<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Physiol.</journal-id>
<journal-title>Frontiers in Physiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Physiol.</abbrev-journal-title>
<issn pub-type="epub">1664-042X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1475441</article-id>
<article-id pub-id-type="doi">10.3389/fphys.2025.1475441</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Physiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Integrative RNA-seq and CLIP-seq analysis reveals <italic>hnRNP-F</italic> regulation of <italic>TNF&#x3b1;/NF&#x3ba;B</italic> signaling in high-glucose conditions</article-title>
<alt-title alt-title-type="left-running-head">Wang et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphys.2025.1475441">10.3389/fphys.2025.1475441</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Lan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1450581/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Li</surname>
<given-names>Huimeng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2796077/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guo</surname>
<given-names>Xinyuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3140148/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Xiaoqin</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1555951/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Hubei University of Chinese Medicine</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Hubei Provincial Hospital of Traditional Chinese Medicine</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Affiliated Hospital of Hubei University of Chinese Medicine, Hubei Key Laboratory of Theory and Application Research of Liver and Kidney in Traditional Chinese Medicine</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Hubei Shizhen Laboratory</institution>, <addr-line>Wuhan</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1338351/overview">Komuraiah Myakala</ext-link>, Georgetown University Medical Center, United States</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2016070/overview">Ramdas Bhat</ext-link>, Department of Pharmacology at Srinivas College of Pharmacy, India</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2347388/overview">Sandrine Ettou</ext-link>, Ingenia Therapeutics, United States</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Xiaoqin Wang, <email>wangxiaoqin@hbhtcm.com</email>
</corresp>
<fn fn-type="equal" id="fn001">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this work and share first authorship</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>09</day>
<month>09</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1475441</elocation-id>
<history>
<date date-type="received">
<day>03</day>
<month>08</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>30</day>
<month>07</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Wang, Li, Guo and Wang.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Wang, Li, Guo and Wang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Diabetic kidney disease (DKD), with its complex pathogenesis, is the most important cause of end-stage renal disease and has become an urgent public health problem worldwide. Heterogeneous nuclear ribonucleoprotein F (<italic>hnRNP-F</italic>) is a member of a subfamily of widely expressed nuclear heterogeneous ribonucleoproteins with biological roles in regulating gene expression and variable splicing. Some studies have investigated <italic>hnRNP-F</italic> in DKD. However, its potential mechanism in renal intrinsic cells has rarely been reported. Therefore, it is necessary to further investigate its potential mechanism in DKD in the search for novel ideas for new therapeutic targets for DKD.</p>
</sec>
<sec>
<title>Methods</title>
<p>In this study, <italic>hnRNP-F</italic> was overexpressed in human renal proximal tubular epithelial (HK-2) cells cultured in high-glucose conditions, while an empty vector was transfected into HK-2 cells as a control group (NC). Meanwhile, to avoid any osmotic stress that might be caused by the use of high sugar, we also added mannose as a non-osmotic control. RNA-seq was utilized to generate transcriptome data following <italic>hnRNP-F</italic> overexpression, allowing for the analysis of differential gene expression and alternative splicing events influenced by <italic>hnRNP-F</italic> overexpression. Similarly, we overexpressed <italic>hnRNP-F</italic> in mouse podocyte clone 5 (MPC5) cells and verified the relevant indicators using Western blotting (WB) under high-glucose and high-mannitol conditions, respectively. We also downloaded the CLIP-seq data of <italic>hnRNP-F</italic> in human 293T cells from the Gene Expression Omnibus (GEO) database. Through integrative analysis of RNA-seq and CLIP-seq, we tried to identify a set of potential direct targets of <italic>hnRNP-F</italic> in cells.</p>
</sec>
<sec>
<title>Results</title>
<p>In this study, RNA sequencing (RNA-seq) was utilized to demonstrate that the upregulation of <italic>hnRNP-F</italic> in HK-2 cells cultured under high-glucose conditions resulted in a substantial decrease in the expression of genes associated with the inflammatory response and suppression of the <italic>TNF&#x3b1;-NF&#x3ba;B</italic> signaling pathway. This was also verified in MPC5 cells. By analyzing CLIP-seq and RNA-seq data, we found that <italic>hnRNP-F</italic> may inhibit gene expression by binding to lncRNA <italic>SNHG1</italic>. Conversely, this upregulation led to a significant increase in alternative splicing events of genes implicated in DKD, such as <italic>hnRNPA2B1, OSML</italic>, <italic>UGT2B7</italic>, <italic>TRIP6</italic>, and <italic>IRF3</italic>. Combining CLIP-seq data, we found that <italic>hnRNP-F</italic> binds to and regulates variable splicing of the <italic>hnRNP</italic> protein family and splicing factors. This result suggests that <italic>hnRNP-F</italic> may regulate alternative splicing through the coordinated action of multiple splicing factors.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>
<italic>hnRNP-F</italic> has dual functions in mRNA transcriptional and post-transcriptional levels and may bind with lncRNA <italic>SNHG1</italic> to negatively regulate the transcription of genes involved in the <italic>TNF&#x3b1;/NF&#x3ba;B</italic> signaling pathway. Meanwhile, <italic>hnRNP-F</italic> may function in the co-regulation of alternative splicing events in cells by interacting with ZFP36 to form a complex.</p>
</sec>
</abstract>
<kwd-group>
<kwd>
<italic>hnRNP-F</italic>
</kwd>
<kwd>diabetic kidney disease</kwd>
<kwd>RNA-seq</kwd>
<kwd>differential gene expression</kwd>
<kwd>variable splicing</kwd>
<kwd>
<italic>TNF&#x3b1;-NF&#x3ba;B</italic> signaling pathway</kwd>
</kwd-group>
<contract-num rid="cn001">82374384</contract-num>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Renal Physiology and Pathophysiology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>1 Introduction</title>
<p>Diabetic kidney disease (DKD) is a global public health problem and an important cause of chronic kidney disease (CKD), leading to end-stage renal disease, and urgently needs our in-depth research and effective response (<xref ref-type="bibr" rid="B6">Chen et al., 2020</xref>; <xref ref-type="bibr" rid="B3">Barrera-Chimal and Jaisser, 2020</xref>). Various factors are implicated in DKD progression, including autoimmunity, inflammation, renal fibrosis, renal hemodynamic alterations, mitochondrial dysfunction, abnormalities in glucolipid metabolism, oxidative stress, and epigenetic inheritance (<xref ref-type="bibr" rid="B46">Tuttle et al., 2022</xref>; <xref ref-type="bibr" rid="B25">Lin et al., 2018</xref>). Therefore, drugs targeting inflammatory and fibrotic pathways have important therapeutic implications in DKD research (<xref ref-type="bibr" rid="B31">Lytvyn et al., 2020</xref>).</p>
<p>Heterogeneous nuclear ribonucleoprotein F (<italic>hnRNP-F</italic>) is a subfamily of widely expressed <italic>hnRNPs</italic>. The proteins of this subfamily are RNA-binding proteins (RBPs) that interact with heterogeneous nuclear RNAs. In addition, as splicing factors, <italic>hnRNPs</italic> are involved in various aspects of RNA metabolism, including alternative splicing of target RNAs, polyadenylation, sequence editing, RNA transport, RNA stabilization and degradation, intracellular localization, and translational control (<xref ref-type="bibr" rid="B37">Smith et al., 2021</xref>; <xref ref-type="bibr" rid="B17">Huang et al., 2017</xref>; <xref ref-type="bibr" rid="B22">Ladd, 2016</xref>). Alternative splicing (AS) is a major mechanism for generating multiple structurally and functionally different proteins from a single gene, greatly expanding proteome diversity (<xref ref-type="bibr" rid="B7">Cheng et al., 2021</xref>). In humans, approximately 95% of multiexon genes undergo AS, and a recent study demonstrated that splice isoform switching is critical in the various kidney diseases, especially in DKD (<xref ref-type="bibr" rid="B51">Zhou et al., 2024</xref>; <xref ref-type="bibr" rid="B24">Liao et al., 2024</xref>).</p>
<p>Based on the biological role of <italic>hnRNP-F</italic> in regulating gene expression and AS, its role in DKD has gradually received attention. At present, scholars have confirmed the closer link between <italic>hnRNP-F</italic> and DKD to varying degrees in various experiments. For example, in patients with type 2 diabetes, the protein levels of <italic>hnRNP-F</italic> have significantly decreased in renal cortex tissues. It shows that <italic>hnRNP-F</italic> is involved in mediating insulin inhibition of Bcl2 modifier expression and diabetic tubulopathy (<xref ref-type="bibr" rid="B14">Ghosh et al., 2019</xref>). <italic>hnRNP-F</italic> protects the kidney from oxidative stress and nephropathy by stimulating Sirtuin-1 expression and signaling in diabetic mice (<xref ref-type="bibr" rid="B14">Ghosh et al., 2019</xref>). Overexpression of <italic>hnRNP-F</italic> attenuates <italic>TGF-&#x3b2;1</italic>-induced diabetic kidney injury in mice, mainly by stimulating renal Ace-2 gene expression (<xref ref-type="bibr" rid="B28">Lo et al., 2015</xref>). <italic>hnRNP-F</italic> was recently found to have a protective effect against podocyte injury, and <italic>hnRNP-F</italic> deficiency promotes podocyte pathology through activation of Mettl14 expression and inhibition of Sirt1 expression by its nuclear translocation (<xref ref-type="bibr" rid="B24">Liao et al., 2024</xref>).</p>
<p>In the study of DKD, HK-2 cells, as a model of human proximal tubular epithelial cells, are widely used to investigate the mechanisms of diabetes-induced tubular damage and potential therapeutic strategies (<xref ref-type="bibr" rid="B8">Darshi et al., 2024</xref>). In the present study, renal tubular epithelial cells (HK2) overexpressing <italic>hnRNP-F</italic> were cultured in high-glucose conditions, while a control group (NC) was similarly exposed to high-glucose. Mannitol was added to the media as an osmotic control. Subsequently, transcriptome data were acquired through RNA sequencing (RNA-seq) following the overexpression of <italic>hnRNP-F</italic> under high-glucose conditions. The expression of differentially expressed genes linked to inflammation was confirmed in both db/db and db/m mouse models. Additionally, overexpression of <italic>hnRNP-F</italic> in conditionally immortalized mouse podocyte cell line (Clone 5) (MPC5) confirmed its inhibitory effect on the <italic>TNF-&#x3b1;/NF-&#x3ba;B</italic> inflammatory signaling pathway. This approach enabled the analysis of differential gene expression and AS events influenced by the overexpression of <italic>hnRNP-F</italic>. Furthermore, the anti-inflammatory effect of <italic>hnRNP-F</italic> has been experimentally demonstrated under LPS stimulation. The results show that <italic>hnRNP-F</italic> broadly regulates gene expression and alternative splicing related to diabetic nephropathy, particularly in inflammation-related pathways, offering new insights into DKD gene regulation.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>2 Materials and methods</title>
<sec id="s2-1">
<title>2.1 Cell lines and cell culture</title>
<p>HK-2 cells (Cell Bank of China Academy of Sciences) were cultured in DMEM/F12 (Gibco) supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin (MilliporeSigma). MPC-5 cells (Procell) were maintained in RPMI 1640 (Procell) containing 10% FBS (Gibco) and 1% penicillin/streptomycin (MilliporeSigma). Both cell lines were incubated at 37 &#xb0;C under 5% CO<sub>2</sub>. Upon reaching 50% confluency, cells were treated with 30 mM high-glucose (HG; MilliporeSigma) for 72 h. Mannitol (MilliporeSigma) served as an osmotic control. LPS (Solarbio) was dissolved in sterile PBS to prepare a 10-mg/mL stock solution. HK-2 cells (10 &#x3bc;g/mL) and MPC5 cells (45 &#x3bc;g/mL) were treated with these LPS solutions for 24 h to model cell injury. Cells were subsequently harvested for Western blot analysis of target protein expression.</p>
</sec>
<sec id="s2-2">
<title>2.2 <italic>hnRNP-F</italic> was overexpressed in HK-2 and MPC5 cell lines</title>
<p>We employed four parallel wells for each group of HK-2 cells: HK-2 cells transfected with the control lentivirus were cultured in a high-glucose medium containing 30 mM glucose (HG-NC) for 72 h, while a separate group of control lentivirus-transfected HK-2 cells was cultured in a medium containing 30 mM mannitol to serve as an osmotic control (OS-NC). Similarly, HK-2 cells transfected to overexpress the <italic>hnRNP-F</italic> lentivirus (Gene ID:98758, Lentiviral expression vector LV5) were maintained in a 30 mM glucose medium (HG-OE) and in a mannitol medium (OS-OE) for 72 h, respectively. MPC5 cells were cultured under HG conditions (30 mM, 72 h), mannitol treatment (30 mM, 72 h), or LPS stimulation (10 &#x3bc;g/mL, 24 h) and then transfected with an <italic>hnRNP-F</italic> overexpressing plasmid packaged in a lentiviral vector (Gene ID: 98758, vector name: HBLV-ZsGreen-PURO).</p>
