<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Physiol.</journal-id>
<journal-title>Frontiers in Physiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Physiol.</abbrev-journal-title>
<issn pub-type="epub">1664-042X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1221205</article-id>
<article-id pub-id-type="doi">10.3389/fphys.2023.1221205</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Physiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Cloning and expression characterization of elongation of very long-chain fatty acids protein 6 (<italic>elovl6</italic>) with dietary fatty acids, ambient salinity and starvation stress in <italic>Scylla paramamosain</italic>
</article-title>
<alt-title alt-title-type="left-running-head">Lin et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphys.2023.1221205">10.3389/fphys.2023.1221205</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Lin</surname>
<given-names>Zhideng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/565620/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wu</surname>
<given-names>Zhouyu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Chaoyang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lin</surname>
<given-names>Huangbin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Mingyao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Mingfeng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Han</surname>
<given-names>Kunhuang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Huang</surname>
<given-names>Weiqing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ruan</surname>
<given-names>Shaojiang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>College of Life Science</institution>, <institution>Ningde Normal University</institution>, <addr-line>Ningde</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Engineering Research Center of Mindong Aquatic Product Deep-Processing</institution>, <institution>Ningde Normal University</institution>, <addr-line>Ningde</addr-line>
<italic>,</italic> <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2158837/overview">Yiming Li</ext-link>, Fishery Machinery and Instrument Research Institute, China</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/719811/overview">Xuexi Wang</ext-link>, Fujian Agriculture and Forestry University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1520321/overview">Jiamin Li</ext-link>, Ocean University of China, China</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Weiqing Huang, <email>393634584@qq.com</email>; Shaojiang Ruan, <email>1519402065@qq.com</email>; Kunhuang Han, <email>153827825@qq.com</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>12</day>
<month>07</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1221205</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>05</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>28</day>
<month>06</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Lin, Wu, Huang, Lin, Zhang, Chen, Han, Huang and Ruan.</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Lin, Wu, Huang, Lin, Zhang, Chen, Han, Huang and Ruan</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<bold>Introduction:</bold> Elongation of very long-chain fatty acids protein 6 (ELOVL6) played crucial roles in regulating energy expenditure and fatty acid metabolism. Many studies have performed to investigate the physiological roles and regulatory mechanisms of <italic>elovl6</italic> in fish and animals, while few studies were reported in crustaceans.</p>
<p>
<bold>Methods:</bold> Here we reported on the molecular cloning, tissue distribution and expression profiles in response to dietary fatty acids, ambient salinity and starvation stress in <italic>Scylla paramamosain</italic> by using rapid amplification of cDNA ends (RACE) and quantitative real-time PCR.</p>
<p>
<bold>Results:</bold> Three <italic>elovl6</italic> isoforms (named <italic>elovl6a, elovl6b</italic> and <italic>elovl6c</italic>) were isolated from <italic>S. paramamosain</italic> in the present study. The complete sequence of <italic>elovl6a</italic> was 1345 bp, the full-length sequence of <italic>elovl6b</italic> was 1419 bp, and the obtained <italic>elovl6c</italic> sequence was 1375 bp in full length. The <italic>elovl6a, elovl6b</italic> and <italic>elovl6c</italic> encoded 287, 329 and 301 amino acids respectively, and exhibited the typical structural features of ELOVL protein family members. Phylogenetic analysis showed that the ELOVL6a from <italic>S. paramamosain</italic> clustered most closely to ELOVL6 from <italic>Portunus trituberculatus</italic> and <italic>Eriocheir sinensis</italic>, while the ELOVL6b and ELOVL6c from <italic>S. paramamosain</italic> gathered alone into a single branch. Quantitative real-time PCR exhibited that the relatively abundant expression of <italic>elovl6b</italic> was observed in intestine and stomach, and the <italic>elovl6a</italic> and <italic>elovl6c</italic> were highly expressed in hepatopancreas. In addition, studies found that replacing fish oil with soybean oil could significantly increase the transcriptional levels of three <italic>elovl6</italic> in hepatopancreas of <italic>S. paramamosain</italic>, and the expression of <italic>elovl6a</italic> and <italic>elovl6c</italic> in hepatopancreas were more sensitive to dietary fatty acids than the <italic>elovl6b</italic>. Compared with the normal sea water group (27&#x2030;), the expression of sterol-regulatory element binding protein1c <italic>(srebp-1), elovl6a, elovl6b</italic> and <italic>elovl6c</italic> were upregulated in the low salinity groups, particularly in 7&#x2030;. On the contrary, the starvation stress suppressed the expression of <italic>srebp-1, elovl6a, elovl6b</italic> and <italic>elovl6c</italic>.</p>
<p>
<bold>Discussion:</bold> These results may contribute to understand the functions of <italic>elovl6</italic> in fatty acid synthesis and regulatory mechanisms in crustaceans.</p>
</abstract>
<kwd-group>
<kwd>ELOVL6</kwd>
<kwd>fatty acids</kwd>
<kwd>salinity stress</kwd>
<kwd>starvation stress</kwd>
<kwd>
<italic>Scylla paramamosain</italic>
</kwd>
</kwd-group>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Aquatic Physiology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>1 Introduction</title>
<p>The synthesis of long chain fatty acids (LCFAs) <italic>de novo</italic> was accomplished by elongation and desaturation steps (<xref ref-type="bibr" rid="B7">Green et al., 2010</xref>; <xref ref-type="bibr" rid="B34">Xie et al., 2021</xref>). As rate-limiting enzymes, elongation of very long-chain fatty acids proteins (ELOVL) were responsible for catalyzing the elongation step, which can elongate two carbons to pre-existing fatty acyl chains (<xref ref-type="bibr" rid="B7">Green et al., 2010</xref>; <xref ref-type="bibr" rid="B8">Guillou et al., 2010</xref>). The ELOVL family was divided into seven members in mammals based on different catalytic substrates and sequence characterization (<xref ref-type="bibr" rid="B10">Jakobsson et al., 2006</xref>). Generally, ELOVL5, ELOVL4 and ELOVL2 were inclined to elongate polyunsaturated fatty acids (PUFA), while ELOVL7, ELOVL6, ELOVL3 and ELOVL1 preferred to catalyze monounsaturated fatty acids (MUFA) and saturated fatty acids (SFA) (<xref ref-type="bibr" rid="B3">Castro et al., 2016</xref>). As a final elongase participated in LCFAs <italic>de novo</italic>, the ELOVL6 was first reported in mice, which showed the functions of elongating palmitoleic acid (C16:1n-7) and palmitate (C16:0) to vaccenci acid (C18:1n-7) and stearate (C18:0) respectively (<xref ref-type="bibr" rid="B21">Moon et al., 2001</xref>; <xref ref-type="bibr" rid="B20">Matsuzaka et al., 2002</xref>; <xref ref-type="bibr" rid="B25">Shi et al., 2017</xref>). Recently, numerous studies have been investigated to determine the physiological roles and regulatory mechanisms of <italic>elovl6</italic> in mammals (<xref ref-type="bibr" rid="B19">Matsuzaka et al., 2007</xref>; <xref ref-type="bibr" rid="B24">Saito et al., 2011</xref>; <xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>; <xref ref-type="bibr" rid="B1">Bae et al., 2016</xref>; <xref ref-type="bibr" rid="B27">Su et al., 2018</xref>). By contrast, the roles of <italic>elovl6</italic> in aquatic animals was still unclear, which only reported in <italic>Larimichthys crocea</italic> (<xref ref-type="bibr" rid="B13">Li et al., 2019</xref>), <italic>Misgurnus anguillicaudatus</italic> (<xref ref-type="bibr" rid="B4">Chen et al., 2018</xref>), <italic>Oncorhynchus mykiss</italic> (<xref ref-type="bibr" rid="B14">Li et al., 2020</xref>) and <italic>Eriocheir sinensis</italic> (<xref ref-type="bibr" rid="B26">Shi et al., 2016</xref>).</p>
