</graphic>
</fig>
<p>ATP is another transmitter involved in endothelial cell communication (<xref ref-type="bibr" rid="B40">Subauste, 2019</xref>). To assess ATP involvement in the observed phenomenon, we next measured ATP concentrations in culture supernatants before and after TRPV4 and Piezo1 agonist stimulation. As expected, application of the Piezo1 agonist, Yoda1 (30 &#xb5;M), and the TRPV4 agonist GSK (500 nM), resulted in a significant increase in ATP concentration (<xref ref-type="fig" rid="F5">Figure 5B</xref>).</p>
<p>To further confirm our findings, we conducted mechanical stress experiments. We measured the concentrations of ATP and NO in the culture supernatants before and after mechanical stimulation. Consistent with our pharmacological stimulation results, mechanical stimulation also led to an increase in ATP concentration (<xref ref-type="fig" rid="F5">Figure 5D</xref>), while NO levels remained unchanged (<xref ref-type="fig" rid="F5">Figure 5C</xref>).</p>
</sec>
<sec id="s3-6">
<title>Release of ATP contributes to poke-induced [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase in both autocrine and paracrine manners</title>
<p>As previously demonstrated in peripheral vessel endothelial cells (<xref ref-type="bibr" rid="B27">Lillo et al., 2018</xref>), ATP also induced an increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in cultured hCMEC/D3 cells, and this ATP-evoked [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase could be reduced using the non-selective P2X and P2Y receptor blocker, pyridoxal-6-phenyl-2&#x2032;,4&#x2032;-disulfonic acid (PPADS). To investigate whether released ATP contribute to poke-induced [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase in an autocrine manner, the ATP-diphosphate hydrolase, apyrase, which can degrade extracellular ATP to ADP, and PPADS were applied. Pretreatment with apyrase (10 U/mL) and PPADS (10 &#x3bc;M) significantly inhibited the poke-induced increase in [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in both poked and surrounding cells (<xref ref-type="fig" rid="F6">Figure 6</xref>).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Release of ATP contributed to poke-induced [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase. <bold>(A,B)</bold> Typical traces <bold>(A)</bold> and summary data <bold>(B)</bold> demonstrating that application of apyrase (10 U/mL) to hydrolyze extracellular ATP reduced poke-induced [Ca<sup>2&#x2b;</sup>]<sub>I</sub> increase in stimulated and neighboring cells. <bold>(C,D)</bold> Typical traces <bold>(C)</bold> and summary data <bold>(D)</bold> showing that application of PPADS (10 &#x3bc;M), a common P2 receptor antagonist, reduced the poke-induced [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase in both stimulated and neighboring cells. Numbers above each bar indicate numbers of cells. &#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01.</p>
</caption>
<graphic xlink:href="fphys-16-1633251-g006.tif">
<alt-text content-type="machine-generated">Graphical data showing calcium response ratios (340/380) in stimulated and neighboring cells. Graphs A (left) depict responses to a poke, with apyrase affecting ratios. Graph C (left) shows PPADS effects. Graphs B and D (right) show statistical differences with asterisks indicating significance levels between poke treatments: both show reduced response with apyrase or PPADS.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>In the present study, we examined the expression of mechano-sensing TRPV4 and Piezo1 channels and their roles in the most widely-used and best-characterized human BMEC cell line, hCMEC/D3. Our major findings are: (1) Among mechano-sensing channels, TRPV4 and Piezo1 are more abundantly expressed than TRPV2 and Piezo2, which is consistent with previous reports of rodent (<xref ref-type="bibr" rid="B44">Vanlandewijck et al., 2018</xref>); (2) Activation of TRPV4 and Piezo1 channels contributes to mechanical stimulus-evoked [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase; (3) Activation of TRPV4 or Piezo1 channels induced ATP release from hCMEC/D3 cells; and (4) mechanical stimulus-induced responses in a single cell can elicit responses in surrounding cells by a paracrine mechanism involving ATP secretion. The expression and function of Piezo1 in brain endothelial cells have been studied in rodents (<xref ref-type="bibr" rid="B21">Harraz et al., 2022</xref>). To the authors&#x2019; knowledge, this is the first study to reveal the roles of Piezo1 and TRPV4 in mechano-transduction in hCMEC/D3 cells. Our results provide further evidence for an active role of HBMECs in mechano-transduction at the BBB.</p>
<p>Common <italic>in vitro</italic> methods of cellular mechano-stimulation include stretching cells with various custom-designed devices, exposing cells to high hydrostatic pressure, applying shear force to the cell surface, or poking cells with a glass micropipette (<xref ref-type="bibr" rid="B11">Dalghi et al., 2021</xref>; <xref ref-type="bibr" rid="B34">Neuhaus et al., 2020</xref>). In our study, we applied two mechanical modalities: poking and flow induced SS. We found that both stimuli can elicit cellular responses, manifesting as a transient [Ca<sup>2&#x2b;</sup>]<sub>i</sub> elevation in hCMEC/D3. Poking is reported to be approximately 20-fold better at increasing membrane tension than use of membrane suction for mechano-sensing channel activation (<xref ref-type="bibr" rid="B9">Coste et al., 2010</xref>; <xref ref-type="bibr" rid="B20">Guan et al., 2018</xref>; <xref ref-type="bibr" rid="B24">Kumar et al., 2020</xref>). In hCMEC/D3 cells, we also found that poke stimulus evoked a larger [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase than SS (<xref ref-type="fig" rid="F1">Figure 1B</xref> vs. <xref ref-type="fig" rid="F1">Figure 1D</xref>). Moreover, compared with SS, poke stimulus can be finely controlled (2 &#x3bc;m steps). Thus, although SS has been considered the standard physical stimulation method for HBMECs, poke was used as the mechanical stimulus in most of our experiments.</p>