</sec>
<sec id="s2-3">
<title>2.3 Reverse transcription quantitative real-time PCR (RT-qPCR)</title>
<p>Total RNA was isolated from the renal cortex and cells separately using the TRIzol method, and 1 &#x3bc;L of total RNA was used as the template, reverse-transcribed to cDNA, and continued to be amplified by using cDNA as the template, sequentially, at 95 &#xb0;C for 3 min, 1 cycle, 95 &#xb0;C for 10 s, and 62 &#xb0;C for 40 s, for a total of 40 cycles. The mRNA levels of HG-NC and HG-OE were determined using the 2<sup>&#x2212;&#x394;&#x394;CT</sup> method, with <italic>&#x3b2;-actin</italic> and <italic>GAPDH</italic> serving as internal references. Similarly, mRNA levels in renal tissues of <italic>db/db</italic> and <italic>db/m</italic> mice were calculated. The specific primer sequences are shown in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primer sequences for qRT-PCR.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Gene</th>
<th align="left">Forward primer (5&#x2032;&#x2013;3&#x2032;)</th>
<th align="left">Reverse primer (5&#x2032;&#x2013;3&#x2032;)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">HOMO-<italic>hnRNP-F</italic>
</td>
<td align="left">CTCCGTCGTGGAAGCAGG</td>
<td align="left">CGAGCAGGACTGGTTTCTGT</td>
</tr>
<tr>
<td align="left">HOMO-<italic>GAPDH</italic>
</td>
<td align="left">TCGGAGTCAACGGATTTGGT</td>
<td align="left">TTCCCGTTCTCAGCCTTGAC</td>
</tr>
<tr>
<td align="left">HOMO<italic>-&#x3b2;-actin</italic>
</td>
<td align="left">CACCCAGCACAATGAAGATCAAGAT</td>
<td align="left">CCAGTTTTTAAATCCTGAGTCAAGC</td>
</tr>
<tr>
<td align="left">Mouse-<italic>hnRNP-F</italic>
</td>
<td align="left">GCCTTCGTTCAGTTTGCCTC</td>
<td align="left">AATGCCAATGTACCTCCGGG</td>
</tr>
<tr>
<td align="left">Mouse-<italic>GAPDH</italic>
</td>
<td align="left">AACGACCCCTTCATTGAC</td>
<td align="left">GAAGACACCAGTAGACTCCAC</td>
</tr>
<tr>
<td align="left">Mouse-<italic>&#x3b2;-actin</italic>
</td>
<td align="left">TGTACCCAGGCATTGCTGAC</td>
<td align="left">AACGCAGCTCAGTAACAGTCC</td>
</tr>
<tr>
<td align="left">Mouse-<italic>GDF15</italic>
</td>
<td align="left">GCAGACTTATGATGACCTGGTGG</td>
<td align="left">AAGGGGAGTGTAGGTGAGGAGC</td>
</tr>
<tr>
<td align="left">Mouse<italic>-IL6</italic>
</td>
<td align="left">CCCCAATTTCCAATGCTCTCC</td>
<td align="left">CGCACTAGGTTTGCCGAGTA</td>
</tr>
<tr>
<td align="left">Mouse<italic>-PTX3</italic>
</td>
<td align="left">CTCAGTTCCCAGTCCCTAGTGTTG</td>
<td align="left">GGAGTCCACCCTCAGGAACAGA</td>
</tr>
<tr>
<td align="left">Mouse<italic>-TFPI2</italic>
</td>
<td align="left">CTCCAGTCCAAAGGATGAAGGT</td>
<td align="left">AGTTATTCTCATTCCCACCACAGC</td>
</tr>
<tr>
<td align="left">Mouse-<italic>GAPDH</italic>
</td>
<td align="left">CCTCGTCCCGTAGACAAAATG</td>
<td align="left">TGAGGTCAATGAAGGGGTCGT</td>
</tr>
<tr>
<td align="left">Mouse<italic>-&#x3b2;-actin</italic>
</td>
<td align="left">TGGTCTTTCTGGTGCTTGTCTC</td>
<td align="left">CAGTTCAGTATGTTCGGCTTCC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-4">
<title>2.4 Co-immunoprecipitation (Co-IP)</title>
<p>After extracting the proteins from the cells OE-<italic>hnRNP-F</italic> and the NC HK-2 cells, the lysates were pre-cleared with rabbit IgG (3 &#x3bc;g/mg protein) and protein A/G magnetic beads. Then, they were incubated overnight at 4 &#xb0;C with anti-<italic>hnRNP-F</italic> or control IgG (3 &#x3bc;g/mg protein). The complexes were captured with fresh magnetic beads (20 &#x3bc;L/500 &#x3bc;L lysate, room temperature for 2 h), washed three times with lysis buffer, and eluted in 1&#xd7; Laemmli buffer (95 &#xb0;C, 5 min) for immunoblotting.</p>
</sec>
<sec id="s2-5">
<title>2.5 Western blotting analysis</title>
<p>Total protein lysates (30 &#xb5;g/lane) from cells or renal tissues were separated by 10% SDS-PAGE and transferred to PVDF membranes (Millipore). After blocking with 5% non-fat milk/TBST for 1 hour, the membranes were incubated overnight at 4&#xb0;C with the following primary antibodies:<italic>hnRNP-F</italic>, <italic>&#x3b2;-actin</italic>, <italic>GAPDH</italic> (1:5000; Proteintech, 67701-1-Ig, 20536-1-AP, 60004-1-Ig), <italic>p-p65</italic> (1:500; Invitrogen, MA5-15160), <italic>p65</italic> (1:5000; Abclonal, A19653) and <italic>TNF-&#x3b1;</italic> (1:1000; Abcam, ab183218). Following TBST washes (3 &#xd7; 10 min), membranes were incubated 1 h with HRP-conjugated secondary antibodies: Goat anti-mouse, Goat anti-rabbit (1:1000; Proteintech, SA00001-1, SA00001-2). Signals were detected by ECL (Proteintech, P0018S) and quantified using ImageJ (NIH, v1.53e), normalized to <italic>&#x3b2;-actin</italic>/<italic>GAPDH</italic>.</p>
</sec>
<sec id="s2-6">
<title>2.6 RNA extraction and sequencing</title>
<p>All RNA was processed with RQ1 DNase (Promega) to remove DNA. The quality and quantity of the purified RNA were determined by measuring the absorbance at 260 nm/280 nm (A260/A280) utilizing SmartSpec Plus (BioRad). RNA integrity was further verified by 1.5% agarose gel electrophoresis.</p>
<p>For each sample, 1 &#x3bc;g of total RNA was used for RNA-seq library preparation. mRNAs were captured by VAHTS mRNA capture beads (Vazyme, N401). The purified RNA was treated with RQ1 DNase (Promega) to remove DNA before being used for directional VAHTS with a Universal V8 RNA-seq Library Prep Kit for Illumina (NR605). Polyadenylated mRNAs were purified and fragmented. Fragmented mRNAs were converted into double-stranded cDNA. Following end repair and A tailing, the DNAs were ligated to Adapter (N323). After purification of the ligation product and size fractioning to 300&#x2013;500 bps, the ligated products were amplified and purified, then quantified and stored at &#x2212;80 &#xb0;C before sequencing. The strand marked with dUTP (the second cDNA strand) is not amplified, allowing strand-specific sequencing.</p>
<p>For high-throughput sequencing, the libraries were prepared following the manufacturer&#x2019;s instructions and applied to an Illumina NovaSeq 6000 system for 150-nt paired-end sequencing.</p>
</sec>
<sec id="s2-7">
<title>2.7 RNA-seq raw data cleaning and alignment</title>
<p>First, raw reads containing more than 2-N bases were discarded. Then, adapters and low-quality bases were trimmed from raw sequencing reads using FASTX-Toolkit (Version 0.0.13). The short reads less than 16 nt were dropped as well. Afterward, clean reads were aligned to the GRCh38 genome by HISAT2 (<xref ref-type="bibr" rid="B21">Kim et al., 2015</xref>), allowing four mismatches. Uniquely mapped reads were used for gene read number counting and FPKM calculation (fragments per kilobase of transcript per million fragments mapped) (<xref ref-type="bibr" rid="B44">Trapnell et al., 2010</xref>).</p>
</sec>
<sec id="s2-8">
<title>2.8 Differentially expressed genes (DEG) analysis</title>
<p>The R Bioconductor package DESeq2 was applied to screen out the differentially expressed genes (DEGs) (<xref ref-type="bibr" rid="B29">Love et al., 2014</xref>). The P-value for correction &#x3c;0.05 and fold change &#x2265;2 or &#x2264;0.5 were set as the cut-off criteria for identifying DEGs.</p>
</sec>
<sec id="s2-9">
<title>2.9 Batch effect correction and quality control</title>
<p>To minimize potential batch effects and technical variability in RNA-seq data, we applied ComBat_seq, an empirical Bayes method implemented in the &#x201c;suva&#x201d; R package, to adjust for known batch information across samples while preserving biological variance. Prior to batch correction, principal component analysis (PCA) was performed to visualize sample clustering and assess batch-related variation. After correction, PCA and hierarchical clustering confirmed improved consistency within experimental groups.</p>
</sec>
<sec id="s2-10">
<title>2.10 Alternative splicing analysis</title>
<p>The AS events and regulated alternative splicing events (RAS) between OE-<italic>hnRNP-F</italic> and NC samples were defined and quantified by using the splice sites usage variation analysis (SUVA) pipeline as described previously. Differential splicing of each pair of cells was analyzed. The frequency and reads proportion of the SUVA AS event (pSAR) of each AS event were calculated. For alternative splicing validation, we performed <italic>RT-qPCR</italic> on independent samples (<italic>n</italic> &#x3d; 3 biological replicates) to confirm SUVA predictions, reporting both p-values and AS ratios in supplementary GraphPad data.</p>
</sec>
<sec id="s2-11">
<title>2.11 Functional enrichment analysis</title>
<p>In order to sort out functional categories of DEGs, Gene Ontology (GO) terms and KEGG pathways were identified using the KOBAS 2.0 server (<xref ref-type="bibr" rid="B50">Xie et al., 2011</xref>). The hypergeometric test and the Benjamini&#x2013;Hochberg FDR controlling procedure were used to define the enrichment of each term.</p>
</sec>
<sec id="s2-12">
<title>2.12 Gene set enrichment analysis (GSEA)</title>
<p>GSEA is an analytical method for genome-wide expression profile microarray data. By comparing genes with predefined gene sets, it can identify functional enrichment. A gene set means a group of genes sharing localization, pathways, functions, or other features. GSEA was conducted using the clusterProfiler package (version 4.6.2). The fold change of gene expression between the Mets group and the Primary group was calculated, and the gene list was generated in accordance with the change of &#x7c;log2FC&#x7c;. Afterward, we utilized GSEA-based enriched <italic>HALLMARK</italic> gene sets of the Molecular Signature Database.</p>
</sec>
<sec id="s2-13">
<title>2.13 CLIP-seq data analysis</title>
<p>Public sequence data files of CLIP-seq data of <italic>hnRNP-F</italic> in human 293T cells from GSE34993 were downloaded from the Sequence Read Archive (SRA). After reads were aligned onto the genome, only uniquely mapped reads were used for the following analysis. The &#x201c;ABLIRC&#x201d; strategy was used to identify the binding regions of RBP on the genome (<xref ref-type="bibr" rid="B49">Xia et al., 2017</xref>). Reads with at least 1-bp overlap were clustered as peaks. For each gene, computational simulation was used to randomly generate reads with the same number and lengths as reads in peaks. The output reads were further mapped to the same genes to generate random max peak heights from overlapping reads. The whole process was repeated 500 times. All the observed peaks with heights higher than those of random max peaks (&#x2a;<italic>P</italic> &#x3c; 0.05) were selected. The target genes of <italic>hnRNP-F</italic> were finally determined by the peaks, and the binding motifs were called by HOMER software (<xref ref-type="bibr" rid="B16">Heinz et al., 2010</xref>).</p>
</sec>
<sec id="s2-14">
<title>2.14 Other statistical analyses</title>
<p>Principal component analysis (PCA) was performed by the R package factoextra (<ext-link ext-link-type="uri" xlink:href="https://cloud.r-project.org/package=factoextra">https://cloud.r-project.org/package&#x3d;factoextra</ext-link>) to show the clustering of samples with the first two components. After controlling the reads by tags per million TPM) of each gene in samples, an in-house script (sogen) was used for visualization of next-generation sequence data and genomic annotations. The pheatmap package (<ext-link ext-link-type="uri" xlink:href="https://cran.r-project.org/web/packages/pheatmap/index.html">https://cran.r-project.org/web/packages/pheatmap/index.html</ext-link>) in R was used to perform the clustering based on Euclidean distance.</p>
</sec>
<sec id="s2-15">
<title>2.15 Animal experiments</title>
<p>Seven-week-old male <italic>db/db</italic> mice (C57BLKS/J background, 12 weeks old, mean body weight: 45.2 &#xb1; 3.1 g) and their <italic>db/m</italic> littermates were purchased from GemPharmatech Co., Ltd. (Chengdu, China) and maintained in the specific pathogen-free (SPF) animal facility at Hubei University of Chinese Medicine (Wuhan, China). All experimental procedures involving animals were performed in strict compliance with the institutional guidelines and approved by the Animal Ethics Committee of Hubei University of Chinese Medicine (Approval No. HUCMS00303837). DKD modeling success was defined by (1) fasting blood glucose &#x2265;16.7 mmol/L for three consecutive tests, (2) urine output &#x3e;150% of controls, and (3) persistent proteinuria (<xref ref-type="bibr" rid="B47">Wang et al., 2021</xref>).</p>
</sec>
<sec id="s2-16">
<title>2.16 Statistical analysis</title>
<p>All results are presented as the average value plus or minus the standard deviation (SD). Statistical analyses were performed using GraphPad Prism 10.1.2 software (GraphPad, San Diego, CA). Differences between experimental groups were evaluated using either a paired two-tailed Student&#x2019;s t-test or one-way ANOVA followed by Bonferroni&#x2019;s <italic>post hoc</italic> test for multiple comparisons. A P-value of &#x2264;0.05 was considered statistically significant.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>3 Results</title>
<sec id="s3-1">
<title>3.1 Effect of high-glucose on <italic>hnRNP-F</italic> protein level in HK2 cells</title>
<p>In cells treated under normal glucose and hypertonic conditions, there was no significant difference in <italic>hnRNP-F</italic> protein levels between the two groups (<italic>P</italic> &#x3e; 0.05). However, in HK-2 cells cultured with HG concentrations, <italic>hnRNP-F</italic> levels were significantly reduced (&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01) (<xref ref-type="fig" rid="F1">Figures 1A&#x2013;C</xref>). Western blot analysis demonstrated that high-glucose downregulated <italic>hnRNP-F</italic> expression. Mannitol, used as an osmotic control, exhibited no significant effect on <italic>hnRNP-F</italic> gene expression. Consistent with protein-level observations, <italic>RT-qPCR</italic> confirmed significant upregulation of <italic>hnRNP-F</italic> mRNA in high-glucose-treated HK-2 cells (&#x2a;<italic>P</italic> &#x3c; 0.05 vs. control) (<xref ref-type="fig" rid="F1">Figures 1D,E</xref>), while treatment with equiosmolar mannitol showed no comparable effect (<italic>P</italic> &#x3e; 0.05).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>