<p>The <italic>elovl6</italic> is mainly expressed in lipogenic tissues and is closely associated with metabolic diseases (like atherogenesis, insulin resistance and hepatic inflammation) and energy balance (<xref ref-type="bibr" rid="B19">Matsuzaka et al., 2007</xref>; <xref ref-type="bibr" rid="B18">Matsuzaka and Shimano, 2009</xref>; <xref ref-type="bibr" rid="B29">Takashi et al., 2012</xref>; <xref ref-type="bibr" rid="B22">Motoko et al., 2015</xref>; <xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>; <xref ref-type="bibr" rid="B36">Zhao et al., 2017</xref>; <xref ref-type="bibr" rid="B23">Nakamura et al., 2018</xref>; <xref ref-type="bibr" rid="B27">Su et al., 2018</xref>). Previous studies have shown that the expression of <italic>elovl6</italic> was sensitive to nutrients (<xref ref-type="bibr" rid="B20">Matsuzaka et al., 2002</xref>; <xref ref-type="bibr" rid="B12">Leroux et al., 2016</xref>; <xref ref-type="bibr" rid="B26">Shi et al., 2016</xref>; <xref ref-type="bibr" rid="B13">Li et al., 2019</xref>), environmental factors (<xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>; <xref ref-type="bibr" rid="B4">Chen et al., 2018</xref>) and hormonal (<xref ref-type="bibr" rid="B19">Matsuzaka et al., 2007</xref>; <xref ref-type="bibr" rid="B18">Matsuzaka and Shimno, 2009</xref>; <xref ref-type="bibr" rid="B28">Sun et al., 2013</xref>; <xref ref-type="bibr" rid="B14">Li et al., 2020</xref>). In mammals, transcription of <italic>elovl6</italic> was regulated by the transcription factors such as carbohydrate response element binding protein (CHREB), sterol-regulatory element binding protein-1c (SREBP-1C) and liver X receptor &#x3b1; (LXR &#x3b1;), and the transcriptional level was intimately related to dietary lipid addition (<xref ref-type="bibr" rid="B20">Matsuzaka et al., 2002</xref>; <xref ref-type="bibr" rid="B11">Kumadaki et al., 2008</xref>; <xref ref-type="bibr" rid="B6">Ducheix et al., 2011</xref>; <xref ref-type="bibr" rid="B28">Sun et al., 2013</xref>; <xref ref-type="bibr" rid="B1">Bae et al., 2016</xref>). Likewise, both <italic>in vivo</italic> and <italic>in vitro</italic> demonstrated that dietary fatty acids could markedly affect the <italic>elovl6</italic> expression through regulating related transcription factors for <italic>L. crocea</italic> and <italic>O. mykiss</italic> (<xref ref-type="bibr" rid="B13">Li et al., 2019</xref>; <xref ref-type="bibr" rid="B14">2020</xref>). Besides, the <italic>elovl6</italic> plays a vital role in keeping fatty acids and energy balances in dealing with cold stress (<xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>; <xref ref-type="bibr" rid="B4">Chen et al., 2018</xref>). Studies have found that the transcriptional level of <italic>elovl6</italic> was significantly increased in brown adipose tissue under the cold stress, and <italic>elovl6</italic>
<sup>&#x2212;/&#x2212;</sup> mice showed lower heat-producing capability in brown adipose tissue (<xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>). Similar result was also observed in <italic>M. anguillicaudatus</italic>, which found that the <italic>elovl6</italic> expression could be induced by the cold stress for producing fatty acids to maintain proper membrane fluidity (<xref ref-type="bibr" rid="B4">Chen et al., 2018</xref>). In addition to temperature stress, aquatic animals also often need face salinity and starvation stress. In aquatic animals, supply of energy is crucial for coping with salinity and starvation stress, as well as maintenance of suitable cell membrane fluidity is also important adaptive way during osmoregulation. However, to the best our knowledge, the roles of <italic>elovl6</italic> in the face of salinity and starvation stress are still poorly understood.</p>
<p>The mud crab, <italic>Scylla paramamosain</italic>, is a kind of important marine crustacean species (<xref ref-type="bibr" rid="B35">Ye et al., 2010</xref>). Because of high nutritional value, unique flavor, high output and high economic value, the mud crab has been widely cultured in the coastal areas of southern China with a yield of around 152,065 tons in 2021 (<xref ref-type="bibr" rid="B5">China Fishery Statistical Yearbook, 2022</xref>). The present study aimed to determine the molecular features of three <italic>elovl6</italic> and their expression profiles in reaction to ambient salinity, dietary fatty acids and starvation. These results may be beneficial for further understanding the functions of <italic>elovl6</italic> in fatty acid synthesis and regulatory mechanism in crustaceans.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>2 Materials and methods</title>
<sec id="s2-1">
<title>2.1 Nutrition experiment</title>
<p>Six isonitrogenous (45% crude protein) and isolipidic (9.5% crude lipid) experimental diets were prepared by substituting fish oil with 0% (FO group), 20% (SO-20 group), 40% (SO-40 group), 60% (SO-60 group), 80% (SO-80 group) and 100% (SO-100 group) soybean oil. The dietary protein sources were provided with casein and white fishmeal, and lipid sources were supplied by soybean oil, cholesterol, phospholipids and fish oil. The specific feed formula, diet making process, experimental design, experimental condition and sample collection have been described in our previous studies (<xref ref-type="bibr" rid="B16">Lin et al., 2017</xref>; <xref ref-type="bibr" rid="B15">Lin et al., 2018</xref>).</p>
</sec>
<sec id="s2-2">
<title>2.2 Salinity stress experiment</title>
<p>The 21-day salinity stress experiment was conducted in culture system of Ningde Normal University. The salinity was set as 27&#x2030;, 22&#x2030;, 17&#x2030;, 12&#x2030; and 7&#x2030;. The crabs used in the present study were bought from a local crab farm in Sandu bay (Ningde, Fujian, China), and the crabs were temporarily cultured for adapting to the experimental environment and diets. Subsequently, ninety healthy crabs (initial average weight: 62.90 &#xb1; 1.98&#xa0;g) with intact limbs were assigned to fifteen polypropylene buckets (Zhongkehai, Qingdao, China). There were five groups, each with three replicates, and each replicate with six crabs. The crabs were fed commercial diets twice daily (8:30 and 18:00) to apparent satiation during experiment. Feces and residual diets were removed once a day. During the salinity stress experiment, water quality parameters were as follows: the temperature ranged from 19.1&#xb0;C to 22.4&#xb0;C, oxygen concentration more than 5.0&#xa0;mg&#xa0;L<sup>&#x2212;1</sup> and ammonia nitrogen lower than 0.05&#xa0;mg&#xa0;L<sup>&#x2212;1</sup>. At the end of the trial, the crabs were dissected to obtain the hepatopancreas and muscle samples after being starved for 24&#xa0;h. Then, the samples were immediately frozen in liquid nitrogen and stored at &#x2212;80&#xb0;C for further treatment.</p>
</sec>
<sec id="s2-3">
<title>2.3 Starvation stress experiment</title>
<p>The crabs (64.51 &#xb1; 0.83&#xa0;g) used in the present study were purchased from Sandu bay (Ningde, Fujian, China), and 4-week starvation stress experiment was performed in culture system of Ningde Normal University. The starvation stress experiment contained two treatments: starvation group (SG) and feeding group (FG). Thirty-six vigorous crabs were randomly divided into six polypropylene buckets after being temporarily reared for acclimatization. Each treatment has three replicates, and each replicate has six crabs. During the starvation stress experiment, the crabs in feeding group was fed twice daily (8:30 and 18:00) to apparent satiation with a local bivalve mollusc (<italic>Sinonovacula constrzcta</italic>), and starvation group was not fed any food. Uneaten feeds and feces were cleared once daily, and 30% water from each tank was exchanged per day. During the experiment, dissolved oxygen of water was more than 7.0&#xa0;mg&#xa0;L<sup>&#x2212;1</sup>, water temperature ranged from 15.3&#xb0;C to 20.3&#xb0;C and ammonia nitrogen was lower than 0.05&#xa0;mg&#xa0;L<sup>&#x2212;1</sup>. The hepatopancreas and muscle samples were collected and immediately frozen in liquid nitrogen after the experiment completed. Subsequently, the samples above were stored at &#x2212;80&#xb0;C for further analysis.</p>
</sec>
<sec id="s2-4">
<title>2.4 RNA isolation, first-strand cDNA synthesis and full-length cDNA cloning</title>
<p>Total RNA was extracted from the fresh hepatopancreas using Trizol reagent (Invitrogen, United States) according to the manufacturer&#x2019;s instructions. After determining the quality and concentration of total RNA, SMARTer&#x2122; RACE cDNA Amplification kit (Clontech, United States) was used to produce the first-strand cDNA based on specification. The cDNA samples were kept in &#x2212;20&#xb0;C as subsequent cloning templates.</p>