<p>The BBB can respond to various mechanical forces, such as SS, pressure, and substrate stiffness. The role of SS in regulating BBB structure and function has been extensively studied (<xref ref-type="bibr" rid="B19">Garcia-Polite et al., 2017</xref>; <xref ref-type="bibr" rid="B37">Siddharthan et al., 2007</xref>; <xref ref-type="bibr" rid="B47">Wang et al., 2020</xref>). There is evidence that capillary-like SS promotes BBB function and facilitates the differentiation of vascular endothelial cells into a BBB phenotype (<xref ref-type="bibr" rid="B35">Rochfort et al., 2015</xref>), while high SS, due to systemic vascular disease or cerebral bypass graft, led to barrier disruption (<xref ref-type="bibr" rid="B19">Garcia-Polite et al., 2017</xref>). Matrix stiffness can regulate the local permeability of HBMECs (<xref ref-type="bibr" rid="B51">Yan et al., 2023</xref>); however, to our knowledge, no study has examined the molecular mechanism involved in mechano-sensing of HBMECs. The most important finding of our study is that Piezo1 and TRPV4 are involved in mechano-transduction in HBMECs. The supporting evidence includes: (1) TRPV4 and Piezo1 mRNA expression levels are the highest among mechano-sensing channels (<xref ref-type="fig" rid="F1">Figure 1</xref>); (2) TRPV4 and Piezo1 protein expression were revealed both in HBMECs and in microvascular endothelial cells of human brain tissue (<xref ref-type="fig" rid="F1">Figures 1</xref>, <xref ref-type="fig" rid="F2">2C</xref>); (3) TRPV4 and Piezo1 are functional in hCMEC/D3 cells, as demonstrated by the fact that TRPV4 or Piezo1 agonists evoked [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase; and, most importantly, (4) [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase evoked by mechanical stimulation was significantly blocked by selective antagonists of TRPV4 or Piezo1 (<xref ref-type="fig" rid="F4">Figure 4</xref>). Therefore, the effects of mechanical force on BBB structure and function are likely mediated by opening of TRPV4 and Piezo1 channels and subsequent [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase.</p>
<p>Piezo1 channels have been shown to function as physiological sensors of blood flow (SS) in peripheral endothelial cells (<xref ref-type="bibr" rid="B25">Li et al., 2014</xref>). Endothelial Piezo1 mediates pressure-induced lung vascular hyperpermeability via disruption of adherens junctions (<xref ref-type="bibr" rid="B18">Friedrich et al., 2019</xref>). Further, TRPV4 serves as a mechanosensitive channel in endothelial cells that can mediate shear stress induced [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increases, leading to the release of endothelial relaxing factors and dilation of small resistance arteries (<xref ref-type="bibr" rid="B2">Bagher et al., 2012</xref>; <xref ref-type="bibr" rid="B32">Mendoza et al., 2010</xref>; <xref ref-type="bibr" rid="B38">Sonkusare et al., 2012</xref>). Our data indicate that Piezo1 and TRPV4 channels serve as mechanosensors with similar roles in HBMECs to those described in peripheral endothelial cells (<xref ref-type="bibr" rid="B7">Caolo et al., 2020</xref>; <xref ref-type="bibr" rid="B25">Li et al., 2014</xref>). More interestingly, in one recent study, Piezo1 was reported to act as an upstream mediator of TRPV4 activation in endothelial cells in response to SS (<xref ref-type="bibr" rid="B41">Swain and Liddle, 2021</xref>); however, we did not test this possibility in HBMECs, as it is beyond our research interest.</p>
<p>HBMECs detect and respond to mechanical stimuli by triggering several downstream biochemical signaling pathways that control various cellular properties under physiological and pathophysiological conditions. Consistently, we found that activation of TRPV4 or Piezo1 channels with specific agonists induced the release of ATP (<xref ref-type="fig" rid="F5">Figure 5B</xref>). This finding is also in agreement with recent reports showing that Piezo1 channel activation can induce ATP production in peripheral vascular endothelial cells (<xref ref-type="bibr" rid="B22">Jiang et al., 2023</xref>; <xref ref-type="bibr" rid="B46">Wang et al., 2016</xref>); however, unlike those studies, we found no evidence that Piezo1 activation is involved in NO release from hCMEC/D3 cells (<xref ref-type="bibr" rid="B46">Wang et al., 2016</xref>), suggesting that downstream signals in response to mechanical stimuli may differ between peripheral and cerebral endothelial cells.</p>
<p>Another important finding of our study is that mechanical stimulation of a single hCMEC/D3 cell can result in increased [Ca<sup>2&#x2b;</sup>]<sub>i</sub> in cells neighboring the stimulated cell, mediated by a paracrine ATP-secretion mechanism. Furthermore, we found that ATP release could further enhance the response to mechanical stimulation in an autocrine manner, as blocking the P2X and P2Y purinoceptors with PPADS or ATP hydrolase with apyrase significantly reduced the [Ca<sup>2&#x2b;</sup>]<sub>i</sub> increase in both stimulated and neighboring cells (<xref ref-type="fig" rid="F6">Figure 6</xref>). Therefore, ATP may act as an amplifier of mechanical stimulation signal responses in hCMEC/D3 cells. Released ATP can activate both ionotropic (ligand-gated ion channels, i.e., the P2X family) and metabotropic (i.e., the P2Y family) receptors (<xref ref-type="bibr" rid="B29">Locovei et al., 2007</xref>; <xref ref-type="bibr" rid="B45">von K&#xfc;gelgen and Hoffmann, 2016</xref>); however, we did not specifically detect which purinergic receptors are involved in these processes, and further clarification is warranted in future studies.</p>