<italic>hnRNP-F</italic> expression in HK-2 cells under HG and hyperosmotic conditions. <bold>(A)</bold> Representative immunoblots of hnRNP-F protein in Con, Normal glucose (5.5 mM); HG, High-glucose (30 mM); Man, Hyperosmotic control (mannitol, 30 mM). <bold>(B,C)</bold> Quantitative analysis of hnRNP-F protein normalized to GAPDH or &#x3b2;-actin. <bold>(D,E)</bold> <italic>hnRNP-F</italic> mRNA levels normalized to <italic>GAPDH</italic> or <italic>&#x3b2;-actin</italic> by <italic>RT-qPCR</italic>. Error bars represent mean &#xb1; SEM. Statistical comparisons were performed using one-way ANOVA with <italic>post hoc</italic> tests; &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001; ns: not significant.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g001.tif">
<alt-text content-type="machine-generated">Western blot and bar graph analysis showing hnRNP-F, GAPDH, and &#x3B2;-actin protein levels in HK-2, HK-2&#x2b;MA, and HK-2&#x2b;HG groups. Bars indicate protein and mRNA levels of hnRNP-F relative to GAPDH and &#x3B2;-actin. Significant differences are marked with asterisks, indicating statistical significance: &#x2a;&#x2a; for p &#x3C; 0.01, &#x2a;&#x2a;&#x2a; for p &#x3C; 0.001, and &#x2a;&#x2a;&#x2a;&#x2a; for p &#x3C; 0.0001. Results show a decrease in hnRNP-F protein and mRNA levels in HG compared to NC and MA groups.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<title>3.2 Overexpression of <italic>hnRNP-F</italic> regulates gene expression in high-glucose-treated renal tubular epithelial cells</title>
<p>Overexpression of <italic>hnRNP-F</italic> was constructed in HK2 cells cultured in a HG environment. qPCR results showed that <italic>hnRNP-F</italic> gene expression levels were upregulated in HK-2 cells after infection with overexpression of the <italic>hnRNP-F</italic> lentivirus (<xref ref-type="fig" rid="F2">Figure 2A</xref>). To comprehensively investigate the <italic>hnRNP-F</italic>-mediated transcriptional regulation in high-glucose (HG) conditions, we constructed cDNA libraries prepared from control and <italic>hnRNP-F</italic>-overexpression cells (three biological replicates), which were incubated in high-glucose and mannitol. After removing adapters and contaminating sequences, we obtained a total of 742.7 million high-quality reads from each sample (<xref ref-type="sec" rid="s11">Supplementary Table S2</xref>). Approximately 91.2%&#x2013;96.39% paired-end reads per sample were then aligned to the human GRCH38 genome. RNA-seq yielded robust expression for 18,051 genes (<xref ref-type="sec" rid="s11">Supplementary Table S3</xref>). PCA was carried out and revealed excellent clustering of expression gene changes between the OE-<italic>hnRNP-F</italic> HK-2 cells and control samples for different treatment conditions (<xref ref-type="fig" rid="F2">Figure 2B</xref>). To evaluate the dynamics of gene expression between OE-<italic>hnRNP-F</italic> vs. Ctrl cells, we compared expression among all pairwise combinations of the samples using <italic>DESeq2</italic> (<xref ref-type="bibr" rid="B29">Love et al., 2014</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>
<italic>hnRNP-F</italic> regulates gene expression in HK-2 cells. <bold>(A)</bold> Verification of <italic>hnRNP-F</italic> mRNA expression in OE-<italic>hnRNP-F</italic> and NC HK2 cells under high-glucose conditions (HG-NC vs. HG-OE) using <italic>RT-qPCR</italic>. <bold>(B)</bold> Principal component analysis (PCA) of all samples based on normalized gene expression levels, showing clustering of HG-NC, HG-OE, OS-NC, and OS-OE groups. <bold>(C)</bold> Venn diagrams showing the overlap of differentially expressed genes (DEGs) between high-glucose (HG) and osmolality-control (OS) conditions. Left: upregulated genes; right: downregulated genes. <bold>(D)</bold> Dot plot displaying the top 10 enriched Gene Ontology (GO) biological process (BP) terms among upregulated genes in HG-OE vs. HG-NC. <bold>(E)</bold> Dot plot displaying the top 10 enriched GO biological process (BP) terms among downregulated genes in HG-OE vs. HG-NC. <bold>(F)</bold> Expression profiles of selected inflammation-related DEGs (<italic>CXCL8, GDF15, IL6, PTX3</italic>, and <italic>TFPI2</italic>) across four groups, shown as FPKM values from RNA-seq (left) and validated by <italic>RT-qPCR</italic> (right). Error bars represent mean &#xb1; SEM. Statistical comparisons were performed using one-way ANOVA with <italic>post hoc</italic> tests; &#x2a;<italic>P</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001, and &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001; ns, not significant.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g002.tif">
<alt-text content-type="machine-generated">Graphs and diagrams depict gene expression analysis. Panel A shows a bar graph comparing relative expression of HNRNPF in two groups. Panel B presents a PCA plot of all detected genes across four groups. Panel C illustrates Venn diagrams comparing up- and down-regulated genes between HG and OS groups. Panels D and E display dot plots of top gene ontology processes for up-regulated and down-regulated genes, respectively. Panel F contains bar graphs comparing expression levels of CXCL8, GDF15, IL6, PTX3, and TFPI2, with significant differences marked.</alt-text>
</graphic>
</fig>
<p>OE-<italic>hnRNP-F</italic> affects many gene expressions under HG conditions. A total of 890 DEGs were obtained (<italic>P</italic>-value of &#x3c;0.05, fold change &#x2265;2, or &#x2264;0.5, FDR &#x2264;0.05), of which 568 genes were upregulated and 322 genes were downregulated (<xref ref-type="sec" rid="s11">Supplementary Table S4</xref>). Mannitol treatment was found to affect the expression of some genes (<xref ref-type="sec" rid="s11">Supplementary Table S5</xref>), while the number of DEGs was larger in HK-2 cells treated with high-glucose than in HK-2 cells treated with mannitol. A Venn diagram illustrating the profiles of DEGs reveals an overlap between glucose and mannitol treatment (<xref ref-type="fig" rid="F2">Figure 2C</xref>). This analysis displays unique and overlapping sets of DEGs in <italic>hnRNP-F</italic> overexpressing cells under HG treatment. Venn diagram analysis revealed an intersection of 118 genes between the high-glucose-treated and mannitol-treated OE-<italic>hnRNP-F</italic> HK-2 cells. Mannitol did not drastically affect overall gene expression when used as an osmolar control treatment.</p>
<p>To correlate the <italic>hnRNP-F</italic>-regulated gene expression and biological functions under high-glucose, we subjected all 890 DEGs to GO annotation (<xref ref-type="sec" rid="s11">Supplementary Tables S6, S7</xref>). In the biological processes (BPs) of GO analysis, the upregulated genes in the <italic>OE-hnRNP-F</italic> samples were highly enriched in the &#x201c;extracellular matrix organization&#x201d; and &#x201c;cell adhesion&#x201d; processes (<xref ref-type="fig" rid="F2">Figure 2D</xref>). The downregulated genes were mainly enriched in the inflammatory response and other related biological processes, as well as &#x201c;regulation of insulin secretion,&#x201d; &#x201c;response to ischemia,&#x201d; &#x201c;regulation of insulin secretion,&#x201d; positive regulation of angiogenesis,&#x201d; and &#x201c;response to hypoxia,&#x201d; which are closely related to the pathogenesis of DKD (<xref ref-type="fig" rid="F2">Figure 2E</xref>; <xref ref-type="sec" rid="s11">Supplementary Table S7</xref>). Among these, the decreased expression of inflammation-related genes was of particular interest. Representative genes from inflammatory-related genes (<italic>CXCL8</italic>, <italic>IL6</italic>, <italic>GDF15</italic>, <italic>PTX3</italic>, and <italic>TFPI2</italic>) were selected for <italic>RT-qPCR</italic> validation of their mRNA levels. <italic>CXCL8</italic> and <italic>IL6</italic> were found to be enriched in the tumor necrosis factor pathway (<xref ref-type="sec" rid="s11">Supplementary Table S6</xref>)<italic>.</italic> KEGG pathway enrichment analysis was also performed (<xref ref-type="sec" rid="s11">Supplementary Figures S1A,B</xref>; <xref ref-type="sec" rid="s11">Supplementary Table S8</xref>). The downregulated genes were also enriched in the <italic>TNF</italic> signaling pathway (<xref ref-type="sec" rid="s11">Supplementary Figure S1B</xref>). The GO enrichment pathway of differentially expressed genes following mannitol treatment in HK-2 cells with <italic>hnRNP-F</italic> overexpression differs from that observed under HG conditions (<xref ref-type="sec" rid="s11">Supplementary Figures S1C,D</xref>). Compared with HK-2 cells treated with HG and transfected with the empty vector (HG-NC group), overexpression of <italic>hnRNP-F</italic> could significantly downregulate the expression of <italic>CXCL8</italic>, <italic>IL6</italic>, <italic>GDF15</italic>, <italic>PTX3</italic>, and <italic>TFPI2</italic> (&#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001). The qPCR results were consistent with RNA sequencing data (<xref ref-type="fig" rid="F2">Figure 2F</xref>). The primers are listed in <xref ref-type="sec" rid="s11">Supplementary Table S1</xref>. In the hyperosmotic mannitol control condition, the overexpression of <italic>hnRNP-F</italic> resulted in the significant downregulation of only two genes, <italic>IL6</italic> and <italic>GDF15.</italic> This suggests that the upregulation of <italic>hnRNP-F</italic> under normoglycemic conditions did not exert any significant effect. However, under hyperglycemic conditions, it led to a marked reduction in the expression of genes associated with the inflammatory response, particularly those involved in the TNF signaling pathway and the pathogenesis of DKD.</p>
</sec>
<sec id="s3-3">
<title>3.3 Overexpression of <italic>hnRNP-F</italic> downregulates the transcription of genes involved in the <italic>TNF</italic> signaling pathway under HG conditions</title>
<p>We performed GSEA of genes differentially expressed upon <italic>hnRNP-F</italic> overexpression under high-glucose. The overexpression of <italic>hnRNP-F</italic> resulted in a significant inhibition of the <italic>TNF&#x3b1;/NF&#x3ba;B</italic> signaling pathway (<xref ref-type="fig" rid="F3">Figure 3A</xref>). As demonstrated in <xref ref-type="fig" rid="F3">Figure 3B</xref>, the upregulation of <italic>hnRNP-F</italic> resulted in a notable decrease in the expression of <italic>PTX3</italic> and <italic>IL6</italic>, both of which are genes associated with the <italic>TNF&#x3b1;/NF&#x3ba;B</italic> signaling pathway. Even in the hypertonic control of mannitol, overexpression of <italic>hnRNP-F</italic> inhibited the expression of these genes. The findings indicated that the upregulation of <italic>hnRNP-F</italic> suppressed the transcription of genes associated with the <italic>TNF</italic> signaling pathway, such as <italic>CXCL8, IL6</italic>, and <italic>PTX3</italic>.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>GSEA analysis for <italic>hnRNP-F</italic> overexpression in HK-2 cells. <bold>(A)</bold> Enrichment plot from gene set enrichment analysis (GSEA) showing significant negative enrichment of TNF&#x3b1; signaling via the NF&#x3ba;B pathway (HALLMARK_TNF&#x3b1;_SIGNALING_VIA_NF&#x3ba;B) in the HG-OE vs. the HG-NC group. <bold>(B)</bold> Hierarchical clustering heatmap showing the expression levels of TNF&#x3b1;/NF&#x3ba;B pathway-related genes across four sample groups: HG-NC, HG-OE, OS-NC, and OS-OE. Red and blue represent relative up- and downregulation, respectively.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g003.tif">
<alt-text content-type="machine-generated">Panel A displays a Gene Set Enrichment Analysis (GSEA) plot highlighting the TNFA signaling via NF&#x3ba;B. The running enrichment score decreases, with p-values indicated as 0.001022 and adjusted to 0.03474. Panel B is a heatmap clustering gene expression levels across different conditions. Genes like GPR183 and TNF are mapped, with colors ranging from blue to orange, denoting expression levels. A color key indicates groups HG-NC, HG-OE, OS-NC, and OS-OE.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<title>3.4 Identification that <italic>hnRNP-F</italic> regulates alternative splicing events in HK-2 cells under high-glucose conditions</title>
<p>Given the multi-functional nature of <italic>hnRNP-F</italic> as an RNA-binding protein, our analysis also encompasses the impact of <italic>hnRNP-F</italic> on the regulation of AS events. We obtained a total of 125 million uniquely mapped reads from each sample, in which 33.15%&#x2013;44.04% were junction reads (<xref ref-type="sec" rid="s11">Supplementary Table S2</xref>). We analyzed the RNA-seq data using the software SUVA (9). Our analysis revealed the presence of distinct alternative splicing events (ASEs) and regulated alternative splicing events (RASEs) among the OE-<italic>hnRNP-F</italic> and control cells in the HG and mannitol-treated groups. Specifically, alt3p and alt5p were the main ASEs and RASEs between <italic>OE-hnRNP-F</italic> and control cells (<xref ref-type="fig" rid="F4">Figure 4A</xref>; <xref ref-type="sec" rid="s11">Supplementary Figure S3A</xref>; <xref ref-type="sec" rid="s11">Supplementary Table S9</xref>. The SUVA-identified ASEs corresponded to the classical ASEs. <italic>hnRNP-F</italic> overexpression processing in HG cultured HK-2 cells resulted in a large number of differential variable splicing events, with a total of 1,158 significant RASEs detected. The main variable splicing event types included 65 3pMXE, 66 5pMXE, 230 A3SS, 27 A3SS&#x26;ES, 177 A5SS, 52 A5SS&#x26;ES, 261 ES, 4 IntronR, 67 MXE, and 209 cassette exons (<xref ref-type="fig" rid="F4">Figure 4B</xref>; <xref ref-type="sec" rid="s11">Supplementary Table S9</xref>). Mannitol treatment mainly affects the AS events of A3SS and ES (<xref ref-type="sec" rid="s11">Supplementary Figure S3B</xref>; <xref ref-type="sec" rid="s11">Supplementary Table S9</xref>). <xref ref-type="fig" rid="F3">Figure 3C</xref> illustrates the presence of novel splicing events among the RASEs under HG conditions, a finding that aligns with the results observed following mannitol treatment (<xref ref-type="sec" rid="s11">Supplementary Figure S3C</xref>). These findings suggest that the overexpression of <italic>hnRNP-F</italic> can modulate intracellular alternative splicing in response to hypertonic treatment conditions.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>