<p>Three partial cDNA sequences of <italic>elovl6s</italic>, named <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic>, were obtained from our previous transcriptome sequencing. Related primers were designed according to the sequences above, and the primers have been shown in <xref ref-type="table" rid="T1">Table 1</xref>. 5&#x2032; and 3&#x2032; rapid amplification of cDNA ends (RACE) methods were applied to clone the 5&#x2032; untranslated region (UTR) and 3&#x2032; UTR of three <italic>elovl6s</italic> using touch-down PCR (first round PCR) and nested PCR (second round PCR) strategies. The primers of elovl6a 3-1, elovl6a 5-1, elovl6b 3-1, elovl6b 5-1, elovl6c 3-1 and elovl6c 5-1 were applied to touch-down PCR, and the primers of elovl6a 3-2, elovl6a 5-2, elovl6b 3-2, elovl6b 5-2, elovl6c 3-2 and elovl6c 5-2 were used to nested PCR. The amplification program and reaction system of touch-down PCR and nested PCR have been shown in our previous studies (<xref ref-type="bibr" rid="B16">Lin et al., 2017</xref>; <xref ref-type="bibr" rid="B15">Lin et al., 2018</xref>). Target band was purified with SanPrep Column DNA Gel Extraction Kit (Sangon Biotech, Shanghai, China.), and then cloned into pMD 19-T simple vector (Takara, Dalian, China). The sequence information of positive clones was determined by sequencing with a commercial company (BGI, Shenzhen, China).</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Names and sequences of primers used in the present study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Primer</th>
<th align="left">Sequence (5&#x2032;-3&#x2032;)</th>
<th align="left">Objective</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Oligo-</td>
<td align="left">AAG&#x200b;CAG&#x200b;TGG&#x200b;TAT&#x200b;CAA&#x200b;CGC&#x200b;AGA&#x200b;GTACXXXXX</td>
<td align="left">First-Strand cDNA Synthesis</td>
</tr>
<tr>
<td align="left">UPM (long)</td>
<td align="left">CTA&#x200b;ATA&#x200b;CGA&#x200b;CTC&#x200b;ACT&#x200b;ATA&#x200b;GGG&#x200b;CAA&#x200b;GCA&#x200b;GTG&#x200b;GTA&#x200b;TCA&#x200b;ACG&#x200b;CAG&#x200b;AGT</td>
<td align="left">RACE-PCR</td>
</tr>
<tr>
<td align="left">UPM (short)</td>
<td align="left">CTA&#x200b;ATA&#x200b;CGA&#x200b;CTC&#x200b;ACT&#x200b;ATA&#x200b;GGG&#x200b;C</td>
<td align="left">RACE-PCR</td>
</tr>
<tr>
<td align="left">NUP</td>
<td align="left">AAGCAGTGGTATCAACGCAGAGT</td>
<td align="left">RACE-PCR</td>
</tr>
<tr>
<td align="left">M13F</td>
<td align="left">CGC&#x200b;CAG&#x200b;GGT&#x200b;TTT&#x200b;CCC&#x200b;AGT&#x200b;CAC&#x200b;GAC</td>
<td align="left">PCR screening</td>
</tr>
<tr>
<td align="left">M13R</td>
<td align="left">AGC&#x200b;GGA&#x200b;TAA&#x200b;CAA&#x200b;TTT&#x200b;CAC&#x200b;ACA&#x200b;GGA</td>
<td align="left">PCR screening</td>
</tr>
<tr>
<td align="left">&#x3b2;-actin R</td>
<td align="left">GCG&#x200b;GCA&#x200b;GTG&#x200b;GTC&#x200b;ATC&#x200b;TCC&#x200b;T</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td align="left">Srebp-1 F</td>
<td align="left">GCT&#x200b;TCA&#x200b;AGG&#x200b;GAT&#x200b;GAG&#x200b;GTT&#x200b;TGC</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td align="left">Srebp-1 R</td>
<td align="left">GGA&#x200b;TCT&#x200b;TCT&#x200b;GAG&#x200b;GTC&#x200b;CTG&#x200b;AGG&#x200b;TAC&#x200b;T</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td align="left">&#x3b2;-actin F</td>
<td align="left">GCC&#x200b;CTT&#x200b;CCT&#x200b;CAC&#x200b;GCT&#x200b;ATC&#x200b;CT</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td colspan="3" align="left">For elovl6a clone and qRT-PCR</td>
</tr>
<tr>
<td align="left">elovl6a 3&#x2013;1</td>
<td align="left">AGT&#x200b;ACC&#x200b;GCC&#x200b;CTC&#x200b;GAT&#x200b;TTG&#x200b;AGC&#x200b;TCC&#x200b;G</td>
<td align="left">3&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6a 3&#x2013;2</td>
<td align="left">GGA&#x200b;CCC&#x200b;AGT&#x200b;TTC&#x200b;CTT&#x200b;GAC&#x200b;AAC&#x200b;CGT&#x200b;GT</td>
<td align="left">3&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6a 5&#x2013;1</td>
<td align="left">CCA&#x200b;CCC&#x200b;ACA&#x200b;CGG&#x200b;TTG&#x200b;TCA&#x200b;AGG&#x200b;AAA&#x200b;CT</td>
<td align="left">5&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6a 5&#x2013;2</td>
<td align="left">TCG&#x200b;AGG&#x200b;GCG&#x200b;GTA&#x200b;CTG&#x200b;CAT&#x200b;GTA&#x200b;AAG&#x200b;TTG</td>
<td align="left">5&#x2032;RACE</td>
</tr>
<tr>
<td align="left">Q-elovl6a F</td>
<td align="left">TCA&#x200b;CTC&#x200b;CTC&#x200b;AAA&#x200b;AAA&#x200b;CCA&#x200b;CGC</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td align="left">Q-elovl6a R</td>
<td align="left">GCT&#x200b;GAC&#x200b;ACA&#x200b;CGA&#x200b;CAC&#x200b;GCT&#x200b;CAA</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td colspan="3" align="left">For elovl6b clone and qRT-PCR</td>
</tr>
<tr>
<td align="left">elovl6b 3&#x2013;1</td>
<td align="left">CGT&#x200b;TAC&#x200b;CTC&#x200b;CAC&#x200b;CAA&#x200b;CTT&#x200b;CAC&#x200b;CTA&#x200b;CCG</td>
<td align="left">3&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6b 3&#x2013;2</td>
<td align="left">GCC&#x200b;TTA&#x200b;CGC&#x200b;ACC&#x200b;ACG&#x200b;CCT&#x200b;GAA&#x200b;ATG</td>
<td align="left">3&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6b 5&#x2013;1</td>
<td align="left">CAG&#x200b;CAT&#x200b;TTC&#x200b;AGG&#x200b;CGT&#x200b;GGT&#x200b;GCG&#x200b;TAA&#x200b;G</td>
<td align="left">5&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6b 5&#x2013;2</td>
<td align="left">TCG&#x200b;GCG&#x200b;GGA&#x200b;GTG&#x200b;TCA&#x200b;GGT&#x200b;CGT&#x200b;AG</td>
<td align="left">5&#x2032;RACE</td>
</tr>
<tr>
<td align="left">Q-elovl6b F</td>
<td align="left">TTC&#x200b;ACC&#x200b;TAC&#x200b;CGC&#x200b;TAC&#x200b;ACC&#x200b;TTC&#x200b;A</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td align="left">Q-elovl6b R</td>
<td align="left">ACT&#x200b;TGG&#x200b;GTC&#x200b;GCT&#x200b;TTT&#x200b;CCA&#x200b;TCA&#x200b;C</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td colspan="3" align="left">For elovl6c clone and qRT-PCR</td>
</tr>
<tr>
<td align="left">elovl6c 3&#x2013;1</td>
<td align="left">CTA&#x200b;CAT&#x200b;GGT&#x200b;GGG&#x200b;CGC&#x200b;CTA&#x200b;CAT&#x200b;GGC</td>
<td align="left">3&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6c 3&#x2013;2</td>
<td align="left">TGT&#x200b;TCA&#x200b;CGT&#x200b;TGA&#x200b;GCA&#x200b;AGG&#x200b;TGC&#x200b;CAG&#x200b;A</td>
<td align="left">3&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6c 5&#x2013;1</td>
<td align="left">TGG&#x200b;CAC&#x200b;CTT&#x200b;GCT&#x200b;CAA&#x200b;CGT&#x200b;GAA&#x200b;CAT&#x200b;C</td>
<td align="left">5&#x2032;RACE</td>
</tr>
<tr>
<td align="left">elovl6c 5&#x2013;2</td>
<td align="left">GGT&#x200b;CAA&#x200b;AAG&#x200b;CAG&#x200b;GTC&#x200b;GGG&#x200b;TCT&#x200b;CCA</td>
<td align="left">5&#x2032;RACE</td>
</tr>
<tr>
<td align="left">Q-elovl6c F</td>
<td align="left">TCT&#x200b;ACG&#x200b;GCG&#x200b;GAA&#x200b;ACT&#x200b;GGG&#x200b;TG</td>
<td align="left">qRT-PCR</td>
</tr>
<tr>
<td align="left">Q-elovl6c R</td>
<td align="left">TGC&#x200b;TTG&#x200b;CGG&#x200b;AGG&#x200b;TCA&#x200b;AAA&#x200b;GC</td>
<td align="left">qRT-PCR</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>X, undisclosed base in the proprietary SMARTer, oligo sequence.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2-5">
<title>2.5 Sequence and phylogenetic analysis</title>
<p>Homology searches were performed with BLAST at the National Center for Biotechnology Information (<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/">http://www.ncbi.nlm.nih.gov/</ext-link>). The multiple alignments were created using the DNAMAN software. Transmembrane structure was predicted utilizing the TMHMM 2.0 (<ext-link ext-link-type="uri" xlink:href="https://services.healthtech.dtu.dk/services/TMHMM-2.0/">https://services.healthtech.dtu.dk/services/TMHMM-2.0/</ext-link>). The phylogenetic analysis based on the amino acid sequences was constructed by the Neighbour-Joining algorithm with the software MEGA version 7.0.</p>
</sec>
<sec id="s2-6">
<title>2.6 Quantitative real-time PCR</title>
<p>Six mud crabs (average weight: 103.60 &#xb1; 6.20&#xa0;g) were used to investigate the <italic>elovl6a, elovl6b</italic> and <italic>elovl6c</italic> expression levels in different tissues (epidermis, gill, hepatopancreas, cranial ganglia, eyestalk, thoracic ganglia, stomach, intestine, muscle and heart) by using quantitative real-time PCR. Likewise, quantitative real-time PCR was also applied to detect the <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> mRNA levels in response to dietary fatty acids, salinity stress and starvation stress. The <italic>&#x3b2;-actin</italic> gene from <italic>S. paramamosain</italic> was selected as reference for internal standardization. Primers used in quantitative real-time PCR were given in <xref ref-type="table" rid="T1">Table 1</xref>. The amplification program and reaction system of quantitative real-time PCR have been described in our previous studies used for determining tissue distribution as well as <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> expression levels in response to dietary fatty acids (<xref ref-type="bibr" rid="B16">Lin et al., 2017</xref>; <xref ref-type="bibr" rid="B15">Lin et al., 2018</xref>). In addition, as for salinity and starvation stress experiment, the total RNA of muscle and hepatopancreas was isolated by using TRNzol universal Reagent (Tiangen, Beijing, China). The single-strand cDNA was synthesized using PrimeScript<sup>&#xae;</sup> RT reagent Kit with gDNA Eraser with 1&#xa0;&#x3bc;g of total RNA, and the obtained cDNA was diluted by 4 times using ultra-pure water for further analysis. Five different thinned cDNA samples were used to determine the standard curves. The amplification efficiency of primers used in the present study was between 95% and 105% by counting with formula <italic>E</italic> &#x3d; 10<sup>(&#x2212;1/Slope)</sup>&#x2014;1. Quantitative real-time PCR was performed in a total volume of 20&#xa0;&#x3bc;L including 10&#xa0;&#x3bc;L 2 &#xd7; ChamQ universal SYBR qPCR Master Mix (Q711&#x2013;02/03, Vazyme Biotech Co., Ltd., Nanjing, China), 1.0&#xa0;&#x3bc;L of the diluted cDNA template, 0.4&#xa0;&#x3bc;L of each primer (10&#xa0;&#x3bc;M) and 8.2&#xa0;&#x3bc;L of sterile distilled H<sub>2</sub>O. The program of quantitative real-time PCR was 95&#xb0;C for 30&#xa0;s, followed by 40 cycles of 95&#xb0;C for 10 s and 60&#xb0;C for 30&#xa0;s, and then a dissociation curve (95&#xb0;C for 15&#xa0;s, 60&#xb0;C for 60&#xa0;s and 95&#xb0;C for 15&#xa0;s) was performed to identify unicity of PCR product. The relative mRNA expression levels were calculated by 2<sup>&#x2212;&#x394;&#x394;Ct</sup> method (<xref ref-type="bibr" rid="B17">Livak and Schmittgen, 2001</xref>).</p>