<p>Limitations of our study: (1) only pharmacological approach has been used to block Piezo1 and TRPV4 channel activity, and no molecular approach such as siRNA knockdown has been applied to confirm our findings. (2) although SS may be a more physiologically relevant mechanical stimuli, however in most of our experiments, poke has been used. The reason is that poke stimuli could be finely controlled in our setup.</p>
<p>In summary, in this study we identified TRPV4 and Piezo1 channels as important mechanosensors in hCMEC/D3 cells. Further, our data reveal that paracrine and autocrine ATP release are important mechanisms involved in hCMEC/D3 cell mechanical sensing. In recent years, there has been considerable interest in the effects of mechanical force, such as cerebral vascular flow, in regulating the structure and function of the BBB under physiological and pathological conditions. Thus, revealing the pathological role of TRPV4 and Piezo1 in mechanical force alteration associated with BBB dysfunction has potential to facilitate development of new protective and restorative cerebral vascular interventional therapies.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>WA: Conceptualization, Data curation, Investigation, Software, Validation, Visualization, Writing &#x2013; original draft. MS: Investigation, Software, Validation, Writing &#x2013; original draft. XZ: Conceptualization, Funding acquisition, Methodology, Resources, Writing &#x2013; review and editing. LH: Methodology, Resources, Writing &#x2013; review and editing. HL: Data curation, Project administration, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review and editing. BC: Conceptualization, Methodology, Project administration, Resources, Supervision, Writing &#x2013; review and editing, Funding acquisition.</p>
</sec>
<sec sec-type="funding-information" id="s8">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This study was supported by the Natural Science Foundation of Shandong Province (ZR2023MH048) and National Natural Science Foundation of China (82070783).</p>
</sec>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abbott</surname>
<given-names>N. J.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Dynamics of CNS barriers: evolution, differentiation, and modulation</article-title>. <source>Cell Mol. Neurobiol.</source> <volume>25</volume>, <fpage>5</fpage>&#x2013;<lpage>23</lpage>. <pub-id pub-id-type="doi">10.1007/s10571-004-1374-y</pub-id>
<pub-id pub-id-type="pmid">15962506</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bagher</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Beleznai</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kansui</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Mitchell</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Garland</surname>
<given-names>C. J.</given-names>
</name>
<name>
<surname>Dora</surname>
<given-names>K. A.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Low intravascular pressure activates endothelial cell TRPV4 channels, local Ca2&#x2b; events, and IKCa channels, reducing arteriolar tone</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>109</volume>, <fpage>18174</fpage>&#x2013;<lpage>18179</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1211946109</pub-id>
<pub-id pub-id-type="pmid">23071308</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Beech</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Kalli</surname>
<given-names>A. C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Force sensing by piezo channels in cardiovascular health and disease</article-title>. <source>Arterioscler. Thromb. Vasc. Biol.</source> <volume>39</volume>, <fpage>2228</fpage>&#x2013;<lpage>2239</lpage>. <pub-id pub-id-type="doi">10.1161/ATVBAHA.119.313348</pub-id>
<pub-id pub-id-type="pmid">31533470</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Berra-Romani</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Faris</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Negri</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Botta</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Genova</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Moccia</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Arachidonic acid evokes an increase in intracellular Ca(<sup>2&#x2b;</sup>) concentration and nitric oxide production in endothelial cells from human brain microcirculation</article-title>. <source>Cells</source> <volume>8</volume>, <fpage>689</fpage>. <pub-id pub-id-type="doi">10.3390/cells8070689</pub-id>
<pub-id pub-id-type="pmid">31323976</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boedtkjer</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Praetorius</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Matchkov</surname>
<given-names>V. V.</given-names>
</name>
<name>
<surname>Stankevicius</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Mogensen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>F&#xfc;chtbauer</surname>
<given-names>A. C.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Disruption of Na&#x2b;,HCO<sub>3</sub>
<sup>-</sup> cotransporter NBCn1 (slc4a7) inhibits NO-mediated vasorelaxation, smooth muscle Ca<sup>2&#x2b;</sup> sensitivity, and hypertension development in mice</article-title>. <source>Circulation</source> <volume>124</volume>, <fpage>1819</fpage>&#x2013;<lpage>1829</lpage>. <pub-id pub-id-type="doi">10.1161/CIRCULATIONAHA.110.015974</pub-id>
<pub-id pub-id-type="pmid">21947296</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Botello-Smith</surname>
<given-names>W. M.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Ozkan</surname>
<given-names>A. D.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Pham</surname>
<given-names>C. N.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>A mechanism for the activation of the mechanosensitive Piezo1 channel by the small molecule Yoda1</article-title>. <source>Nat. Commun.</source> <volume>10</volume>, <fpage>4503</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-019-12501-1</pub-id>