<italic>hnRNP-F</italic> regulates alternative splicing events in HK-2 cells. <bold>(A)</bold> Bar plot showing the number of regulated alternative splicing (RAS) events among OE and NC samples detected by SUVA. <bold>(B)</bold> Bar plot categorizing splice junctions constituting RAS events detected by SUVA into classical alternative splicing (AS) event types and displaying the number of each type. <bold>(C)</bold> Bar plot showing the number of known and novel RAS events. <bold>(D)</bold> Bar plot showing the number of RAS events with different abundances (pSAR) among all RAS with a frequency &#x2265;50%. RAS with pSAR &#x2265;50% are further analyzed and marked in red. <bold>(E)</bold> Venn diagram showing the overlap of high-confidence RAS events (pSAR &#x2265; 50%) identified under high-glucose (HG) and osmolality-control (OS) conditions. <bold>(F)</bold> The top 10 most enriched Gene Ontology (GO) terms related to biological processes are visualized for genes involved in RAS when comparing OE and NC samples. <bold>(G)</bold> Visualization of the read distribution of <italic>TRIP6</italic> in AS event clualt5p46323 from different groups, with splice junctions (SJs) labeled with SJ read numbers and the altered exon marked with a box. RNA-seq and <italic>RT-qPCR</italic> validation of the splicing ratio profile of the splicing event shown on the right. &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001. <bold>(H)</bold> Visualization of the read distribution of OSMR in AS event clualt3p40080 from different groups, with splice junctions labeled with SJ read numbers and altered splice sites marked with a box. RNA-seq and <italic>RT-qPCR</italic> validation of the splicing ratio profile of the splicing event shown on the right. &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g004.tif">
<alt-text content-type="machine-generated">A composite figure with several panels showing data visualizations and diagrams. Panels A, B, C, and D feature bar charts with various classifications and numbers. Panel E has a Venn diagram illustrating RAS overlap between two groups labeled HG and OS.Panel F is a dot plot displaying gene enrichment information with p-values and gene counts. Panels G and H show splicing diagrams with read coverage and splicing ratios, including box plots and bar charts for TRIP6 and OSMR genes. Statistical significance is annotated with p-values and asterisks.</alt-text>
</graphic>
</fig>
<p>Due to a splicing event involving two transcripts, which may account for a very small proportion of the entire gene expression, our study focused on identifying the more dominant transcripts in splicing events. We specifically quantified the number of splicing events with varying proportions of RASEs in the region covered by all reads. We also excluded splicing events with a low proportion (pSAR&#x3c;50%). A total of 687 events with pSAR&#x3e;50% were detected in overexpression <italic>hnRNP-F</italic> cells treated with high-glucose (<xref ref-type="fig" rid="F4">Figure 4D</xref>). A total of 611 events were detected in the cells treated with mannitol (<xref ref-type="sec" rid="s11">Supplementary Figure S3D</xref>). While a diversity of AS events was observed in cells treated with mannitol, the functional disparities in these splicing events between the two groups were pronounced when compared to the HG group. Notably, only 36 AS events were common to both treatment conditions (<xref ref-type="fig" rid="F4">Figure 4E</xref>). This result indicated that overexpressed <italic>hnRNP-F</italic> HK-2 cells have a distinct AS profile in response to HG exposure. Gene Ontology biological process (GO-BP) enrichment analysis revealed that the HG group exhibited significant alterations in alternative splicing, predominantly enriched in pathways related to &#x201c;regulation of RNA splicing&#x201d; and &#x201c;RNA splicing&#x201d; (<xref ref-type="fig" rid="F4">Figure 4F</xref>). The AS events of the mannitol group were mainly enriched in the &#x201c;microvillus assembly&#x201d; and &#x201c;epithelial tube formation&#x201d; pathway (<xref ref-type="sec" rid="s11">Supplementary Figure S3E</xref>). To validate the accuracy of the predicted <italic>hnRNP-F</italic>-regulated ASEs selected from the RNA-seq data under the HG condition, two RASEs were selected for verification. The ratio of variable splicing events occurring in the gene <italic>OSMR</italic> (alt3p) decreased in the OE-<italic>HNRNP-F</italic> group (<xref ref-type="fig" rid="F4">Figure 4H</xref>), and increased in the gene <italic>TRIP6</italic> (alt5p) (<xref ref-type="fig" rid="F4">Figure 4G</xref>), as expected. We present the designed PCR primer pairs in <xref ref-type="sec" rid="s11">Supplementary Table S1</xref>. <italic>TRIP6</italic> mediates inflammatory response and renal fibrosis in diabetic nephropathy (<xref ref-type="bibr" rid="B26">Lin et al., 2021</xref>).</p>
</sec>
<sec id="s3-5">
<title>3.5 <italic>hnRNP-F</italic> CLIP-seq reads revealed that <italic>hnRNP-F</italic> bound to splicing factors and regulated alternative splicing events</title>
<p>The <italic>hnRNP-F</italic> CLIP-seq data in human 293T cells were obtained from the SRA database accession number GSE34993. These data were utilized to identify transcripts that interact with <italic>hnRNP-F</italic> in cells. Only reads that mapped uniquely were included in the subsequent analysis. Comparisons between the control group and the IP groups revealed that the reads in the latter were predominantly enriched in noncoding exons, introns, and the 3&#x2032;UTR region (<xref ref-type="fig" rid="F5">Figure 5A</xref>). RNA-binding proteins that bind to the 3&#x2032;UTR region often have an impact on RNA stability, suggesting that <italic>hnRNP-F</italic> may influence RNA stability.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>
<italic>hnRNP-F</italic> binds to other splicing factors and regulates alternative splicing of <italic>RBM41</italic>. <bold>(A)</bold> Bar plot showing the distribution of genomic regions of <italic>HNRNP-F</italic>-bound peaks. <bold>(B)</bold> The five most enriched motif sequences among the <italic>HNRNP-F</italic>-bound peaks were identified using HOMER software. <bold>(C)</bold> Dot plot showing the top 10 enriched GO biological processes of genes bound by <italic>HNRNP-F</italic>. <bold>(D)</bold> Venn diagram illustrating the overlap between <italic>HNRNP-F</italic>-bound genes and <italic>HNRNP-F</italic>-regulated differentially expressed genes (DEGs) in HK-2 cells and 293T cells (Up HK-2 cells; Down 293T cells). <bold>(E)</bold> Venn diagram illustrating the overlap between <italic>HNRNP-F</italic>-bound genes and <italic>HNRNP-F</italic>-regulated alternatively spliced genes in HK-2 cells and 293T cells (Up HK-2 cells; Down 293T cells). <bold>(F)</bold> Visualization of the read distribution of <italic>RBM41</italic> in the AS event cluir47843 from different groups, with splice junctions labeled with the SJ read number. The model and NC were derived from the RNA-seq data of 293T cells, while OE-<italic>HNRNP-F</italic> and NC were derived from the RNA-seq data of HK-2 cells.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g005.tif">
<alt-text content-type="machine-generated">Multiple panels display data related to hnRNP-F-bound genes. Panel A shows a bar graph depicting gene regions with the highest percentage in introns. Panel B includes motifs with motifs ranked and p-values. Panel C offers a dot plot of hnRNP-F-bound gene functions, emphasizing RNA splicing. Panels D and E feature Venn diagrams showing overlaps of differentially expressed genes and hnRNP-F-bound genes. Panel F provides genomic mapping with peaks indicating hnRNP-F binding sites.</alt-text>
</graphic>
</fig>
<p>Hypergeometric Optimization of Motif EnRichment (HOMER v4.11, <ext-link ext-link-type="uri" xlink:href="http://homer.ucsd.edu/homer/">http://homer.ucsd.edu/homer/</ext-link>) was employed for motif analysis of the specific binding peaks identified in the experimental samples. The motif enrichment analysis of the immunoprecipitation (IP) groups revealed enrichment of the UA-rich motif 5&#x2032;-UUA-3&#x2032; in the <italic>hnRNP-F-</italic>bound motif (<xref ref-type="fig" rid="F5">Figure 5B</xref>). Subsequently, the gene sequences corresponding to the bound peak clusters were aligned with the GO database for annotation, which indicated enrichment ion the RNA splicing process. These primarily included the heterogeneous ribonucleoprotein (<italic>HNRNP</italic>) family as well as <italic>SRSF</italic> splicing factors, including <italic>HNRNPA2B1</italic>, <italic>HNRNPH, HNRNPU, SRSF1, SRSF5,</italic> and <italic>SRSF11</italic> (<xref ref-type="fig" rid="F5">Figure 5C</xref>). Studies have shown that <italic>HNRNPA2B1</italic>-binding motifs were UA rich (<xref ref-type="bibr" rid="B48">Wu et al., 2018</xref>).</p>
<p>Next, we asked whether differences in <italic>hnRNP-F</italic> binding genes were associated with different gene expressions. We performed gene-based differential binding analyses. We separately analyzed the transcriptome data of <italic>hnRNP-F</italic> in human 293T cells (GSE34995) and the transcriptome data of <italic>hnRNP-F</italic> in HK-2 cells that we independently measured. The results showed that <italic>hnRNP-F</italic>-binding genes overlap with differently expressed genes. Of particular interest was the observation that the lncRNA <italic>SNHG1</italic>, when bound by <italic>hnRNP-F</italic> in 293T cells, exhibited differential expression in HK-2 cells overexpressing <italic>hnRNP-F</italic> (OE-hnRNP-F). Otherwise, in 293T cells, the lncRNA <italic>SNHG1</italic> underwent alternative splicing (<xref ref-type="fig" rid="F5">Figures 5D,E</xref>). We also performed an association analysis utilizing CLIP-seq and AS methodologies, which revealed that AS events occurred in four gene regions where <italic>hnRNP-F</italic> binds in HK-2 and in 16 gene regions in 293T cells (<xref ref-type="fig" rid="F5">Figure 5E</xref>). The AS events of gene <italic>RBM41</italic> were detected in both cells (<xref ref-type="fig" rid="F5">Figure 5E</xref>). The analysis of distribution maps indicated that the overexpression of <italic>hnRNP-F</italic> in HK-2 cells led to a diverse intron retention (ir) AS event of <italic>RBM41</italic>. Similarly, in 293T cells with <italic>hnRNP-F</italic> knockdown, an ir AS event was also observed in <italic>RBM41</italic>. There is an <italic>hnRNP-F</italic> bound site near the splicing site (<xref ref-type="fig" rid="F5">Figure 5F</xref>). The findings suggest that <italic>hnRNP-F</italic> can interact with <italic>RBM41</italic>. The interaction between <italic>hnRNP-F</italic> and <italic>RBM41</italic> results in the production of a truncated transcript of <italic>RBM41</italic>. Our hypothesis posits that the truncated transcript generated by <italic>RBM41</italic> could potentially influence the AS events. Nonetheless, given that the experiment conducted in 293T cells involved the knockdown of <italic>hnRNP-F</italic> and was characterized by a relatively low sequencing depth, this AS event warrants further experimental investigation.</p>
</sec>
<sec id="s3-6">
<title>3.6 Experimental validation of <italic>hnRNP-F</italic>-regulated differential gene expression in a <italic>db/db</italic> mouse model</title>
<p>Initially, we observed a significant reduction in the levels of <italic>hnRNP-F</italic> protein in the kidney of <italic>db/db</italic> mice compared to <italic>db/m</italic> controls (&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001) (<xref ref-type="fig" rid="F6">Figures 6A&#x2013;C</xref>). Subsequently, we validated the differentially expressed genes identified through RNA-seq (DEGs: <italic>CXCL8, GDF15, IL6, PTX3,</italic> and <italic>TFPI2</italic>) by <italic>RT-qPCR</italic>. Notably, <italic>CXCL8</italic> is a chemokine specific to humans and lacks a direct ortholog in mice, which precludes its validation in murine models. Compared to <italic>db/m</italic> controls, <italic>db/db</italic> mice demonstrated significantly elevated renal expression of genes associated with inflammation (<italic>GDF15</italic>, <italic>IL6</italic>, <italic>PTX3</italic>, and <italic>TFPI2</italic>, &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001) (<xref ref-type="fig" rid="F6">Figures 6D&#x2013;G</xref>), suggesting their critical roles in the progression of DKD. The downregulation of <italic>hnRNP-F</italic> protein may have facilitated the upregulation of these genes in the <italic>db/db</italic> mouse model.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Expression of <italic>hnRNP-F</italic> in the kidneys of <italic>db/db</italic> mice and validation of its differentially expressed genes. <bold>(A)</bold> Representative immunoblot images showing hnRNP-F protein expression in the kidneys of <italic>db/db</italic> and <italic>db/m</italic> mice. <bold>(B,C)</bold> Quantification of hnRNP-F protein levels normalized to GAPDH or &#x3b2;-actin as internal controls. <bold>(D&#x2013;G)</bold> mRNA levels of <italic>hnRNP-F</italic>-modulated differentially expressed genes quantified by <italic>RT-qPCR</italic>. Error bars represent mean &#xb1; SEM. Statistical comparisons were performed using one-way ANOVA with <italic>post hoc</italic> tests; &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001; ns: not significant.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g006.tif">