</sec>
<sec id="s2-7">
<title>2.7 Statistical analysis</title>
<p>Results were shown in the form of means &#xb1; SEM (standard error of the mean). After checking homogeneity and normality, one-way analysis of variance (ANOVA) followed by Duncan&#x2019;s multiple comparison test was used to determine the differences of tissue distribution, nutrition experiment and salinity stress experiment. In addition, independent-samples <italic>t</italic>-test was applied to analyze differences in starvation stress experiment. All statistical analysis was carried out by SPSS 20.0 (SPSS, Chicago, IL, United States), and <italic>p</italic> values less than 0.05 was considered to be statistically significant.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>3 Results</title>
<sec id="s3-1">
<title>3.1 cDNA cloning and sequence analysis</title>
<p>The full-length cDNA sequences of <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> were obtained by overlapping the corresponding expressed sequence tags (ESTs) with the amplified fragments using the RACE technology. The sequences of <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> were submitted to GenBank getting the accession numbers MF784574, OQ863017 and OQ863018 respectively. The complete sequence of <italic>elovl6a</italic> was 1345 bp containing a 5&#x2032;-UTR of 176 bp, a 3&#x2032;-UTR of 305 bp with a poly A tail and an open reading frame (ORF) of 864 bp encoding a putative protein of 287 amino acids, and the full-length sequence of <italic>elovl6b</italic> was 1419 bp and consists of a 990 bp ORF from 126 bp to 1115 bp encoding a putative protein of 329 amino acids, 125 bp of 5&#x2032;-UTR and 304 bp of 3&#x2032;-UTR with a poly A tail. In addition, the obtained <italic>elovl6c</italic> sequence was 1375 bp in full length with 167 bp of 5&#x2032;-UTR and 302 bp of 3&#x2032;-UTR including poly A tail, which contained an ORF of 906 bp encoding a putative protein of 301 amino acids. All the ELOVL6s possessed the endoplasmic reticulum retention signal (KXKXX) and membrane-spanning domains (Supplemented Fig. s1-3). Multiple alignments of ELOVL6a, ELOVL6b and ELOVL6c indicated that the predicted amino acid sequences contained characteristic conserved motifs of the microsomal ELOVL family, like HXXHH (histidine box), KXXEXXDT, NXXXHXXMYXYY and TXXQXXQ (<xref ref-type="fig" rid="F1">Figure 1</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Multiple alignments of the ELOVL6 amino acid sequences between <italic>Scylla paramamosain</italic> and other crustaceans. The threshold for similarity shading was set at 50%. Identical residues are shaded black. Amino acid residues that are conserved in at least 75% and 50% of sequences are shaded in pink and cyan, respectively. The motifs highly conserved are boxed among elongases, and the endoplasmic reticulum retention signal is underlined. SP_ELOVL6a: <italic>Scylla paramamosain</italic> ELOVL6a; SP_ELOVL6b: <italic>Scylla paramamosain</italic> ELOVL6b; SP_ELOVL6c: <italic>Scylla paramamosain</italic> ELOVL6c. <italic>Procambarus clarkii</italic> (XP_045621678), <italic>Homarus americanus</italic> (XP_042209792), <italic>Penaeus japonicas</italic> (XP_042885566), <italic>Portunus trituberculatus</italic> (XP_045136269), <italic>Penaeus chinensis</italic> (XP_047487575) and <italic>Gecarcoidea lalandii</italic> (QKG32709).</p>
</caption>
<graphic xlink:href="fphys-14-1221205-g001.tif"/>
</fig>
</sec>
<sec id="s3-2">
<title>3.2 Homology and phylogenetic analysis</title>
<p>The results of phylogenetic tree showed that the three mud crab ELOVL6 gathered together with their corresponding orthologues, and separated with the ELOVL1, ELOVL2, ELOVL3, ELOVL4, ELOVL5 and ELOVL7. The mud crab ELOVL6a clustered most closely to ELOVL6 from <italic>Portunus trituberculatus</italic>, and further clustered with <italic>E. sinensis</italic>. In addition, the mud crab ELOVL6b and ELOVL6c gathered alone into a single branch and then clustered with other ELOVL6 from crustaceans (<xref ref-type="fig" rid="F2">Figure 2</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Phylogenetic analysis between the amino acid sequences of <italic>Scylla paramamosain</italic> ELOVL6 and 31 available ELOVL sequences. The tree was constructed using the neighbor joining method with MEGA 7.0. The horizontal branch length is proportional to amino acid substitution rate per site. Numbers represent the frequencies with which the tree topology presented was replicated after 1000 bootstrap iterations.</p>
</caption>
<graphic xlink:href="fphys-14-1221205-g002.tif"/>
</fig>
</sec>
<sec id="s3-3">
<title>3.3 Tissue distribution</title>
<p>Quantitative real-time PCR was used to analyze mRNA levels of <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> in the tissues of healthy crabs, including thoracic ganglia, stomach, heart, gill, epidermis, hepatopancreas, intestine, muscle, eyestalk and cranial ganglia. As illustrated in <xref ref-type="fig" rid="F3">Figure 3</xref>, <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> could be detected in all the examined tissues, but existed obvious differences in expression levels. The relatively abundant expression of <italic>elovl6a</italic> was observed in hepatopancreas and stomach, moderate expression in intestine and cranial ganglia and low expression in epidermis, gill, heart, eyestalk, muscle and thoracic ganglia. The <italic>elovl6c</italic> was expressed at significantly higher levels in hepatopancreas and stomach compared to other tissues (<italic>p</italic> &#x3c; 0.05). By contrast, the <italic>elovl6b</italic> was mainly expressed in the stomach, followed by the intestine and hepatopancreas.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Relative mRNA levels of <italic>elovl6</italic> in different tissues of <italic>Scylla paramamosain</italic>. Vertical bars represented mean &#xb1; SEM (<italic>n</italic> &#x3d; 6) for each tissue. Letters show significant differences (<italic>p</italic> &#x3c; 0.05) among tissues as determined by one-way ANOVA followed by Duncan&#x2019;s multiple comparison test.</p>
</caption>
<graphic xlink:href="fphys-14-1221205-g003.tif"/>
</fig>
</sec>
<sec id="s3-4">
<title>3.4 Transcriptional levels of <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> in response to dietary fatty acids</title>
<p>The mRNA levels of <italic>elovl6s</italic> in hepatopancreas were observably influenced by the dietary fatty acids (<italic>p</italic> &#x3c; 0.05). The crabs fed SO-60, SO-80 and SO-100 diets showed markedly higher <italic>elovl6a</italic> mRNA levels than those fed FO and SO-20 diets (<italic>p</italic> &#x3c; 0.05). There was no significant difference between the FO and SO-20 groups in the <italic>elovl6a</italic> expression (<italic>p</italic> &#x3e; 0.05). The mRNA levels of <italic>elovl6b</italic> in the SO-60 and SO-100 groups were dramatically upregulated when compared with the FO group. (<italic>p</italic> &#x3c; 0.05). Although no significant differences were detected among the FO, SO-40 and SO-80 groups, the SO-40 and SO-80 groups had the higher <italic>elovl6b</italic> mRNA levels than the FO group (<italic>p</italic> &#x3e; 0.05). In addition, the <italic>elovl6c</italic> transcriptional levels showed increasing tendency with the increased replacement of dietary fish oil by soybean oil, and the SO-80 and SO-100 groups exhibited significantly higher <italic>elovl6c</italic> transcriptional levels than the FO group (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figure 4</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Relative expression levels of <italic>elovl6</italic> in hepatopancreas of <italic>Scylla paramamosain</italic> fed six experimental diets. Bars with different superscripts are significantly different (<italic>p</italic> &#x3c; 0.05, one-way ANOVA and Duncan&#x2019;s multiple comparison test). FO means that fish oil is the only dietary lipid source, numerical values after SO refer to the percentage of dietary fish oil replaced by soybean oil.</p>