<pub-id pub-id-type="pmid">31582801</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caolo</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Debant</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Endesh</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Futers</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Lichtenstein</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Bartoli</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Shear stress activates ADAM10 sheddase to regulate Notch1 via the Piezo1 force sensor in endothelial cells</article-title>. <source>Elife</source> <volume>9</volume>, <fpage>e50684</fpage>. <pub-id pub-id-type="doi">10.7554/eLife.50684</pub-id>
<pub-id pub-id-type="pmid">32484440</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Choublier</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Taghi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Menet</surname>
<given-names>M. C.</given-names>
</name>
<name>
<surname>Le Gall</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bruce</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chafey</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Exposure of human cerebral microvascular endothelial cells hCMEC/D3 to laminar shear stress induces vascular protective responses</article-title>. <source>Fluids Barriers CNS</source> <volume>19</volume>, <fpage>41</fpage>. <pub-id pub-id-type="doi">10.1186/s12987-022-00344-w</pub-id>
<pub-id pub-id-type="pmid">35658915</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coste</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Mathur</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Schmidt</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Earley</surname>
<given-names>T. J.</given-names>
</name>
<name>
<surname>Ranade</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Petrus</surname>
<given-names>M. J.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels</article-title>. <source>Science</source> <volume>330</volume>, <fpage>55</fpage>&#x2013;<lpage>60</lpage>. <pub-id pub-id-type="doi">10.1126/science.1193270</pub-id>
<pub-id pub-id-type="pmid">20813920</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coste</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Santos</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Syeda</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Grandl</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Spencer</surname>
<given-names>K. S.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Piezo proteins are pore-forming subunits of mechanically activated channels</article-title>. <source>Nature</source> <volume>483</volume>, <fpage>176</fpage>&#x2013;<lpage>181</lpage>. <pub-id pub-id-type="doi">10.1038/nature10812</pub-id>
<pub-id pub-id-type="pmid">22343900</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dalghi</surname>
<given-names>M. G.</given-names>
</name>
<name>
<surname>Ruiz</surname>
<given-names>W. G.</given-names>
</name>
<name>
<surname>Clayton</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Montalbetti</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Daugherty</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>Beckel</surname>
<given-names>J. M.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Functional roles for PIEZO1 and PIEZO2 in urothelial mechanotransduction and lower urinary tract interoception</article-title>. <source>JCI Insight</source> <volume>6</volume>, <fpage>e152984</fpage>. <pub-id pub-id-type="doi">10.1172/jci.insight.152984</pub-id>
<pub-id pub-id-type="pmid">34464353</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Daneman</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Prat</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>The blood-brain barrier</article-title>. <source>Cold Spring Harb. Perspect. Biol.</source> <volume>7</volume>, <fpage>a020412</fpage>. <pub-id pub-id-type="doi">10.1101/cshperspect.a020412</pub-id>
<pub-id pub-id-type="pmid">25561720</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Delmas</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Parpaite</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Coste</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>PIEZO channels and newcomers in the Mammalian mechanosensitive ion channel family</article-title>. <source>Neuron</source> <volume>110</volume>, <fpage>2713</fpage>&#x2013;<lpage>2727</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuron.2022.07.001</pub-id>
<pub-id pub-id-type="pmid">35907398</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Douguet</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Patel</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Vanhoutte</surname>
<given-names>P. M.</given-names>
</name>
<name>
<surname>Honor&#xe9;</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Piezo ion channels in cardiovascular mechanobiology</article-title>. <source>Trends Pharmacol. Sci.</source> <volume>40</volume>, <fpage>956</fpage>&#x2013;<lpage>970</lpage>. <pub-id pub-id-type="doi">10.1016/j.tips.2019.10.002</pub-id>
<pub-id pub-id-type="pmid">31704174</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eisenhoffer</surname>
<given-names>G. T.</given-names>
</name>
<name>
<surname>Loftus</surname>
<given-names>P. D.</given-names>
</name>
<name>
<surname>Yoshigi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Otsuna</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chien</surname>
<given-names>C. B.</given-names>
</name>
<name>
<surname>Morcos</surname>
<given-names>P. A.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Crowding induces live cell extrusion to maintain homeostatic cell numbers in epithelia</article-title>. <source>Nature</source> <volume>484</volume>, <fpage>546</fpage>&#x2013;<lpage>549</lpage>. <pub-id pub-id-type="doi">10.1038/nature10999</pub-id>
<pub-id pub-id-type="pmid">22504183</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Evans</surname>
<given-names>E. L.</given-names>
</name>
<name>