<alt-text content-type="machine-generated">A series of experiments comparing db/m and db/db mice shows: A) Western blots for hnRNP-F, GAPDH, and &#x3B2;-actin proteins. B) and C) Bar graphs showing the relative protein levels of hnRNP-F normalized to GAPDH and &#x3B2;-actin, respectively, with db/db mice having significantly lower levels. D-G) Bar graphs showing relative mRNA levels of GDF15, IL-6, PTX3, and TFPI2, with db/db mice having significantly higher levels. Significant differences are noted with asterisks.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-7">
<title>3.7 <italic>hnRNP-F</italic> overexpression exerts anti-inflammatory effects in MPC5 cells under HG conditions</title>
<p>Under HG conditions, MPC-5 cells demonstrated a significant reduction in <italic>hnRNP-F</italic> protein levels (&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01), with minimal correlation to hyperosmolarity induced by mannitol (<xref ref-type="fig" rid="F7">Figures 7A&#x2013;E</xref>). In cells stably transfected to overexpress <italic>hnRNP-F</italic> (validated by immunoblotting) (<xref ref-type="fig" rid="F7">Figures 7F,G</xref>), <italic>TNF-&#x3b1;</italic> expression was significantly attenuated in HG conditions (&#x2a;<italic>P</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F7">Figures 7H,K</xref>), and <italic>NF-&#x3ba;B p-p65</italic> phosphorylation was notably suppressed (&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01) (<xref ref-type="fig" rid="F7">Figures 7H&#x2013;J</xref>).</p>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption>
<p>Role of <italic>hnRNP-F</italic> in MPC-5 cells under high-glucose and its regulation of <italic>TNF-&#x3b1;/NF-&#x3ba;B</italic> signaling. <bold>(A)</bold> Representative Western blot analysis of hnRNP-F protein in NG: Normal glucose (5.5 mM), HG: High-glucose (30 mM), Man: Hyperosmotic control (mannitol, 30 mM). <bold>(B,C)</bold> Quantitative analysis of hnRNP-F protein normalized to GAPDH or &#x3b2;-actin. <bold>(D,E)</bold> <italic>hnRNP-F</italic> mRNA levels normalized to <italic>GAPDH</italic> or <italic>&#x3b2;-actin</italic> by <italic>RT-qPCR</italic>. <bold>(F)</bold> <italic>hnRNP-F</italic> protein in vector-transfected (NC) and <italic>hnRNP-F-</italic>overexpressing (OE) MPC-5 cells under high-glucose. <bold>(G)</bold> <italic>hnRNP-F</italic> mRNA levels in NC and OE cells under high-glucose. <bold>(H)</bold> Western blot analysis of TNF-&#x3b1;/NF-&#x3ba;B pathway components in NC and OE cells: TNF-&#x3b1;, Total p65, Phospho-p65 (Ser536). <bold>(I)</bold> Quantitative analysis of Phospho-p65/total p65 ratio. <bold>(J)</bold> Quantitative analysis of p65/&#x3b2;-actin. <bold>(K)</bold> Quantitative analysis of TNF-&#x3b1;/&#x3b2;-actin. Error bars represent mean &#xb1; SEM. Statistical comparisons were performed using one-way ANOVA with <italic>post hoc</italic> tests; &#x2a;<italic>P</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001, and &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001; ns, not significant.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g007.tif">
<alt-text content-type="machine-generated">Western blot and bar graphs demonstrating hnRNP-F protein and mRNA expression levels under various treatments. Panels include A: Western blot results for hnRNP-F, GAPDH, and &#x3B2;-actin in MPC5 cells under different conditions. B, C: Bar graphs showing relative protein levels of hnRNP-F normalized to GAPDH and &#x3B2;-actin. D, E: Relative mRNA levels normalized to GAPDH and &#x3B2;-actin. F: Western blot for &#x3B2;-actin, HN-flag, and hnRNP-F in different cell lines. G: Bar graph for mRNA expression in cell lines. H: Western blot for p-NF&#x3ba;B p65, TNF-&#x3B1;, with treatments. I-K: Bar graphs for protein levels normalized to controls, indicating significant changes. Statistical significance noted by asterisks.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-8">
<title>3.8 Effect of LPS on <italic>hnRNP-F</italic> expression and anti-inflammatory effects of <italic>hnRNP-F</italic> overexpression in LPS-treated MPC5 cells</title>
<p>Under LPS-induced inflammatory conditions, <italic>hnRNP-F</italic> protein levels were significantly decreased in both HK-2 cells and MPC-5 podocytes (&#x2a;<italic>P</italic> &#x3c; 0.001; <italic>P</italic> &#x3c; 0.01; <xref ref-type="fig" rid="F8">Figures 8A&#x2013;F</xref>). In MPC-5 cells stably transfected to overexpress <italic>hnRNP-F</italic>, TNF-&#x3b1; expression was markedly attenuated (&#x2a;<italic>P</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F8">Figure 8I</xref>), and NF-&#x3ba;B p-p65/p65 was significantly suppressed (&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01) (<xref ref-type="fig" rid="F8">Figures 8G,H</xref>) under LPS exposure.</p>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption>
<p>Expression of <italic>hnRNP-F</italic> in HK2 cells and MPC-5 cells under LPS conditions and its regulation of the TNF-&#x3b1;/NF-&#x3ba;B signaling pathway in MPC-5 cells. <bold>(A)</bold> Representative immunoblot images of hnRNP-F protein expression in HK-2 cells under LPS conditions (10 &#xb5;g/mL) and normal conditions. <bold>(B)</bold> Quantitative analysis of hnRNP-F protein normalized to &#x3b2;-actin in HK-2 cells under normal and LPS conditions. <bold>(C)</bold> <italic>hnRNP-F</italic> mRNA levels in HK-2 cells under normal and LPS conditions were quantified by RT-qPCR and normalized to <italic>&#x3b2;-actin</italic>. <bold>(D)</bold> Representative immunoblot images of hnRNP-F protein expression in MPC5 cells under LPS conditions (45 &#xb5;g/mL) and normal conditions. <bold>(E)</bold> Quantitative analysis of hnRNP-F protein normalized to &#x3b2;-actin in MPC5 cells under normal and LPS conditions. <bold>(F)</bold> <italic>hnRNP-F</italic> mRNA levels in MPC5 cells under normal and LPS conditions were quantified by RT-qPCR and normalized to <italic>&#x3b2;-actin</italic>. <bold>(G)</bold> Western blot of TNF-&#x3b1;/NF-&#x3ba;B pathway components in NC-hnRNP-F and OE-hnRNP-F MPC5 cells: TNF-&#x3b1;, total p65, phosphorylated p65 (Ser536). <bold>(H)</bold> Quantitative analysis of the phosphorylated p65/total p65 ratio in MPC5 cells under basal and LPS conditions. <bold>(I)</bold> Quantitative analysis of TNF-&#x3b1;/&#x3b2;-actin in MPC5 cells under basal and LPS conditions. Error bars represent mean &#xb1; SEM. Statistical comparisons were performed using one-way ANOVA with <italic>post hoc</italic> tests; &#x2a;<italic>P</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001; ns, not significant.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g008.tif">
<alt-text content-type="machine-generated">Western blot analysis and bar graphs show relative expression levels of hnRNP-F, NF&#x3BA;B p65, and TNF-&#x3B1; in different cell treatments: HK2, MPC5, and their combinations with LPS. Panels A, D, and G present protein bands for hnRNP-F, p-NF&#x3BA;B p65, NF&#x3BA;B p65, and TNF-&#x3B1; with &#x3B2;-actin as control. Panels B, C, E, F, H, and I show corresponding relative expression levels with significant differences marked by asterisks, denoting statistical significance: one asterisk for P &#x3C; 0.05, two for P &#x3C; 0.01, three for P &#x3C; 0.001, and four for P &#x3C; 0.0001.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-9">
<title>3.9 <italic>hnRNP-F</italic> is physically associated with <italic>ZFP36</italic> to form a complex that regulates gene expression and alternative splicing</title>
<p>To elucidate the mechanistic role of <italic>hnRNP-F</italic> in transcriptional repression, we conducted Co-IP experiments to examine the <italic>hnRNP-F</italic> interactome <italic>in vivo</italic>. In these experiments, HK-2 cells were engineered to stably overexpress <italic>hnRNP-F</italic>. Total protein lysates were subjected to immunoprecipitation using antibodies specific to <italic>hnRNP-F</italic>, followed by WB with antibodies targeting <italic>ZFP36, HNRNPH</italic>, and <italic>FOXP3</italic> (<xref ref-type="fig" rid="F9">Figure 9</xref>). The Co-IP analysis using <italic>hnRNP-F</italic>antibodies, followed by WB with <italic>ZFP36</italic> antibodies, demonstrated a physical association between <italic>hnRNP-F</italic> and <italic>ZFP36.</italic> The <italic>ZFP36</italic> gene, also known as tristetraprolin (<italic>TTP</italic>), is a crucial RNA-binding protein that plays a vital role in various biological processes. <italic>ZFP36</italic> modulates mRNA stability through its interaction with AU-rich elements (AREs) within mRNA, consequently affecting gene expression and cellular function (<xref ref-type="bibr" rid="B32">Makita et al., 2021</xref>). Furthermore, empirical evidence suggests that <italic>ZFP36</italic> plays a substantial role in the regulation of alternative splicing (<xref ref-type="bibr" rid="B45">Tu et al., 2019</xref>; <xref ref-type="bibr" rid="B4">Chan et al., 2025</xref>). We speculate that <italic>hnRNP-F</italic> and <italic>ZFP36</italic> form a complex that regulates gene expression and alternative splicing.</p>
<fig id="F9" position="float">
<label>FIGURE 9</label>
<caption>
<p>hnRNP-F associates with <italic>ZFP36</italic> to form a complex that modulates gene expression and splicing. <bold>(A)</bold> Co-IP assays in HK-2 cells transfected with empty vector (NC) or hnRNP-F overexpression plasmid (OE-hnRNP-F). Whole-cell lysates (Input) and immunoprecipitated complexes (IP: &#x3b1;-hnRNP-F) were probed for hnRNP-F (46-/50-kDa isoforms), ZFP36 (34 kDa), and FOXP3 (45 kDa). IgG served as a negative control, and &#x3b2;-actin (42 kDa) was the loading control. <bold>(B)</bold> Quantitative analysis of protein enrichment in Co-IP complexes. Relative protein levels were normalized to IgG control (mean &#xb1; SD; <italic>n</italic> &#x3d; 3). &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01 vs. NC group; ns: not significant (<italic>P</italic> &#x3e; 0.05), two-tailed Student&#x2019;s t-test.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g009.tif">
<alt-text content-type="machine-generated">Panel A shows a Western blot analysis of proteins hnRNP-F, ZFP36, hnRNP-H, FOXP3, and &#x3B2;-actin with different conditions: empty vector and OE-hnRNP-F, with input, IgG, and hnRNP-F immunoprecipitation. Molecular weights are indicated. Panel B is a bar graph comparing relative protein levels for hnRNP-F, ZFP36, hnRNP-H, and FOXP3 between NC-hnRNP-F and OE-hnRNP-F conditions, highlighting significant differences and non-significant results.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>4 Discussion</title>
<p>The pathophysiology of DKD involves multiple pathways, such as hemodynamic, metabolic, and inflammatory pathways. Targeting inflammatory and fibrotic pathways may have important therapeutic implications in DKD research (<xref ref-type="bibr" rid="B33">Matoba et al., 2019</xref>). Therefore, it is necessary to further investigate its molecular regulatory mechanism in cells associated with DKD to provide new ideas for finding new therapeutic targets for DKD.</p>
<p>As an RNA-binding protein, <italic>hnRNP-F</italic> is capable of binding to mRNA and participating in the post-transcriptional regulation of target genes, and it is known to modulate the expression of target genes. Abnormal expression of <italic>hnRNP-F</italic> has been reported to have a significant effect on the progression of diabetic nephropathy, and high expression of <italic>hnRNP-F</italic> may have a better protective effect. In patients with type 2 diabetes, the protein levels of <italic>hnRNP-F</italic> have significantly decreased in renal cortex tissues, but the role of <italic>hnRNP-F</italic> in renal tubular epithelial cell mechanisms remains unclear (<xref ref-type="bibr" rid="B24">Liao et al., 2024</xref>). RNA-seq analysis in this study demonstrated that <italic>hnRNP-F</italic> broadly modulates high-glucose-induced differential gene expression and alternative splicing in HK-2 cells. Downregulation of <italic>hnRNP-F</italic> expression under HG conditions or in DKD was subsequently confirmed across HK-2 cells, MPC5 cells, and <italic>db/db</italic> mouse models. Furthermore, lentivirus-mediated <italic>hnRNP-F</italic> overexpression in MPC5 cells significantly suppressed the TNF-&#x3b1;/NF-&#x3ba;B signaling pathway. The expression and synthesis of <italic>TNF-&#x3b1;</italic>, a potent inflammatory factor, are not only limited to hematopoietic cells, but also can be produced by renal intrinsic cells, such as mesangial cells, endothelial cells, tubular epithelial cells, etc. (<xref ref-type="bibr" rid="B20">Jevnikar et al., 1991</xref>; <xref ref-type="bibr" rid="B39">Sugimoto et al., 1999</xref>). <italic>TNF-&#x3b1;</italic> plays an activating role in renal intrinsic cells, including a second messenger system, transcription factors, and cytokines, and participates in the synthesis of inflammatory mediators and tissue-compatible complexes (<xref ref-type="bibr" rid="B35">Vielhauer et al., 2005</xref>). It has been demonstrated that insulin-resistant diabetic patients have increased serum levels of <italic>TNF-&#x3b1;</italic> (<xref ref-type="bibr" rid="B19">Iwata et al., 2001</xref>), and the levels of <italic>TNF-&#x3b1;</italic> in the blood or glomerular cells are considered to correlate with the damage to the tethered cells in patients with DKD. Being a pleiotropic transcription factor, <italic>NF-&#x3ba;B</italic> is a regulatory hub for thylakoid cells to express a variety of immune-inflammation-related genes, and is intimately implicated in thylakoid cell proliferation and secretion of inflammatory factors (<xref ref-type="bibr" rid="B12">Evans et al., 2002</xref>). Numerous studies have shown that <italic>NF-&#x3ba;B</italic> may accelerate the progression of DKD by regulating inflammation; for example, it has been shown that <italic>NF-&#x3ba;B</italic> mediates high-glucose-induced inflammatory response and ECM accumulation in glomerular mesangial cells (<xref ref-type="bibr" rid="B5">Chen et al., 2016</xref>; <xref ref-type="bibr" rid="B27">Liu et al., 2019</xref>).</p>