</caption>
<graphic xlink:href="fphys-14-1221205-g004.tif"/>
</fig>
</sec>
<sec id="s3-5">
<title>3.5 Transcriptional levels of <italic>elovl6a</italic>, <italic>elovl6b</italic>, <italic>elovl6c</italic> and <italic>srebp-1</italic> in response to ambient salinity</title>
<p>The effects of ambient salinity on the mRNA levels of <italic>elovl6a</italic>, <italic>elovl6b</italic>, <italic>elovl6c</italic> and <italic>srebp-1</italic> in hepatopancreas and muscle are presented in <xref ref-type="fig" rid="F5">Figure 5</xref>. Compared with the 27&#x2030; salinity group, the mRNA levels of <italic>elovl6a</italic>, <italic>elovl6b</italic>, <italic>elovl6c</italic> and <italic>srebp-1</italic> in hepatopancreas were upregulated in the 22&#x2030;, 17&#x2030;, 12&#x2030; and 7&#x2030; salinity groups, and the 7&#x2030; salinity group showed a significant difference with the 27&#x2030; salinity group (<italic>p</italic> &#x3c; 0.05). There were no significant differences in <italic>elovl6a</italic> and <italic>srebp-1</italic> expression of muscle, although the 22&#x2030;, 17&#x2030;, 12&#x2030; and 7&#x2030; salinity groups had the higher levels than the 27&#x2030; salinity group (<italic>p</italic> &#x3e; 0.05). The <italic>elovl6b</italic> and <italic>elovl6c</italic> transcriptional levels in the 27&#x2030; salinity group were also lower than the 22&#x2030;, 17&#x2030;, 12&#x2030; and 7&#x2030; salinity groups. In addition, the <italic>elovl6c</italic> mRNA levels in 7&#x2030; salinity group and <italic>elovl6b</italic> transcriptional levels in 7&#x2030; and 12&#x2030; salinity groups exhibited markedly higher values than the 27&#x2030; salinity group (<italic>p</italic> &#x3c; 0.05).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Relative expression levels of <italic>elovl6</italic> and <italic>srebp-1</italic> in hepatopancreas and muscle of <italic>Scylla paramamosain</italic> in response to salinity stress. Bars with different superscripts are significantly different (<italic>p</italic> &#x3c; 0.05, one-way ANOVA and Duncan&#x2019;s multiple comparison test). Numerical values refer to seawater salinity.</p>
</caption>
<graphic xlink:href="fphys-14-1221205-g005.tif"/>
</fig>
</sec>
<sec id="s3-6">
<title>3.6 Transcriptional levels of <italic>elovl6a</italic>, <italic>elovl6b</italic>, <italic>elovl6c</italic> and <italic>srebp-1</italic> in response to starvation stress</title>
<p>The effects of starvation stress on the mRNA levels of <italic>elovl6a</italic>, <italic>elovl6b</italic>, <italic>elovl6c</italic> and <italic>srebp-1</italic> in hepatopancreas and muscle are shown in <xref ref-type="fig" rid="F6">Figure 6</xref>. Compared with the feeding group, the <italic>elovl6a</italic>, <italic>elovl6b</italic>, <italic>elovl6c</italic> and <italic>srebp-1</italic> transcriptional levels in hepatopancreas were downregulated in the starvation group. The <italic>elovl6a</italic> and <italic>srebp-1</italic> expression levels in hepatopancreas of starvation group were dramatically lower than the feeding group (<italic>p</italic> &#x3c; 0.01). Additionally, no significant differences in <italic>elovl6a</italic>, <italic>elovl6b</italic>, <italic>elovl6c</italic> and <italic>srebp-1</italic> expression levels of muscle were observed between the starvation group and feeding group (<italic>p</italic> &#x3e; 0.05).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Relative expression levels of <italic>elovl6</italic> and <italic>srebp-1</italic> in hepatopancreas and muscle of <italic>Scylla paramamosain</italic> in response to starvation stress. &#x2a; indicates significant difference between feeding group and starvation group (<italic>p</italic> &#x3c; 0.05, independent-samples <italic>t</italic>-test).</p>
</caption>
<graphic xlink:href="fphys-14-1221205-g006.tif"/>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>4 Discussion</title>
<p>As a final elongase participated in LCFAs <italic>de novo</italic> in conjunction with fatty acid synthase and stearoyl-CoA desaturase, the ELOVL6 was located in endoplasmic reticulum, which possessed the ability to elongate C16:1n-7 and C16:0 to C18:1n-7 and C18:0 respectively (<xref ref-type="bibr" rid="B7">Green et al., 2010</xref>; <xref ref-type="bibr" rid="B25">Shi et al., 2017</xref>). Previous studies have exhibited that the ELOVL6 was closely related to metabolic diseases and energy balance in mammal and fish (<xref ref-type="bibr" rid="B29">Takashi et al., 2012</xref>; <xref ref-type="bibr" rid="B22">Motoko et al., 2015</xref>; <xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>; <xref ref-type="bibr" rid="B36">Zhao et al., 2017</xref>; <xref ref-type="bibr" rid="B4">Chen et al., 2018</xref>; <xref ref-type="bibr" rid="B23">Nakamura et al., 2018</xref>; <xref ref-type="bibr" rid="B27">Su et al., 2018</xref>), while few studies were reported in crustaceans. In the present study, three <italic>elovl6</italic> isoforms were isolated from the <italic>S. paramamosain</italic>, and the deduced amino acids have the typical structural features of ELOVL protein family members (<xref ref-type="bibr" rid="B32">Tocher, 2015</xref>), such as conserved motifs (KXXEXXDT, NXXXHXXMYXYY and TXXQXXQ), histidine box (HXXHH) and transmembrane regions. The phylogenetic analysis showed that the <italic>S. paramamosain</italic> ELOVL6 gathered together with their orthologues from crustaceans and separated with the ELOVL1, ELOVL2, ELOVL3, ELOVL4, ELOVL5 and ELOVL7, which further supported that the isolated genes were <italic>elovl6</italic>. The ELOVL6a from <italic>S. paramamosain</italic> clustered most closely to ELOVL6 from <italic>P. trituberculatus</italic> and <italic>E. sinensis</italic>, which indicated that they have an intimate relationship. In addition, the ELOVL6b and ELOVL6c from <italic>S. paramamosain</italic> gathered alone into a single branch, suggesting ELOVL6b and ELOVL6c have a closer genetic relationship than ELOVL6a and ELOVL6 from other crustaceans.</p>
<p>Studies in mice have indicated that the <italic>elovl6</italic> was mainly expressed in liver and brain (<xref ref-type="bibr" rid="B21">Moon et al., 2001</xref>; <xref ref-type="bibr" rid="B20">Matsuzaka et al., 2002</xref>; <xref ref-type="bibr" rid="B1">Bae et al., 2016</xref>). Similar results were also observed in <italic>L. crocea</italic> and <italic>O. mykiss</italic>, which found that the high expression of <italic>elovl6</italic> was detected in the liver, brain and eye (<xref ref-type="bibr" rid="B13">Li et al., 2019</xref>; <xref ref-type="bibr" rid="B14">Li et al., 2020</xref>). By contrast, three <italic>elovl6</italic> isoforms from <italic>M. anguillicaudatus</italic> exhibited different expression patterns, and muscle and ovary were the main expression sites (<xref ref-type="bibr" rid="B4">Chen et al., 2018</xref>). The results of present study showed that the highest expression levels of the <italic>elovl6a</italic> and <italic>elovl6c</italic> from <italic>S. paramamosain</italic> were the hepatopancreas. This result was consistent with a past study of <xref ref-type="bibr" rid="B26">Shi et al. (2016)</xref>, who detected that <italic>elovl6</italic> was highly expressed in hepatopancreas of <italic>E. sinensis</italic>. Normally, the hepatopancreas is considered as a main lipid metabolism and storage organ akin to liver of vertebrates (<xref ref-type="bibr" rid="B33">Wen et al., 2001</xref>; <xref ref-type="bibr" rid="B31">Tian et al., 2023</xref>). The results above may indicate that the <italic>elovl6a</italic> and <italic>elovl6c</italic> mainly acted in the hepatopancreas in <italic>S. paramamosain</italic>. In addition, digestive organs are now regarded as an important site of fatty acid metabolism, at least in salmonids (<xref ref-type="bibr" rid="B2">Bell et al., 2003</xref>). The present study also found that the relatively abundant expression of <italic>elovl6b</italic> was observed in intestine and stomach, and the <italic>elovl6a</italic> also had high expression levels, suggesting <italic>elovl6a</italic> and <italic>elovl6b</italic> may plays an important role in fatty acid synthesis of these tissues in <italic>S. paramamosain</italic>.</p>