<surname>Cuthbertson</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Endesh</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Rode</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Blythe</surname>
<given-names>N. M.</given-names>
</name>
<name>
<surname>Hyman</surname>
<given-names>A. J.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Yoda1 analogue (Dooku1) which antagonizes Yoda1-evoked activation of Piezo1 and aortic relaxation</article-title>. <source>Br. J. Pharmacol.</source> <volume>175</volume>, <fpage>1744</fpage>&#x2013;<lpage>1759</lpage>. <pub-id pub-id-type="doi">10.1111/bph.14188</pub-id>
<pub-id pub-id-type="pmid">29498036</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Birukov</surname>
<given-names>K. G.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Mechanosensing and mechanoregulation of endothelial cell functions</article-title>. <source>Compr. Physiol.</source> <volume>9</volume>, <fpage>873</fpage>&#x2013;<lpage>904</lpage>. <pub-id pub-id-type="doi">10.1002/cphy.c180020</pub-id>
<pub-id pub-id-type="pmid">30873580</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Friedrich</surname>
<given-names>E. E.</given-names>
</name>
<name>
<surname>Hong</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhong</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Di</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rehman</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Endothelial cell Piezo1 mediates pressure-induced lung vascular hyperpermeability via disruption of adherens junctions</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>116</volume>, <fpage>12980</fpage>&#x2013;<lpage>12985</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1902165116</pub-id>
<pub-id pub-id-type="pmid">31186359</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garcia-Polite</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Martorell</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Del Rey-Puech</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Melgar-Lesmes</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>O&#x27;Brien</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Roquer</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Pulsatility and high shear stress deteriorate barrier phenotype in brain microvascular endothelium</article-title>. <source>J. Cereb. Blood Flow. Metab.</source> <volume>37</volume>, <fpage>2614</fpage>&#x2013;<lpage>2625</lpage>. <pub-id pub-id-type="doi">10.1177/0271678X16672482</pub-id>
<pub-id pub-id-type="pmid">27702879</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guan</surname>
<given-names>N. N.</given-names>
</name>
<name>
<surname>Sharma</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Hall&#xe9;n-Grufman</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Jager</surname>
<given-names>E. W. H.</given-names>
</name>
<name>
<surname>Svennersten</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>The role of ATP signalling in response to mechanical stimulation studied in T24 cells using new microphysiological tools</article-title>. <source>J. Cell Mol. Med.</source> <volume>22</volume>, <fpage>2319</fpage>&#x2013;<lpage>2328</lpage>. <pub-id pub-id-type="doi">10.1111/jcmm.13520</pub-id>
<pub-id pub-id-type="pmid">29392898</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harraz</surname>
<given-names>O. F.</given-names>
</name>
<name>
<surname>Klug</surname>
<given-names>N. R.</given-names>
</name>
<name>
<surname>Senatore</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Hill-Eubanks</surname>
<given-names>D. C.</given-names>
</name>
<name>
<surname>Nelson</surname>
<given-names>M. T.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Piezo1 is a mechanosensor channel in central nervous system capillaries</article-title>. <source>Circ. Res.</source> <volume>130</volume>, <fpage>1531</fpage>&#x2013;<lpage>1546</lpage>. <pub-id pub-id-type="doi">10.1161/CIRCRESAHA.122.320827</pub-id>
<pub-id pub-id-type="pmid">35382561</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y. X.</given-names>
</name>
<name>
<surname>Bu</surname>
<given-names>W. J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Piezo1 channel activation stimulates ATP production through enhancing mitochondrial respiration and glycolysis in vascular endothelial cells</article-title>. <source>Br. J. Pharmacol.</source> <volume>180</volume>, <fpage>1862</fpage>&#x2013;<lpage>1877</lpage>. <pub-id pub-id-type="doi">10.1111/bph.16050</pub-id>
<pub-id pub-id-type="pmid">36740831</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kawano</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kunz</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Abe</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Girouard</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Anrather</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>iNOS-derived NO and nox2-derived superoxide confer tolerance to excitotoxic brain injury through peroxynitrite</article-title>. <source>J. Cereb. Blood Flow. Metab.</source> <volume>27</volume>, <fpage>1453</fpage>&#x2013;<lpage>1462</lpage>. <pub-id pub-id-type="doi">10.1038/sj.jcbfm.9600449</pub-id>
<pub-id pub-id-type="pmid">17293848</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Lim</surname>
<given-names>C. S.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Joshi</surname>
<given-names>H. P.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>K. T.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>Y. H.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Elevated TRPV4 levels contribute to endothelial damage and scarring in experimental spinal cord injury</article-title>. <source>J. Neurosci.</source> <volume>40</volume>, <fpage>1943</fpage>&#x2013;<lpage>1955</lpage>. <pub-id pub-id-type="doi">10.1523/JNEUROSCI.2035-19.2020</pub-id>
<pub-id pub-id-type="pmid">31974206</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Tumova</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Muraki</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Bruns</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ludlow</surname>