<p>We considered that the significant downregulation of <italic>CXCL8, IL6, GDF15</italic>, <italic>PTX3</italic>, and <italic>TFPI2</italic> warranted additional focus. Existing studies have reported that inhibition of <italic>CXCL8</italic> attenuates high-glucose-induced renal tubular cell-mediated inflammation and apoptosis in diabetic kidney disease (<xref ref-type="bibr" rid="B2">Bai et al., 2022</xref>). Significantly, activation of <italic>CXCL8</italic> has been demonstrated to heighten TNF-&#x3b1;-induced inflammatory responses (<xref ref-type="bibr" rid="B18">Huang et al., 2018</xref>). <italic>IL-6</italic> signaling is known to be involved in the core inflammatory response in the progression of DKD (<xref ref-type="bibr" rid="B13">Feigerlov&#xe1; and Battaglia-Hsu, 2017</xref>). As is known, <italic>TNF-&#x3b1;</italic> inhibits the transcription factors resulting in the production of <italic>IL-6</italic> (<xref ref-type="bibr" rid="B42">Tanaka et al., 2014</xref>). Growth differentiation factor-15 (<italic>GDF-15</italic>) increases the likelihood of DKD by affecting reno-protective factors with anti-inflammatory activity (<xref ref-type="bibr" rid="B9">Delrue et al., 2023</xref>). GDF-15 inhibits inflammation by reducing the infiltration of inflammatory cells, diminishing the secretion of cytokines and chemokines, and attenuating macrophage and T cell activity to suppress the release of <italic>TNF-&#x3b1;</italic>, <italic>IL-6</italic>, and <italic>IL-1&#x3b2;</italic> (<xref ref-type="bibr" rid="B43">Tang et al., 2024</xref>). In addition, it has been shown that <italic>TNF-&#x3b1;</italic> could increase the transcriptional activity of <italic>GDF-15</italic> by potentiating multiple signal transduction pathways, especially the classical <italic>NF-&#x3ba;B</italic> and <italic>MAPK</italic> pathways (<xref ref-type="bibr" rid="B1">Adela et al., 2015</xref>).</p>
<p>Two other genes, <italic>PTX3</italic> and <italic>TFPI2</italic>, were also involved in the DKD pathological process. <italic>PTX3</italic> induces mitochondrial dysfunction and renal tubular cell senescence via &#x3b2;-linker activation, leading to renal fibrosis (<xref ref-type="bibr" rid="B30">Luo et al., 2023</xref>). It was reported that <italic>TFPI2</italic> can regulate the endothelial&#x2013;mesenchymal transition and the <italic>TGF-&#x3b2;2</italic> signaling pathway and is a potential promoter of DKD pathogenesis (<xref ref-type="bibr" rid="B15">Guan et al., 2022</xref>). We also downloaded the CLIP-seq data of <italic>hnRNP-F</italic> and found that <italic>hnRNP-F</italic> and lncRNA <italic>SNHG1</italic> had the potential to combine. Meanwhile, the expression of lncRNA <italic>SNHG1</italic> was downregulated after <italic>hnRNP-F</italic> overexpression. <italic>SNHG1</italic> is an annotated lncRNA, which is mainly localized in the nucleus. It is well established that <italic>SNHG1</italic> interacts with the promoter regions of its downstream genes to enhance their expression (<xref ref-type="bibr" rid="B23">Li et al., 2020</xref>; <xref ref-type="bibr" rid="B40">Sun et al., 2017</xref>). The present study demonstrates that overexpression of <italic>hnRNP-F</italic> results in decreased levels of <italic>SNHG1</italic> expression. Additionally, the expression of certain TNF&#x3b1;-related genes is suppressed following <italic>hnRNP-F</italic> overexpression. These findings suggest a potential interaction between <italic>hnRNP-F</italic> and <italic>SNHG1</italic> in regulating the transcription of these target genes.</p>
<p>Our present experiments revealed that <italic>hnRNP-F</italic> combined with lncRNA <italic>SNHG1</italic> in high-glucose-induced renal tubular epithelial cells significantly reduced the expression of genes associated with the <italic>TNF&#x3b1;/NF&#x3ba;B</italic> signaling pathway or with DKD pathogenesis (<xref ref-type="fig" rid="F3">Figure 3</xref>). The mechanism of this transcriptional repression requires further investigation. Undoubtedly, previous studies indicate that <italic>hnRNP-F</italic> interacts with multiple proteins, including <italic>hnRNP-H</italic>, <italic>FOXP3</italic>, and tristetraprolin (<italic>TTP</italic>, also known as <italic>ZFP36</italic>) (<xref ref-type="bibr" rid="B36">Reznik et al., 2014</xref>). Co-IP assays performed in HK2 cells confirmed a physical interaction between <italic>hnRNP-F</italic> and <italic>ZFP36</italic> (&#x2a;<italic>P</italic> &#x3c; 0.05 vs. IgG control). However, no interaction was detected between <italic>hnRNP-F</italic> and <italic>FOXP3.</italic> While <italic>hnRNP-H</italic> co-precipitated with <italic>hnRNP-F</italic>, its comigration with the antibody heavy chain (&#x223c;50 kDa) precluded definitive assessment of this interaction. Notably, overexpression of <italic>hnRNP-F</italic> did not significantly alter the protein levels of <italic>ZFP36, FOXP3,</italic> or <italic>hnRNP-H</italic>, as determined by densitometric analysis (<xref ref-type="fig" rid="F10">Figure 10</xref>). A prior study suggested that <italic>hnRNP-F</italic> acts as a co-factor with <italic>TTP</italic> to increase ARE-mRNA decay. The current study hypothesizes that <italic>hnRNP-F</italic> and <italic>TTP</italic> form a complex mediated by <italic>SNHG1</italic> to regulate gene expression. Nevertheless, further experimental evidence is necessary to substantiate this conclusion.</p>
<fig id="F10" position="float">
<label>FIGURE 10</label>
<caption>
<p>Schematic diagram of hnRNP-F-mediated regulation of gene expression and alternative splicing in high-glucose.</p>
</caption>
<graphic xlink:href="fphys-16-1475441-g010.tif">
<alt-text content-type="machine-generated">Diagram of a cell showing transcription and alternative splicing processes. In the nucleoplasm, ZFP36 and hnRNP-F interact with RBM41 pre-mRNA to produce two isoforms. Transcription involves interactions with lncRNA SNHG1, producing RNA for genes IL6, CXCL8, GDF15, PTX3, and TFPI2. Alternative splicing produces OSMR, TRIP6, and UGT2BT. Arrows indicate the processes.</alt-text>
</graphic>
</fig>
<p>
<italic>hnRNP-F</italic>, as a coregulator of alternative splicing, always interacts with other RNA-binding proteins, including <italic>RBM41</italic>. We found that <italic>hnRNP-F</italic> overexpression notably promotes several alternative RNA-binding protein splicings. We observed that <italic>hnRNP-F</italic>-dependent alternative splicing of <italic>RBM41</italic> generates a short isoform in <italic>hnRNP-F</italic> overexpression cells. RBM41 is the paralog of U11/U12-65K, a known unique component of the U11/U12 di-snRNP. Both proteins utilize their highly similar C-terminal RRM domains to bind the 3&#x2032;-terminal stem-loops in U12 and U6atac snRNAs with comparable affinity. Recent studies identify RBM41 as a novel, unique protein component of the minor spliceosome, functioning in post-splicing steps and the disassembly process of the minor spliceosome (<xref ref-type="bibr" rid="B34">Norppa et al., 2024</xref>; <xref ref-type="bibr" rid="B41">Taira et al., 2025</xref>). It is speculated that <italic>hnRNP-F</italic> may affect the alternative splicing of RBM41, thereby influencing the overall post-transcriptional regulatory pattern within the cell.</p>
<p>We also found that <italic>hnRNP-F</italic> overexpression significantly alters variable exons of <italic>OSMR</italic> and <italic>UGT2B7</italic>. <italic>OSMR</italic> is a receptor for <italic>OSM,</italic> and <italic>OSM</italic> signaling plays a role in fibrosis, including inflammation, vascular dysfunction, and fibroblast activation (<xref ref-type="bibr" rid="B38">Stawski and Trojanowska, 2019</xref>). Miroslav Dostalek et al. discovered that diabetes reduces <italic>UGT2B7</italic> enzymatic activity in the kidney (<xref ref-type="bibr" rid="B10">Dostalek et al., 2011</xref>).</p>
<p>
<italic>hnRNP-F</italic> also affects the inclusion or deletion of exons in some genes, resulting in transcripts of different lengths, like gene <italic>TRIP6</italic> and <italic>IRF3. TRIP6</italic> mediates inflammatory response and fibrosis in diabetic nephropathy (<xref ref-type="bibr" rid="B26">Lin et al., 2021</xref>). As a key molecule in the interferon gene/interferon regulatory factor 3 (<italic>STING/IRF3</italic>) signaling pathway, <italic>IRF3</italic> is involved in mediating the inflammatory response at different stages of DKD progression (<xref ref-type="bibr" rid="B11">El-Deeb et al., 2023</xref>). Analysis of CLIP-seq data from <italic>hnRNP-F</italic> showed that <italic>hnRNP-F</italic> specifically binds to some <italic>hnRNP</italic> family proteins and splicing factors. Based on the above results, we speculated that <italic>hnRNP-F</italic> may mediate variable splicing in high-glucose-induced HK2 cells through interaction with <italic>hnRNP</italic> family proteins (<xref ref-type="fig" rid="F5">Figure 5</xref>).</p>
<p>In summary, <italic>hnRNP-F</italic> could have dual functions in mRNA transcriptional and post-transcriptional levels. We find that <italic>hnRNP-F</italic> may bind with lncRNA <italic>SNHG1</italic> to negatively regulate the transcription of genes involved in the <italic>TNF&#x3b1;/NF&#x3ba;B</italic> signaling pathway. Interestingly, <italic>hnRNP-F</italic> also regulates the alternative splicing of <italic>hnRNP</italic> proteins and splicing factors. This finding suggests that <italic>hnRNP-F</italic> may play a role in DKD by regulating the differential expression and variable splicing of genes associated with diabetic nephropathy, especially genes associated with inflammatory response; however, its exact mechanism requires further experimental verification.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The data presented in the study are deposited in the GEO repository, accession numbers GSE273001 and GSE299230.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used. The animal study was approved by the Animal Ethics Committee of Hubei University of Chinese Medicine (Approval No. HUCMS00303837). The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>LW: Formal analysis, Funding acquisition, Project administration, Supervision, Writing &#x2013; original draft, and Writing &#x2013; review and editing. HL: Data curation, Formal analysis, Methodology, Software, Validation, Visualization, Writing &#x2013; original draft. XG: Data curation, Software, Visualization, Investigation, Writing &#x2013; original draft. XW: Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing &#x2013; review and editing.</p>
</sec>
<sec sec-type="funding-information" id="s8">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This study was supported by the Joint Fund Project of Hubei Provincial Natural Science Foundation (2022CFD021), the Research Project of Hubei Provincial Administration of Traditional Chinese Medicine (ZY 2023F003), and the National Natural Science Foundation of China (82374384).</p>
</sec>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s12">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec sec-type="disclaimer" id="s10">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec sec-type="supplementary-material" id="s11">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fphys.2025.1475441/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fphys.2025.1475441/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table1.xls" id="SM1" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table3.xlsx" id="SM2" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image6.tif" id="SM3" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image3.tif" id="SM4" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image4.tif" id="SM5" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image2.tif" id="SM6" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.tif" id="SM7" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image7.tif" id="SM8" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table6.xls" id="SM9" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table2.docx" id="SM10" mimetype="application/docx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table4.xlsx" id="SM11" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table7.xls" id="SM12" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table8.xls" id="SM13" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image5.tif" id="SM14" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table5.xlsx" id="SM15" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table9.xls" id="SM16" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Adela</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Banerjee</surname>
<given-names>S. K.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>GDF-15 as a target and biomarker for diabetes and cardiovascular diseases: a translational prospective</article-title>. <source>J. Diabetes Res.</source> <volume>2015</volume>, <fpage>490842</fpage>. <pub-id pub-id-type="doi">10.1155/2015/490842</pub-id>
<pub-id pub-id-type="pmid">26273671</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Up-regulation of miR-20a weakens inflammation and apoptosis in high-glucose-induced renal tubular cell mediating diabetic kidney disease by repressing CXCL8 expression</article-title>. <source>Arch. Physiol. Biochem.</source> <volume>128</volume> (<issue>6</issue>), <fpage>1603</fpage>&#x2013;<lpage>1610</lpage>. <pub-id pub-id-type="doi">10.1080/13813455.2020.1785506</pub-id>
<pub-id pub-id-type="pmid">32608284</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barrera-Chimal</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jaisser</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Pathophysiologic mechanisms in diabetic kidney disease: a focus on current and future therapeutic targets</article-title>. <source>Diabetes Obes. Metab.</source> <volume>22</volume> (<issue>Suppl. 1</issue>), <fpage>16</fpage>&#x2013;<lpage>31</lpage>. <pub-id pub-id-type="doi">10.1111/dom.13969</pub-id>
<pub-id pub-id-type="pmid">32267077</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>K. L.</given-names>