<p>Previous studies have demonstrated that the expression of <italic>elovl6</italic> could markedly affect by dietary fatty acids (<xref ref-type="bibr" rid="B20">Matsuzaka et al., 2002</xref>; <xref ref-type="bibr" rid="B12">Leroux et al., 2016</xref>; <xref ref-type="bibr" rid="B26">Shi et al., 2016</xref>; <xref ref-type="bibr" rid="B13">Li et al., 2019</xref>; <xref ref-type="bibr" rid="B14">Li et al., 2020</xref>). In mice, compared with fat-free diet, the diets added with eicosapentaenoic acid or linoleates significantly suppressed the <italic>elovl6</italic> expression, and the reduction was more obvious in fish oil rich in docosahexaenoic acid and eicosapentaenoic acid (<xref ref-type="bibr" rid="B20">Matsuzaka et al., 2002</xref>). In addition, studies found that <italic>O. mykiss</italic> fed diets containing fish oil exhibited higher the transcriptional level of <italic>elovl6</italic> in liver than those fed diets with soybean oil or linseed oil (<xref ref-type="bibr" rid="B13">Li et al., 2019</xref>). On the contrary, results from <italic>L. crocea</italic> have exhibited that the mRNA levels of <italic>elovl6</italic> in liver were observably upregulated in the soybean oil, linseed oil, or palm oil groups when compared with the fish oil group. Besides, hepatocytes from <italic>L. crocea</italic> treated with linoleic acid, &#x3b1;-linolenic acid or palmitic acid also obtained similar results above, and this increase may be regulated by related transcription factors like hepatocyte nuclear factor 1&#x3b1; (HNF1&#x3b1;) and retinoid X receptor &#x3b1; (RXR&#x3b1;) (<xref ref-type="bibr" rid="B14">Li et al., 2020</xref>). Likewise, the present study also found that replacing fish oil with soybean oil could significantly increase the transcriptional levels of three <italic>elovl6</italic> in hepatopancreas of <italic>S. paramamosain</italic>. This result was consistent with a study from <italic>E. sinensis</italic>, which observed that soybean oil group had markedly higher expression of <italic>elovl6</italic> than the fish oil group (<xref ref-type="bibr" rid="B26">Shi et al., 2016</xref>). Our past study has detected that compared with fish oil, soybean oil markedly upregulated the <italic>srebp-1</italic> expression, and the SREBP-1, as a transcription factor, can activate target gene expression like <italic>elovl6</italic> (<xref ref-type="bibr" rid="B9">Hao et al., 2018</xref>). Thus, we speculated that soybean oil rich in linoleic acid promoted the <italic>elovl6</italic> expression possibly through activating <italic>srebp-1</italic> expression in the present study. Additionally, the expression of <italic>elovl6a</italic> and <italic>elovl6c</italic> in hepatopancreas were more sensitive to dietary fatty acids than the <italic>elovl6b</italic> probably because these two genes are mainly expressed in hepatopancreas.</p>
<p>Besides, the expression of <italic>elovl6</italic> could also markedly affect by the environmental factors. Previous studies have proved that the <italic>elovl6</italic> plays a crucial role in regulating energy expenditure and fatty acid metabolism in adaptation to cold stress (<xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>; <xref ref-type="bibr" rid="B4">Chen et al., 2018</xref>). In mice, the transcriptional level of <italic>elovl6</italic> was markedly upregulated in brown adipose tissue under the cold stress, and <italic>elovl6</italic>
<sup>&#x2212;/&#x2212;</sup> mice exhibited lower heat-producing capability in brown adipose tissue (<xref ref-type="bibr" rid="B30">Tan et al., 2015</xref>). Consistently, <xref ref-type="bibr" rid="B4">Chen et al. (2018)</xref> found that the expression of three <italic>elovl6</italic> isoforms from <italic>M. anguillicaudatus</italic> could be induced by the cold stress for keeping energy balances and producing fatty acids to maintain proper membrane fluidity. In addition to temperature stress, aquatic animals often require cope with stresses of salinity changes and food scarcity. To the best our knowledge, the present study was the first time to investigate the <italic>elovl6</italic> expression in respond to salinity and starvation stress. The results showed that compared with the normal sea water group (27&#x2030;), the expression of <italic>srebp-1</italic>, <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> were upregulated in the low salinity groups, particularly in 7&#x2030;, suggesting that three <italic>elovl6</italic> may play a crucial role in salinity adaptation for <italic>S. paramamosain</italic>. The possible reason for this result above was that the expression of transcription factors, SREBP-1, could be activated by low salinity, which further promoted the expression of downstream target gene (<italic>elovl6</italic>) for synthesizing suitable fatty acids to maintain membrane fluidity. In addition, the starvation group exhibited lower expression of <italic>srebp-1</italic>, <italic>elovl6a</italic>, <italic>elovl6b</italic> and <italic>elovl6c</italic> than the feeding group. It could be speculated that more fatty acids are preferentially used for providing energy rather than synthesis when food is scarce, therefore three <italic>elovl6</italic> showed lower expression levels. Furthermore, the hepatopancreas was more sensitive to starvation stress than the muscle, and this was related to the hepatopancreas as a center of lipid metabolism.</p>
<p>In conclusion, the three <italic>elovl6</italic> cDNA sequences of <italic>S. paramamosain</italic> were isolated in the present study, and the deduced amino acids exhibited the typical structural features of ELOVL protein family members. The results of tissue distribution indicated that the <italic>elovl6a</italic> and <italic>elovl6c</italic> highly expressed in the hepatopancreas, while the relatively abundant expression of <italic>elovl6b</italic> was observed in intestine and stomach. In addition, the dietary fatty acids and ambient salinity significantly increases the transcriptional levels of three <italic>elovl6</italic>, and starvation stress could inhibit three <italic>elovl6</italic> expression. These results may contribute to understand functions of <italic>elovl6</italic> in fatty acid synthesis and regulatory mechanisms in crustaceans.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The sequences of elovl6a, elovl6b and elovl6c were submitted to GenBank (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/">https://www.ncbi.nlm.nih.gov/</ext-link>) with the accession numbers MF784574, OQ863017 and OQ863018, respectively.</p>
</sec>
<sec id="s6">
<title>Ethics statement</title>
<p>The protocols of using animals in this study were approved by the Committee on the Ethics of Animal Experiments of Ningde Normal University.</p>
</sec>
<sec id="s7">
<title>Author contributions</title>
<p>ZL, WH, KH, and SR conceived this research and designed the experiments; ZL wrote and revised the manuscript; ZL, ZW, CH, HL, MZ, and MC performed experiments. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8">
<title>Funding</title>
<p>This study was aid financially by the Natural Science Foundation of Fujian Province, China (Grant number 2022J05273) and Scientific Research Foundation of Ningde Normal University (Grant number 2022Y04).</p>
</sec>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s10">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11">
<title>Supplementary material</title>
<p>The supplementary material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fphys.2023.1221205/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fphys.2023.1221205/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table1.DOCX" id="SM1" mimetype="application/DOCX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table2.DOCX" id="SM2" mimetype="application/DOCX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table3.DOCX" id="SM3" mimetype="application/DOCX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table4.DOCX" id="SM4" mimetype="application/DOCX" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bae</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Oh</surname>
<given-names>A. R.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Ahn</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Cha</surname>
<given-names>J. Y.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Hepatic Elovl6 gene expression is regulated by the synergistic action of ChREBP and SREBP-1c</article-title>. <source>Biochem. Bioph Res. Co.</source> <volume>478</volume>, <fpage>1060</fpage>&#x2013;<lpage>1066</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2016.08.061</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bell</surname>
<given-names>M. V.</given-names>
</name>
<name>
<surname>Dick</surname>
<given-names>J. R.</given-names>
</name>
<name>
<surname>Porter</surname>
<given-names>A. E.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Pyloric ceca are significant sites of newly synthesized 22:6n-3 in rainbow trout (<italic>Oncorhynchus mykiss</italic>)</article-title>. <source>Lipids</source> <volume>38</volume>, <fpage>39</fpage>&#x2013;<lpage>44</lpage>. <pub-id pub-id-type="doi">10.1007/s11745-003-1029-5</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castro</surname>
<given-names>L. F.</given-names>
</name>
<name>