<given-names>M. J.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Piezo1 integration of vascular architecture with physiological force</article-title>. <source>Nature</source> <volume>515</volume>, <fpage>279</fpage>&#x2013;<lpage>282</lpage>. <pub-id pub-id-type="doi">10.1038/nature13701</pub-id>
<pub-id pub-id-type="pmid">25119035</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>L. F.</given-names>
</name>
<name>
<surname>Xiang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>K. R.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Modeling of TRPV<sub>4</sub>-C<sub>1</sub> -mediated calcium signaling in vascular endothelial cells induced by fluid shear stress and ATP</article-title>. <source>Biomech. Model Mechanobiol.</source> <volume>14</volume>, <fpage>979</fpage>&#x2013;<lpage>993</lpage>. <pub-id pub-id-type="doi">10.1007/s10237-015-0647-3</pub-id>
<pub-id pub-id-type="pmid">25577546</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lillo</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Gaete</surname>
<given-names>P. S.</given-names>
</name>
<name>
<surname>Puebla</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ardiles</surname>
<given-names>N. M.</given-names>
</name>
<name>
<surname>Poblete</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Becerra</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Critical contribution of Na(<sup>&#x2b;</sup>)-Ca(<sup>2&#x2b;</sup>) exchanger to the Ca(<sup>2&#x2b;</sup>)-mediated vasodilation activated in endothelial cells of resistance arteries</article-title>. <source>Faseb J.</source> <volume>32</volume>, <fpage>2137</fpage>&#x2013;<lpage>2147</lpage>. <pub-id pub-id-type="doi">10.1096/fj.201700365RR</pub-id>
<pub-id pub-id-type="pmid">29217667</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Halloran</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Burbank</surname>
<given-names>R. R.</given-names>
</name>
<name>
<surname>Hussong</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Hart</surname>
<given-names>M. J.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Chronic rapamycin restores brain vascular integrity and function through NO synthase activation and improves memory in symptomatic mice modeling Alzheimer&#x27;s disease</article-title>. <source>J. Cereb. Blood Flow. Metab.</source> <volume>33</volume>, <fpage>1412</fpage>&#x2013;<lpage>1421</lpage>. <pub-id pub-id-type="doi">10.1038/jcbfm.2013.82</pub-id>
<pub-id pub-id-type="pmid">23801246</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Locovei</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Scemes</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Spray</surname>
<given-names>D. C.</given-names>
</name>
<name>
<surname>Dahl</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Pannexin1 is part of the pore forming unit of the P2X(7) receptor death complex</article-title>. <source>FEBS Lett.</source> <volume>581</volume>, <fpage>483</fpage>&#x2013;<lpage>488</lpage>. <pub-id pub-id-type="doi">10.1016/j.febslet.2006.12.056</pub-id>
<pub-id pub-id-type="pmid">17240370</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Saubamea</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Chasseigneaux</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cochois</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Smirnova</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Glacial</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Molecular and functional study of transient receptor potential vanilloid 1-4 at the rat and human blood-brain barrier reveals interspecies differences</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>8</volume>, <fpage>578514</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2020.578514</pub-id>
<pub-id pub-id-type="pmid">33262985</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Decl&#xe8;ves</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Cisternino</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Transient receptor potential vanilloid in the brain gliovascular unit: prospective targets in therapy</article-title>. <source>Pharmaceutics</source> <volume>13</volume>, <fpage>334</fpage>. <pub-id pub-id-type="doi">10.3390/pharmaceutics13030334</pub-id>
<pub-id pub-id-type="pmid">33806707</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mendoza</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gutterman</surname>
<given-names>D. D.</given-names>
</name>
<name>
<surname>Wilcox</surname>
<given-names>D. A.</given-names>
</name>
<name>
<surname>Bubolz</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>TRPV4-mediated endothelial Ca<sup>2&#x2b;</sup> influx and vasodilation in response to shear stress</article-title>. <source>Am. J. Physiol. Heart Circ. Physiol.</source> <volume>298</volume>, <fpage>H466</fpage>&#x2013;<lpage>H476</lpage>. <pub-id pub-id-type="doi">10.1152/ajpheart.00854.2009</pub-id>
<pub-id pub-id-type="pmid">19966050</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Michinaga</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Onishi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Shimizu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Mizuguchi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Hishinuma</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Pharmacological inhibition of transient receptor potential vanilloid 4 reduces vasogenic edema after traumatic brain injury in mice</article-title>. <source>Biol. Pharm. Bull.</source> <volume>44</volume>, <fpage>1759</fpage>&#x2013;<lpage>1766</lpage>. <pub-id pub-id-type="doi">10.1248/bpb.b21-00512</pub-id>
<pub-id pub-id-type="pmid">34719652</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Neuhaus</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gonsior</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Stolzenburg</surname>
<given-names>J. U.</given-names>