</name>
<name>
<surname>Hung</surname>
<given-names>C. S.</given-names>
</name>
<name>
<surname>Chiang</surname>
<given-names>H. P.</given-names>
</name>
<name>
<surname>Chung</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>Y. C.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>ZFP36L1 and ZFP36L2 reduce cyclin D1 expression by decreasing expression of E2F1 and long 3&#x27;UTR isoform of CCND1 transcripts</article-title>. <source>Mol. Cell Biochem.</source> <volume>480</volume> (<issue>3</issue>), <fpage>1685</fpage>&#x2013;<lpage>1699</lpage>. <pub-id pub-id-type="doi">10.1007/s11010-024-05087-w</pub-id>
<pub-id pub-id-type="pmid">39110278</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>X. F.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhong</surname>
<given-names>Q. X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>H. H.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Terpene glycoside component from Moutan Cortex ameliorates diabetic nephropathy by regulating endoplasmic reticulum stress-related inflammatory responses</article-title>. <source>J. Ethnopharmacol.</source> <volume>193</volume>, <fpage>433</fpage>&#x2013;<lpage>444</lpage>. <pub-id pub-id-type="doi">10.1016/j.jep.2016.09.043</pub-id>
<pub-id pub-id-type="pmid">27664441</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ni</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J. C.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Diabetic kidney disease: challenges, advances, and opportunities</article-title>. <source>Kidney Dis. (Basel)</source> <volume>6</volume> (<issue>4</issue>), <fpage>215</fpage>&#x2013;<lpage>225</lpage>. <pub-id pub-id-type="doi">10.1159/000506634</pub-id>
<pub-id pub-id-type="pmid">32903946</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Bao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yi</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Quan</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Xue</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>SUVA: splicing site usage variation analysis from RNA-seq data reveals highly conserved complex splicing biomarkers in liver cancer</article-title>. <source>RNA Biol.</source> <volume>18</volume> (<issue>Suppl. 1</issue>), <fpage>157</fpage>&#x2013;<lpage>171</lpage>. <pub-id pub-id-type="doi">10.1080/15476286.2021.1940037</pub-id>
<pub-id pub-id-type="pmid">34152934</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Darshi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kugathasan</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Maity</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sridhar</surname>
<given-names>V. S.</given-names>
</name>
<name>
<surname>Fernandez</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Limonte</surname>
<given-names>C. P.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Glycolytic lactate in diabetic kidney disease</article-title>. <source>JCI Insight</source> <volume>9</volume> (<issue>11</issue>), <fpage>e168825</fpage>. <pub-id pub-id-type="doi">10.1172/jci.insight.168825</pub-id>
<pub-id pub-id-type="pmid">38855868</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Delrue</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Speeckaert</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Delanghe</surname>
<given-names>J. R.</given-names>
</name>
<name>
<surname>Speeckaert</surname>
<given-names>M. M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Growth differentiation factor 15 (GDF-15) in kidney diseases</article-title>. <source>Adv. Clin. Chem.</source> <volume>114</volume>, <fpage>1</fpage>&#x2013;<lpage>46</lpage>. <pub-id pub-id-type="doi">10.1016/bs.acc.2023.02.003</pub-id>
<pub-id pub-id-type="pmid">37268330</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dostalek</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Court</surname>
<given-names>M. H.</given-names>
</name>
<name>
<surname>Hazarika</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Akhlaghi</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Diabetes mellitus reduces activity of human UDP-glucuronosyltransferase 2B7 in liver and kidney leading to decreased formation of mycophenolic acid acyl-glucuronide metabolite</article-title>. <source>Drug Metab. Dispos.</source> <volume>39</volume> (<issue>3</issue>), <fpage>448</fpage>&#x2013;<lpage>455</lpage>. <pub-id pub-id-type="doi">10.1124/dmd.110.036608</pub-id>
<pub-id pub-id-type="pmid">21123165</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>El-Deeb</surname>
<given-names>O. S.</given-names>
</name>
<name>
<surname>Hafez</surname>
<given-names>Y. M.</given-names>
</name>
<name>
<surname>Eltokhy</surname>
<given-names>A. K.</given-names>
</name>
<name>
<surname>Awad</surname>
<given-names>M. M.</given-names>
</name>
<name>
<surname>El-Shaer</surname>
<given-names>R. A. A.</given-names>
</name>
<name>
<surname>Abdel Ghafar</surname>
<given-names>M. T.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Stimulator of interferon genes/interferon regulatory factor 3 (STING-IRF3) and inflammasome-activation mediated pyroptosis biomarkers: a network of integrated pathways in diabetic nephropathy</article-title>. <source>J. Diabetes Metab. Disord.</source> <volume>22</volume> (<issue>2</issue>), <fpage>1471</fpage>&#x2013;<lpage>1480</lpage>. <pub-id pub-id-type="doi">10.1007/s40200-023-01270-w</pub-id>
<pub-id pub-id-type="pmid">37975106</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Evans</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Goldfine</surname>
<given-names>I. D.</given-names>
</name>
<name>
<surname>Maddux</surname>
<given-names>B. A.</given-names>
</name>
<name>
<surname>Grodsky</surname>
<given-names>G. M.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Oxidative stress and stress-activated signaling pathways: a unifying hypothesis of type 2 diabetes</article-title>. <source>Endocr. Rev.</source> <volume>23</volume> (<issue>5</issue>), <fpage>599</fpage>&#x2013;<lpage>622</lpage>. <pub-id pub-id-type="doi">10.1210/er.2001-0039</pub-id>
<pub-id pub-id-type="pmid">12372842</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feigerlov&#xe1;</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Battaglia-Hsu</surname>
<given-names>S. F.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>IL-6 signaling in diabetic nephropathy: from pathophysiology to therapeutic perspectives</article-title>. <source>Cytokine Growth Factor Rev.</source> <volume>37</volume>, <fpage>57</fpage>&#x2013;<lpage>65</lpage>. <pub-id pub-id-type="doi">10.1016/j.cytogfr.2017.03.003</pub-id>
<pub-id pub-id-type="pmid">28363692</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghosh</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lo</surname>
<given-names>C. S.</given-names>
</name>
<name>
<surname>Maachi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chenier</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Lateef</surname>
<given-names>M. A.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Heterogeneous nuclear ribonucleoprotein F mediates insulin inhibition of Bcl2-Modifying factor expression and tubulopathy in diabetic kidney</article-title>. <source>Sci. Rep.</source> <volume>9</volume> (<issue>1</issue>), <fpage>6687</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-019-43218-2</pub-id>
<pub-id pub-id-type="pmid">31040360</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guan</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>TFPI2 suppresses the interaction of TGF-&#x3b2;2 pathway regulators to promote endothelial-mesenchymal transition in diabetic nephropathy</article-title>. <source>J. Biol. Chem.</source> <volume>298</volume> (<issue>3</issue>), <fpage>101725</fpage>. <pub-id pub-id-type="doi">10.1016/j.jbc.2022.101725</pub-id>
<pub-id pub-id-type="pmid">35157852</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Heinz</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Benner</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Spann</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Bertolino</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Laslo</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities</article-title>. <source>Mol. Cell</source> <volume>38</volume> (<issue>4</issue>), <fpage>576</fpage>&#x2013;<lpage>589</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2010.05.004</pub-id>
<pub-id pub-id-type="pmid">20513432</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Harvey</surname>
<given-names>S. E.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>RNA G-quadruplex secondary structure promotes alternative splicing via the RNA-binding protein hnRNPF</article-title>. <source>Genes Dev.</source> <volume>31</volume> (<issue>22</issue>), <fpage>2296</fpage>&#x2013;<lpage>2309</lpage>. <pub-id pub-id-type="doi">10.1101/gad.305862.117</pub-id>
<pub-id pub-id-type="pmid">29269483</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>The enhancer RNA lnc-SLC4A1-1 epigenetically regulates unexplained recurrent pregnancy loss (URPL) by activating CXCL8 and NF-kB pathway</article-title>. <source>EBioMedicine</source> <volume>38</volume>, <fpage>162</fpage>&#x2013;<lpage>170</lpage>. <pub-id pub-id-type="doi">10.1016/j.ebiom.2018.11.015</pub-id>
<pub-id pub-id-type="pmid">30448228</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Iwata</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Haruta</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Usui</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Takata</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Takano</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Uno</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2001</year>). <article-title>Pioglitazone ameliorates tumor necrosis factor-alpha-induced insulin resistance by a mechanism independent of adipogenic activity of peroxisome proliferator--activated receptor-gamma</article-title>. <source>Diabetes</source> <volume>50</volume> (<issue>5</issue>), <fpage>1083</fpage>&#x2013;<lpage>1092</lpage>. <pub-id pub-id-type="doi">10.2337/diabetes.50.5.1083</pub-id>
<pub-id pub-id-type="pmid">11334412</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jevnikar</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Brennan</surname>
<given-names>D. C.</given-names>
</name>
<name>
<surname>Singer</surname>
<given-names>G. G.</given-names>
</name>
<name>
<surname>Heng</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Maslinski</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Wuthrich</surname>
<given-names>R. P.</given-names>
</name>
<etal/>
</person-group> (<year>1991</year>). <article-title>Stimulated kidney tubular epithelial cells express membrane associated and secreted TNF alpha</article-title>. <source>Kidney Int.</source> <volume>40</volume> (<issue>2</issue>), <fpage>203</fpage>&#x2013;<lpage>211</lpage>. <pub-id pub-id-type="doi">10.1038/ki.1991.201</pub-id>
<pub-id pub-id-type="pmid">1942768</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Langmead</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Salzberg</surname>
<given-names>S. L.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>HISAT: a fast spliced aligner with low memory requirements</article-title>. <source>Nat. methods</source> <volume>12</volume> (<issue>4</issue>), <fpage>357</fpage>&#x2013;<lpage>360</lpage>. <pub-id pub-id-type="doi">10.1038/nmeth.3317</pub-id>
<pub-id pub-id-type="pmid">25751142</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ladd</surname>
<given-names>A. N.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>New insights into the role of RNA-Binding proteins in the regulation of heart development</article-title>. <source>Int. Rev. Cell Mol. Biol.</source> <volume>324</volume>, <fpage>125</fpage>&#x2013;<lpage>185</lpage>. <pub-id pub-id-type="doi">10.1016/bs.ircmb.2015.12.009</pub-id>
<pub-id pub-id-type="pmid">27017008</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>You</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Epigenetic silencing of CDKN1A and CDKN2B by SNHG1 promotes the cell cycle, migration and epithelial-mesenchymal transition progression of hepatocellular carcinoma</article-title>. <source>Cell Death Dis.</source> <volume>11</volume> (<issue>10</issue>), <fpage>823</fpage>. <pub-id pub-id-type="doi">10.1038/s41419-020-03031-6</pub-id>
<pub-id pub-id-type="pmid">33009370</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liao</surname>
<given-names>M. C.</given-names>
</name>
<name>
<surname>Lo</surname>
<given-names>C. S.</given-names>
</name>
<name>
<surname>Pang</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>W. X.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>X. P.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Heterogeneous nuclear ribonucleoprotein F deficiency in mouse podocyte promotes podocytopathy mediated by methyltransferase-like 14 nuclear translocation resulting in Sirtuin 1 gene inhibition</article-title>. <source>Transl. Res.</source> <volume>267</volume>, <fpage>1</fpage>&#x2013;<lpage>9</lpage>. <pub-id pub-id-type="doi">10.1016/j.trsl.2024.01.002</pub-id>
<pub-id pub-id-type="pmid">38195017</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>K. D.</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>T. S.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Update of pathophysiology and management of diabetic kidney disease</article-title>. <source>J. Formos. Med. Assoc.</source> <volume>117</volume> (<issue>8</issue>), <fpage>662</fpage>&#x2013;<lpage>675</lpage>. <pub-id pub-id-type="doi">10.1016/j.jfma.2018.02.007</pub-id>
<pub-id pub-id-type="pmid">29486908</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>PTPN14 deficiency alleviates podocyte injury through suppressing inflammation and fibrosis by targeting TRIP6 in diabetic nephropathy</article-title>. <source>Biochem. Biophys. Res. Commun.</source> <volume>550</volume>, <fpage>62</fpage>&#x2013;<lpage>69</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2020.12.030</pub-id>