<surname>Tocher</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Monroig</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire</article-title>. <source>Prog. Lipid Res.</source> <volume>62</volume>, <fpage>25</fpage>&#x2013;<lpage>40</lpage>. <pub-id pub-id-type="doi">10.1016/j.plipres.2016.01.001</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Molecular characterization of elongase of very long-chain fatty acids 6 (elovl6) genes in <italic>Misgurnus anguillicaudatus</italic> and their potential roles in adaptation to cold temperature</article-title>. <source>Gene</source> <volume>666</volume>, <fpage>134</fpage>&#x2013;<lpage>144</lpage>. <pub-id pub-id-type="doi">10.1016/j.gene.2018.05.019</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="book">
<collab>China Fishery Statistical Yearbook</collab> (<year>2022</year>). <source>China Fishery statistical Yearbook</source>. <publisher-loc>Beijing, China</publisher-loc>: <publisher-name>China Agriculture Press</publisher-name>, <fpage>28</fpage>.</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ducheix</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lobaccaro</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>P. G.</given-names>
</name>
<name>
<surname>Guillou</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Liver X receptor: An oxysterol sensor and a major player in the control of lipogenesis</article-title>. <source>Chem. Phys. Lipids</source> <volume>164</volume>, <fpage>500</fpage>&#x2013;<lpage>514</lpage>. <pub-id pub-id-type="doi">10.1016/j.chemphyslip.2011.06.004</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Green</surname>
<given-names>C. D.</given-names>
</name>
<name>
<surname>Ozguden-Akkoc</surname>
<given-names>C. G.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jump</surname>
<given-names>D. B.</given-names>
</name>
<name>
<surname>Olson</surname>
<given-names>L. K.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Role of fatty acid elongases in determination of de novo synthesized monounsaturated fatty acid species</article-title>. <source>J. Lipid Res.</source> <volume>51</volume>, <fpage>1871</fpage>&#x2013;<lpage>1877</lpage>. <pub-id pub-id-type="doi">10.1194/jlr.M004747</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guillou</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zadravec</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>P. G.</given-names>
</name>
<name>
<surname>Jacobsson</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice</article-title>. <source>Prog. Lipid Res.</source> <volume>49</volume>, <fpage>186</fpage>&#x2013;<lpage>199</lpage>. <pub-id pub-id-type="doi">10.1016/j.plipres.2009.12.002</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Rong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Sterol regulatory element binding protein-1: Molecular cloning, tissue distribution and gene expression level in response to nutritional regulation in mud crab, <italic>Scylla paramamosain</italic>
</article-title>. <source>Biochem. Bioph Res. Co.</source> <volume>505</volume>, <fpage>705</fpage>&#x2013;<lpage>711</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2018.09.154</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jakobsson</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Westerberg</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Jacobsson</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Fatty acid elongases in mammals: Their regulation and roles in metabolism</article-title>. <source>Prog. Lipid Res.</source> <volume>45</volume>, <fpage>237</fpage>&#x2013;<lpage>249</lpage>. <pub-id pub-id-type="doi">10.1016/j.plipres.2006.01.004</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumadaki</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Matsuzaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kato</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yahagi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Okada</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2008</year>). <article-title>Mouse Elovl6 promoter is an SREBP target</article-title>. <source>Biochem. Bioph Res. Co.</source> <volume>368</volume>, <fpage>261</fpage>&#x2013;<lpage>266</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2008.01.075</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leroux</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Bernard</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Faulconnier</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Rouel</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>de la Foye</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Domagalski</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Bovine mammary nutrigenomics and changes in the milk composition due to rapeseed or sunflower oil supplementation of high-forage or high-concentrate diets</article-title>. <source>J. Nutr. Nutr.</source> <volume>9</volume>, <fpage>65</fpage>&#x2013;<lpage>82</lpage>. <pub-id pub-id-type="doi">10.1159/000445996</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Pang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xiang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mai</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ai</surname>
<given-names>Q.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Molecular cloning, characterization, and nutritional regulation of Elovl6 in large yellow croaker (<italic>Larimichthys crocea</italic>)</article-title>. <source>Int. J. Mol. Sci.</source> <volume>20</volume>, <fpage>1801</fpage>. <pub-id pub-id-type="doi">10.3390/ijms20071801</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Pang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Xiang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Mai</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ai</surname>
<given-names>Q.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Molecular Characterization, nutritional and insulin regulation of Elovl6 in rainbow trout (<italic>Oncorhynchus mykiss</italic>)</article-title>. <source>Biomolecules</source> <volume>10</volume> (<issue>2</issue>), <fpage>264</fpage>. <pub-id pub-id-type="doi">10.3390/biom10020264</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zou</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Rong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Cloning, tissue distribution and nutritional regulation of a fatty acyl Elovl4-like elongase in mud crab, <italic>Scylla paramamosain</italic> (Estampador, 1949)</article-title>. <source>Comp. Biochem. Phys. B</source> <volume>217</volume>, <fpage>70</fpage>&#x2013;<lpage>78</lpage>. <pub-id pub-id-type="doi">10.1016/j.cbpb.2017.12.010</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Molecular cloning, mRNA expression and nutritional regulation of a delta6 fatty acyl desaturase-like gene of mud crab, <italic>Scylla paramamosain</italic>
</article-title>. <source>Comp. Biochem. Phys. B</source> <volume>208</volume>, <fpage>29</fpage>&#x2013;<lpage>37</lpage>. <pub-id pub-id-type="doi">10.1016/j.cbpb.2017.03.004</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname>
<given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuzaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Shimano</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Elovl6: A new player in fatty acid metabolism and insulin sensitivity</article-title>. <source>J. Mol. Med.</source> <volume>87</volume>, <fpage>379</fpage>&#x2013;<lpage>384</lpage>. <pub-id pub-id-type="doi">10.1007/s00109-009-0449-0</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuzaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Shimano</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yahagi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Kato</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Atsumi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>Crucial role of a long-chain fatty acid elongase, Elovl6, in obesity-induced insulin resistance</article-title>. <source>Nat. Med.</source> <volume>13</volume>, <fpage>1193</fpage>&#x2013;<lpage>1202</lpage>. <pub-id pub-id-type="doi">10.1038/nm1662</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuzaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Shimano</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yahagi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Yoshikawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Amemiya-Kudo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hasty</surname>
<given-names>A. H.</given-names>
</name>
<etal/>
</person-group> (<year>2002</year>). <article-title>Cloning and characterization of a mammalian fatty acyl-CoA elongase as a lipogenic enzyme regulated by SREBPs</article-title>. <source>J. Lipid Res.</source> <volume>43</volume>, <fpage>911</fpage>&#x2013;<lpage>920</lpage>. <pub-id pub-id-type="doi">10.1016/s0022-2275(20)30465-x</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moon</surname>
<given-names>Y. A.</given-names>
</name>
<name>
<surname>Shah</surname>
<given-names>N. A.</given-names>