</name>
<name>
<surname>Berger</surname>
<given-names>F. P.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Mechanosensitivity is a characteristic feature of cultured suburothelial interstitial cells of the human bladder</article-title>. <source>Int. J. Mol. Sci.</source> <volume>21</volume>, <fpage>5474</fpage>. <pub-id pub-id-type="doi">10.3390/ijms21155474</pub-id>
<pub-id pub-id-type="pmid">32751838</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rochfort</surname>
<given-names>K. D.</given-names>
</name>
<name>
<surname>Collins</surname>
<given-names>L. E.</given-names>
</name>
<name>
<surname>McLoughlin</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Cummins</surname>
<given-names>P. M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Shear-dependent attenuation of cellular ROS levels can suppress proinflammatory cytokine injury to human brain microvascular endothelial barrier properties</article-title>. <source>J. Cereb. Blood Flow. Metab.</source> <volume>35</volume>, <fpage>1648</fpage>&#x2013;<lpage>1656</lpage>. <pub-id pub-id-type="doi">10.1038/jcbfm.2015.102</pub-id>
<pub-id pub-id-type="pmid">25991069</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rosenkranz</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Shaposhnykov</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Schnapauff</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Epping</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Vieira</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Heidermann</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>TRPV4-Mediated regulation of the blood brain barrier is abolished during inflammation</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>8</volume>, <fpage>849</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2020.00849</pub-id>
<pub-id pub-id-type="pmid">32974355</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siddharthan</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>Y. V.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>K. S.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Human astrocytes/astrocyte-conditioned medium and shear stress enhance the barrier properties of human brain microvascular endothelial cells</article-title>. <source>Brain Res.</source> <volume>1147</volume>, <fpage>39</fpage>&#x2013;<lpage>50</lpage>. <pub-id pub-id-type="doi">10.1016/j.brainres.2007.02.029</pub-id>
<pub-id pub-id-type="pmid">17368578</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sonkusare</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Bonev</surname>
<given-names>A. D.</given-names>
</name>
<name>
<surname>Ledoux</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liedtke</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Kotlikoff</surname>
<given-names>M. I.</given-names>
</name>
<name>
<surname>Heppner</surname>
<given-names>T. J.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Elementary Ca<sup>2&#x2b;</sup> signals through endothelial TRPV4 channels regulate vascular function</article-title>. <source>Science</source> <volume>336</volume>, <fpage>597</fpage>&#x2013;<lpage>601</lpage>. <pub-id pub-id-type="doi">10.1126/science.1216283</pub-id>
<pub-id pub-id-type="pmid">22556255</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sonkusare</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Dalsgaard</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Bonev</surname>
<given-names>A. D.</given-names>
</name>
<name>
<surname>Hill-Eubanks</surname>
<given-names>D. C.</given-names>
</name>
<name>
<surname>Kotlikoff</surname>
<given-names>M. I.</given-names>
</name>
<name>
<surname>Scott</surname>
<given-names>J. D.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>AKAP150-dependent cooperative TRPV4 channel gating is central to endothelium-dependent vasodilation and is disrupted in hypertension</article-title>. <source>Sci. Signal</source> <volume>7</volume>, <fpage>ra66</fpage>. <pub-id pub-id-type="doi">10.1126/scisignal.2005052</pub-id>
<pub-id pub-id-type="pmid">25005230</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Subauste</surname>
<given-names>C. S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The CD40-ATP-P2X (7) receptor pathway: cell to cell cross-talk to promote inflammation and programmed cell death of endothelial cells</article-title>. <source>Front. Immunol.</source> <volume>10</volume>, <fpage>2958</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2019.02958</pub-id>
<pub-id pub-id-type="pmid">31921199</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Swain</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Liddle</surname>
<given-names>R. A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Piezo1 acts upstream of TRPV4 to induce pathological changes in endothelial cells due to shear stress</article-title>. <source>J. Biol. Chem.</source> <volume>296</volume>, <fpage>100171</fpage>. <pub-id pub-id-type="doi">10.1074/jbc.RA120.015059</pub-id>
<pub-id pub-id-type="pmid">33298523</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Swain</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Romac</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Shahid</surname>
<given-names>R. A.</given-names>
</name>
<name>
<surname>Pandol</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Liedtke</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Vigna</surname>
<given-names>S. R.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>TRPV4 channel opening mediates pressure-induced pancreatitis initiated by Piezo1 activation</article-title>. <source>J. Clin. Invest.</source> <volume>130</volume>, <fpage>2527</fpage>&#x2013;<lpage>2541</lpage>. <pub-id pub-id-type="doi">10.1172/JCI134111</pub-id>
<pub-id pub-id-type="pmid">31999644</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sweeney</surname>
<given-names>M. D.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Montagne</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Nelson</surname>