<pub-id pub-id-type="pmid">33684622</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jia</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Nobiletin suppresses high-glucose-induced inflammation and ECM accumulation in human mesangial cells through STAT3/NF-&#x3ba;B pathway</article-title>. <source>J. Cell Biochem.</source> <volume>120</volume> (<issue>3</issue>), <fpage>3467</fpage>&#x2013;<lpage>3473</lpage>. <pub-id pub-id-type="doi">10.1002/jcb.27621</pub-id>
<pub-id pub-id-type="pmid">30499124</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lo</surname>
<given-names>C. S.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Abdo</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chenier</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Filep</surname>
<given-names>J. G.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Overexpression of heterogeneous nuclear ribonucleoprotein F stimulates renal Ace-2 gene expression and prevents TGF-&#x3b2;1-induced kidney injury in a mouse model of diabetes</article-title>. <source>Diabetologia</source> <volume>58</volume> (<issue>10</issue>), <fpage>2443</fpage>&#x2013;<lpage>2454</lpage>. <pub-id pub-id-type="doi">10.1007/s00125-015-3700-y</pub-id>
<pub-id pub-id-type="pmid">26232095</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Love</surname>
<given-names>M. I.</given-names>
</name>
<name>
<surname>Huber</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Anders</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2</article-title>. <source>Genome Biol.</source> <volume>15</volume> (<issue>12</issue>), <fpage>550</fpage>&#x2013;<lpage>21</lpage>. <pub-id pub-id-type="doi">10.1186/s13059-014-0550-8</pub-id>
<pub-id pub-id-type="pmid">25516281</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Pentraxin 3 plays a key role in tubular cell senescence and renal fibrosis through inducing &#x3b2;-catenin signaling</article-title>. <source>Biochim. Biophys. Acta Mol. Basis Dis.</source> <volume>1869</volume> (<issue>7</issue>), <fpage>166807</fpage>. <pub-id pub-id-type="doi">10.1016/j.bbadis.2023.166807</pub-id>
<pub-id pub-id-type="pmid">37453582</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lytvyn</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Bjornstad</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>van Raalte</surname>
<given-names>D. H.</given-names>
</name>
<name>
<surname>Heerspink</surname>
<given-names>H. L.</given-names>
</name>
<name>
<surname>Cherney</surname>
<given-names>D. Z. I.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The new biology of diabetic kidney disease-mechanisms and therapeutic implications</article-title>. <source>Endocr. Rev.</source> <volume>41</volume> (<issue>2</issue>), <fpage>202</fpage>&#x2013;<lpage>231</lpage>. <pub-id pub-id-type="doi">10.1210/endrev/bnz010</pub-id>
<pub-id pub-id-type="pmid">31633153</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Makita</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Takatori</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nakajima</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Post-transcriptional regulation of immune responses and inflammatory diseases by RNA-binding ZFP36 family proteins</article-title>. <source>Front. Immunol.</source> <volume>12</volume>, <fpage>711633</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2021.711633</pub-id>
<pub-id pub-id-type="pmid">34276705</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matoba</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Takeda</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Nagai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Kawanami</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Utsunomiya</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Nishimura</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Unraveling the role of inflammation in the pathogenesis of diabetic kidney disease</article-title>. <source>Int. J. Mol. Sci.</source> <volume>20</volume> (<issue>14</issue>), <fpage>3393</fpage>. <pub-id pub-id-type="doi">10.3390/ijms20143393</pub-id>
<pub-id pub-id-type="pmid">31295940</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Norppa</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Chowdhury</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>van Rooijen</surname>
<given-names>L. E.</given-names>
</name>
<name>
<surname>Ravantti</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Snel</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Varjosalo</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Distinct functions for the paralogous RBM41 and U11/U12-65K proteins in the minor spliceosome</article-title>. <source>Nucleic Acids Res.</source> <volume>52</volume> (<issue>7</issue>), <fpage>4037</fpage>&#x2013;<lpage>4052</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkae070</pub-id>
<pub-id pub-id-type="pmid">38499487</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reznik</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Clement</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>Lykke-Andersen</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>hnRNP F complexes with tristetraprolin and stimulates ARE-mRNA decay</article-title>. <source>PLoS One</source> <volume>9</volume> (<issue>6</issue>), <fpage>e100992</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0100992</pub-id>
<pub-id pub-id-type="pmid">24978456</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Smith</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Sandow</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Webb</surname>
<given-names>A. I.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>The search for RNA-binding proteins: a technical and interdisciplinary challenge</article-title>. <source>Biochem. Soc. Trans.</source> <volume>49</volume> (<issue>1</issue>), <fpage>393</fpage>&#x2013;<lpage>403</lpage>. <pub-id pub-id-type="doi">10.1042/BST20200688</pub-id>
<pub-id pub-id-type="pmid">33492363</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stawski</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Trojanowska</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Oncostatin M and its role in fibrosis</article-title>. <source>Connect. Tissue Res.</source> <volume>60</volume> (<issue>1</issue>), <fpage>40</fpage>&#x2013;<lpage>49</lpage>. <pub-id pub-id-type="doi">10.1080/03008207.2018.1500558</pub-id>
<pub-id pub-id-type="pmid">30056769</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sugimoto</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Shikata</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Wada</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Horiuchi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Makino</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Advanced glycation end products-cytokine-nitric oxide sequence pathway in the development of diabetic nephropathy: aminoguanidine ameliorates the overexpression of tumour necrosis factor-alpha and inducible nitric oxide synthase in diabetic rat glomeruli</article-title>. <source>Diabetologia</source> <volume>42</volume> (<issue>7</issue>), <fpage>878</fpage>&#x2013;<lpage>886</lpage>. <pub-id pub-id-type="doi">10.1007/s001250051241</pub-id>
<pub-id pub-id-type="pmid">10440132</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Skogerb&#xf8;</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>The long noncoding RNA SNHG1 promotes tumor growth through regulating transcription of both local and distal genes</article-title>. <source>Oncogene</source> <volume>36</volume> (<issue>49</issue>), <fpage>6774</fpage>&#x2013;<lpage>6783</lpage>. <pub-id pub-id-type="doi">10.1038/onc.2017.286</pub-id>
<pub-id pub-id-type="pmid">28825722</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taira</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Fukunaga</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>RNA-binding protein Miso/CG44249 is crucial for minor splicing during oogenesis in Drosophila</article-title>. <source>RNA</source> <volume>31</volume> (<issue>6</issue>), <fpage>822</fpage>&#x2013;<lpage>835</lpage>. <pub-id pub-id-type="doi">10.1261/rna.080311.124</pub-id>
<pub-id pub-id-type="pmid">40169226</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tanaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Narazaki</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kishimoto</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>IL-6 in inflammation, immunity, and disease</article-title>. <source>Cold Spring Harb. Perspect. Biol.</source> <volume>6</volume> (<issue>10</issue>), <fpage>a016295</fpage>. <pub-id pub-id-type="doi">10.1101/cshperspect.a016295</pub-id>
<pub-id pub-id-type="pmid">25190079</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Role and mechanism of growth differentiation factor 15 in chronic kidney disease</article-title>. <source>J. Inflamm. Res.</source> <volume>17</volume>, <fpage>2861</fpage>&#x2013;<lpage>2871</lpage>. <pub-id pub-id-type="doi">10.2147/JIR.S451398</pub-id>
<pub-id pub-id-type="pmid">38741613</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trapnell</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Williams</surname>
<given-names>B. A.</given-names>
</name>
<name>
<surname>Pertea</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Mortazavi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kwan</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Van Baren</surname>
<given-names>M. J.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation</article-title>. <source>Nat. Biotechnol.</source> <volume>28</volume> (<issue>5</issue>), <fpage>511</fpage>&#x2013;<lpage>515</lpage>. <pub-id pub-id-type="doi">10.1038/nbt.1621</pub-id>
<pub-id pub-id-type="pmid">20436464</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Dang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Tristetraprolin specifically regulates the expression and alternative splicing of immune response genes in HeLa cells</article-title>. <source>BMC Immunol.</source> <volume>20</volume> (<issue>1</issue>), <fpage>13</fpage>. <pub-id pub-id-type="doi">10.1186/s12865-019-0292-1</pub-id>
<pub-id pub-id-type="pmid">31046669</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tuttle</surname>
<given-names>K. R.</given-names>
</name>
<name>
<surname>Agarwal</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Alpers</surname>
<given-names>C. E.</given-names>
</name>
<name>
<surname>Bakris</surname>
<given-names>G. L.</given-names>
</name>
<name>
<surname>Brosius</surname>
<given-names>F. C.</given-names>
</name>
<name>
<surname>Kolkhof</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Molecular mechanisms and therapeutic targets for diabetic kidney disease</article-title>. <source>Kidney Int.</source> <volume>102</volume> (<issue>2</issue>), <fpage>248</fpage>&#x2013;<lpage>260</lpage>. <pub-id pub-id-type="doi">10.1016/j.kint.2022.05.012</pub-id>
<pub-id pub-id-type="pmid">35661785</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vielhauer</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Stavrakis</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Mayadas</surname>
<given-names>T. N.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Renal cell-expressed TNF receptor 2, not receptor 1, is essential for the development of glomerulonephritis</article-title>. <source>J. Clin. Invest.</source> <volume>115</volume> (<issue>5</issue>), <fpage>1199</fpage>&#x2013;<lpage>1209</lpage>. <pub-id pub-id-type="doi">10.1172/JCI23348</pub-id>
<pub-id pub-id-type="pmid">15841213</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Renal protective effects of Shenyuan Granules on db/db diabetic nephropathy mice based on TGF-&#x3b2;1/Egr1 signaling pathway regulated by Klotho</article-title>. <source>China J. Tradit. Chin. Med. Pharm.</source> <volume>36</volume> (<issue>08</issue>), <fpage>5033</fpage>&#x2013;<lpage>5036</lpage>.</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Patil</surname>
<given-names>D. P.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Gan</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jaffrey</surname>
<given-names>S. R.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Molecular basis for the specific and multivariant recognitions of RNA substrates by human hnRNP A2/B1</article-title>. <source>Nat. Commun.</source> <volume>9</volume> (<issue>1</issue>), <fpage>420</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-017-02770-z</pub-id>
<pub-id pub-id-type="pmid">29379020</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xia</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells</article-title>. <source>Biochim. Biophys. Acta Gene Regul. Mech.</source> <volume>1860</volume> (<issue>9</issue>), <fpage>911</fpage>&#x2013;<lpage>921</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbagrm.2017.07.004</pub-id>
<pub-id pub-id-type="pmid">28733224</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Mao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases</article-title>. <source>Nucleic acids Res.</source> <volume>39</volume> (<issue>Suppl. l_2</issue>), <fpage>W316</fpage>&#x2013;<lpage>W322</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkr483</pub-id>
<pub-id pub-id-type="pmid">21715386</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>A. X.</given-names>
</name>
<name>
<surname>Jeansson</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wigge</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Tonelius</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Tati</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Renal endothelial single-cell transcriptomics reveals spatiotemporal regulation and divergent roles of differential gene transcription and alternative splicing in Murine Diabetic Nephropathy</article-title>. <source>Int. J. Mol. Sci.</source> <volume>25</volume> (<issue>8</issue>), <fpage>4320</fpage>. <pub-id pub-id-type="doi">10.3390/ijms25084320</pub-id>
<pub-id pub-id-type="pmid">38673910</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>