</name>
<name>
<surname>Mohapatra</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Warrington</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Horton</surname>
<given-names>J. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Identification of a mammalian long chain fatty acyl elongase regulated by sterol regulatory element-binding proteins</article-title>. <source>J. Biol. Chem.</source> <volume>276</volume>, <fpage>45358</fpage>&#x2013;<lpage>45366</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M108413200</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Motoko</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Takashi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rie</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ryo</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Naoko</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hikari</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Absence of Elovl6 attenuates steatohepatitis but promotes gallstone formation in a lithogenic diet-fed Ldlr(-/-) mouse model</article-title>. <source>Sci. Rep-UK</source> <volume>5</volume>, <fpage>17604</fpage>. <pub-id pub-id-type="doi">10.1038/srep17604</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakamura</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Matsuzaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Tahara-Hanaoka</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Shibuya</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Shimano</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nakahashi-Oda</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Elovl6 regulates mechanical damage-induced keratinocyte death and skin inflammation</article-title>. <source>Cell Death Dis.</source> <volume>9</volume>, <fpage>1181</fpage>. <pub-id pub-id-type="doi">10.1038/s41419-018-1226-1</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saito</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Matsuzaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Karasawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Sekiya</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Okada</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Igarashi</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Macrophage Elovl6 deficiency ameliorates foam cell formation and reduces atherosclerosis in low-density lipoprotein receptor-deficient mice</article-title>. <source>Arter. Throm Vas</source> <volume>31</volume>, <fpage>1973</fpage>&#x2013;<lpage>1979</lpage>. <pub-id pub-id-type="doi">10.1161/ATVBAHA.110.221663</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname>
<given-names>H. B.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>D. W.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Fatty acid elongase 6 plays a role in the synthesis of long-chain fatty acids in goat mammary epithelial cells</article-title>. <source>J. Dairy Sci.</source> <volume>100</volume>, <fpage>4987</fpage>&#x2013;<lpage>4995</lpage>. <pub-id pub-id-type="doi">10.3168/jds.2016-12159</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname>
<given-names>Q. Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. G.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Q. Q.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>Y. X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>B. H.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Full-length cDNA cloning of Elovl6 and its tentative study in Chinese mitten crab (<italic>Eriocheir sinensis</italic>)</article-title>. <source>J. Fish. China.</source> <volume>40</volume>, <fpage>844</fpage>&#x2013;<lpage>855</lpage>. <pub-id pub-id-type="doi">10.11964/jfc.2015121019</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Su</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H. T.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y. S.</given-names>
</name>
<name>
<surname>Tung</surname>
<given-names>C. L.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Elovl6 is a negative clinical predictor for liver cancer and knockdown of Elovl6 reduces murine liver cancer progression</article-title>. <source>Sci. Rep-UK</source> <volume>8</volume>, <fpage>6586</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-018-24633-3</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Piao</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>The effect of LXR&#x3b1;, ChREBP and Elovl6 in liver and white adipose tissue on medium- and long-chain fatty acid diet-induced insulin resistance</article-title>. <source>Diabetes Res. Clin. P. R.</source> <volume>102</volume>, <fpage>183</fpage>&#x2013;<lpage>192</lpage>. <pub-id pub-id-type="doi">10.1016/j.diabres.2013.10.010</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takashi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ayaka</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rie</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Haruna</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Noriko</surname>
<given-names>S. K.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Elovl6 promotes nonalcoholic steatohepatitis</article-title>. <source>Hepatology</source> <volume>56</volume>, <fpage>2199</fpage>&#x2013;<lpage>2208</lpage>. <pub-id pub-id-type="doi">10.1002/hep.25932</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tan</surname>
<given-names>C. Y.</given-names>
</name>
<name>
<surname>Virtue</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bidault</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Dale</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hagen</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Griffin</surname>
<given-names>J. L.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Brown adipose tissue thermogenic capacity is regulated by Elovl6</article-title>. <source>Cell Rep.</source> <volume>13</volume>, <fpage>2039</fpage>&#x2013;<lpage>2047</lpage>. <pub-id pub-id-type="doi">10.1016/j.celrep.2015.11.004</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tian</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Effects of dietary soluble &#x3b2;-1, 3-glucan on the growth performance, antioxidant status, and immune response of the river prawn (<italic>Macrobrachium nipponense</italic>)</article-title>. <source>Fish. Shellfish Immun.</source> <volume>138</volume>, <fpage>108848</fpage>. <pub-id pub-id-type="doi">10.1016/j.fsi.2023.108848</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tocher</surname>
<given-names>D. R.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Omega-3 long-chain polyunsaturated fatty acids and aquaculture in perspective</article-title>. <source>Aquaculture</source> <volume>449</volume>, <fpage>94</fpage>&#x2013;<lpage>107</lpage>. <pub-id pub-id-type="doi">10.1016/j.aquaculture.2015.01.010</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wen</surname>
<given-names>X. B.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L. Q.</given-names>
</name>
<name>
<surname>Ai</surname>
<given-names>C. X.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>H. B.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Variation in lipid composition of Chinese mitten-handed crab, <italic>Eriocheir sinensis</italic> during ovarian maturation</article-title>. <source>Comp. Biochem. Phys. B</source> <volume>130</volume> (<issue>1</issue>), <fpage>95</fpage>&#x2013;<lpage>104</lpage>. <pub-id pub-id-type="doi">10.1016/s1096-4959(01)00411-0</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>You</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Monroig</surname>
<given-names>O.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Regulation of long-chain polyunsaturated fatty acid biosynthesis in teleost fish</article-title>. <source>Prog. Lipid Res.</source> <volume>82</volume>, <fpage>101095</fpage>. <pub-id pub-id-type="doi">10.1016/j.plipres.2021.101095</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ye</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Tao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Experimental nursery culture of the mud crab <italic>Scylla paramamosain</italic> (Estampador) in China</article-title>. <source>Aquacult Int.</source> <volume>19</volume>, <fpage>313</fpage>&#x2013;<lpage>321</lpage>. <pub-id pub-id-type="doi">10.1007/s10499-010-9399-3</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Matsuzaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Nakano</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Motomura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Yokoo</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Elovl6 deficiency improves glycemic control in diabetic db/db mice by expanding &#x3b2;-cell mass and increasing insulin secretory capacity</article-title>. <source>Diabetes</source> <volume>66</volume> (<issue>7</issue>), <fpage>1833</fpage>&#x2013;<lpage>1846</lpage>. <pub-id pub-id-type="doi">10.2337/db16-1277</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>