<given-names>A. R.</given-names>
</name>
<name>
<surname>Zlokovic</surname>
<given-names>B. V.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Blood-brain barrier: from physiology to disease and back</article-title>. <source>Physiol. Rev.</source> <volume>99</volume>, <fpage>21</fpage>&#x2013;<lpage>78</lpage>. <pub-id pub-id-type="doi">10.1152/physrev.00050.2017</pub-id>
<pub-id pub-id-type="pmid">30280653</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vanlandewijck</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>M&#xe4;e</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Andrae</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ando</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Del Gaudio</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>A molecular atlas of cell types and zonation in the brain vasculature</article-title>. <source>Nature</source> <volume>554</volume>, <fpage>475</fpage>&#x2013;<lpage>480</lpage>. <pub-id pub-id-type="doi">10.1038/nature25739</pub-id>
<pub-id pub-id-type="pmid">29443965</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>von K&#xfc;gelgen</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Hoffmann</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Pharmacology and structure of P2Y receptors</article-title>. <source>Neuropharmacology</source> <volume>104</volume>, <fpage>50</fpage>&#x2013;<lpage>61</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuropharm.2015.10.030</pub-id>
<pub-id pub-id-type="pmid">26519900</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chennupati</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kaur</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Iring</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wettschureck</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Offermanns</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Endothelial cation channel PIEZO1 controls blood pressure by mediating flow-induced ATP release</article-title>. <source>J. Clin. Invest.</source> <volume>126</volume>, <fpage>4527</fpage>&#x2013;<lpage>4536</lpage>. <pub-id pub-id-type="doi">10.1172/JCI87343</pub-id>
<pub-id pub-id-type="pmid">27797339</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Xiang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Advances on fluid shear stress regulating blood-brain barrier</article-title>. <source>Microvasc. Res.</source> <volume>128</volume>, <fpage>103930</fpage>. <pub-id pub-id-type="doi">10.1016/j.mvr.2019.103930</pub-id>
<pub-id pub-id-type="pmid">31639383</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>M&#xf6;ller</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Stegmeyer</surname>
<given-names>R. I.</given-names>
</name>
<name>
<surname>Strilic</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Mechanosensation by endothelial PIEZO1 is required for leukocyte diapedesis</article-title>. <source>Blood</source> <volume>140</volume>, <fpage>171</fpage>&#x2013;<lpage>183</lpage>. <pub-id pub-id-type="doi">10.1182/blood.2021014614</pub-id>
<pub-id pub-id-type="pmid">35443048</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weksler</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Romero</surname>
<given-names>I. A.</given-names>
</name>
<name>
<surname>Couraud</surname>
<given-names>P. O.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>The hCMEC/D3 cell line as a model of the human blood brain barrier</article-title>. <source>Fluids Barriers CNS</source> <volume>10</volume>, <fpage>16</fpage>. <pub-id pub-id-type="doi">10.1186/2045-8118-10-16</pub-id>
<pub-id pub-id-type="pmid">23531482</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Daugherty</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>de Groat</surname>
<given-names>W. C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Reduced bladder responses to capsaicin and GSK-1016790A in retired-breeder female rats with diminished volume sensitivity</article-title>. <source>Am. J. Physiol. Ren. Physiol.</source> <volume>315</volume>, <fpage>F1217-F1227</fpage>&#x2013;<lpage>f1227</lpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00198.2018</pub-id>
<pub-id pub-id-type="pmid">30019934</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yan</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Dwiggins</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Moriarty</surname>
<given-names>R. A.</given-names>
</name>
<name>
<surname>Jung</surname>
<given-names>J. W.</given-names>
</name>
<name>
<surname>Gupta</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Brandon</surname>
<given-names>K. D.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Matrix stiffness regulates the tight junction phenotypes and local barrier properties in tricellular regions in an iPSC-derived BBB model</article-title>. <source>Acta Biomater.</source> <volume>167</volume>, <fpage>109</fpage>&#x2013;<lpage>120</lpage>. <pub-id pub-id-type="doi">10.1016/j.actbio.2023.06.003</pub-id>
<pub-id pub-id-type="pmid">37302732</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Qu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Qi</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>The vascular dilatation induced by Hydroxysafflor yellow A (HSYA) on rat mesenteric artery through TRPV4-dependent calcium influx in endothelial cells</article-title>. <source>J. Ethnopharmacol.</source> <volume>256</volume>, <fpage>112790</fpage>. <pub-id pub-id-type="doi">10.1016/j.jep.2020.112790</pub-id>
<pub-id pub-id-type="pmid">32234595</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Functional expression of transient receptor potential and Piezo1 channels in cultured interstitial cells of human-bladder Lamina Propria</article-title>. <source>Front. Physiol.</source> <volume>12</volume>, <fpage>762847</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2021.762847</pub-id>
<pub-id pub-id-type="pmid">35069237</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>