<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Physiol.</journal-id>
<journal-title>Frontiers in Physiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Physiol.</abbrev-journal-title>
<issn pub-type="epub">1664-042X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">857239</article-id>
<article-id pub-id-type="doi">10.3389/fphys.2022.857239</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Physiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Insulin-Like <italic>ILP2</italic> Regulates Trehalose Metabolism to Tolerate Hypoxia/Hypercapnia in <italic>Tribolium castaneum</italic>
</article-title>
<alt-title alt-title-type="left-running-head">Wang et al.</alt-title>
<alt-title alt-title-type="right-running-head">New Idea in Pest Control</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Yuan-Yuan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="fn" rid="fn1">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Xin-Yu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="fn" rid="fn1">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mu</surname>
<given-names>Xue-Rui</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Xian</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhou</surname>
<given-names>Min</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Song</surname>
<given-names>Yue-Hua</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1135970/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Kang-Kang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/692818/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Can</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/620255/overview"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Guizhou Provincial Key Laboratory for Rare Animal and Economic Insect of the Mountainous Region</institution>, <institution>College of Biology and Environmental Engineering</institution>, <institution>Guiyang University</institution>, <addr-line>Guiyang</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Institute of South China Karst</institution>, <institution>Guizhou Normal University</institution>, <addr-line>Guiyang</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/446228/overview">Peng He</ext-link>, Guizhou University, China</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/594252/overview">Bimalendu B. Nath</ext-link>, Savitribai Phule Pune University, India</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1160406/overview">Kai Liu</ext-link>, Zhongkai University of Agriculture and Engineering, China</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Can Li, <email>lican790108@163.com</email>
</corresp>
<fn fn-type="equal" id="fn1">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this work and share first authorship</p>
</fn>
<fn fn-type="other">
<p>This article was submitted to Invertebrate Physiology, a section of the journal Frontiers in Physiology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>20</day>
<month>04</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>13</volume>
<elocation-id>857239</elocation-id>
<history>
<date date-type="received">
<day>18</day>
<month>01</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>21</day>
<month>03</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Wang, Zhang, Mu, Li, Zhou, Song, Xu and Li.</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Wang, Zhang, Mu, Li, Zhou, Song, Xu and Li</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>RNAi was used to downregulate the expression of insulin-like peptides (<italic>ILP2</italic>), with air-modulation, and high-concentration CO<sub>2</sub> stress, in the larvae of <italic>Tribolium castaneum</italic>. We assessed the changes in carbohydrate-related content, trehalase activity, and the expression levels of trehalose pathway genes. And pupation, adult emergence, pupation rate, and mortality were assessed. There was a significant change in the expression of <italic>ILPs</italic> in <italic>T. castaneum</italic>, at a certain concentration of CO<sub>2</sub>. <italic>ILP2</italic> RNAi did not alter the trehalose content significantly, however, the glycogen and glucose content increased significantly. High-concentration CO<sub>2</sub> stress altered the trehalose content and reduced the glycogen and glucose content. The expression levels of <italic>TPS</italic> and <italic>TRE2</italic> were up-regulated by hypoxia/hypercapnia and <italic>dsILP2</italic> combination, with the increase of CO<sub>2</sub> concentration, other trehalase genes begin to respond successively. <italic>ILP2</italic> knockout raised the mortality and reduced the pupation rate and eclosion rate in CO<sub>2</sub>. Understanding the insulin pathway responses to hypoxic stress induced by a high concentration of CO<sub>2</sub> would further elucidate the mechanisms underlying trehalose metabolism in insects.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Tribolium castaneum</italic>
</kwd>
<kwd>insulin pathway</kwd>
<kwd>carbon dioxide induced hypoxia stress</kwd>
<kwd>
<italic>ILP2</italic>
</kwd>
<kwd>trehalose metabolism</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>The red flour beetle, <italic>Tribolium castaneum</italic> (Herbst) is a coleopteran belonging to the family, Tenebrionidae. It is distributed in the warmer regions and is an extremely important universal pest of stored grains (<xref ref-type="bibr" rid="B44">Shelby, 1977</xref>; <xref ref-type="bibr" rid="B6">Campbell et al., 2010</xref>; <xref ref-type="bibr" rid="B49">Wei, 2013</xref>). It damages a variety of commodities (such as flour, beans, nuts, Chinese medicinal materials, even meat) and causes tremendous economic losses, because of its fast reproduction, long life span, complex eating habits, and strong adaptability. When the population density of pest is high, <italic>T. castaneum</italic> chestnut secretes benzoquinones, which imparts a pungent odor to the commodity that render it unfit for consumption (<xref ref-type="bibr" rid="B5">Campbell and Runnion, 2003</xref>). <italic>T. castaneum</italic> in stored products and grain is primarily controlled using fumigants and sprays, but long-term use has resulted in the emergence of resistant populations (<xref ref-type="bibr" rid="B41">Pimentel et al., 2010</xref>; <xref ref-type="bibr" rid="B3">Boyer et al., 2012</xref>; <xref ref-type="bibr" rid="B38">Opit et al., 2012</xref>; <xref ref-type="bibr" rid="B40">Perkin and Oppert, 2019</xref>). Furthermore, usage of insecticides on food is a concerned due to the safe of human health and environment would expose to harm. Therefore, it is essential to identify new and effective methods to control <italic>T. castaneum</italic>.</p>
<p>Hermetic storage technology, a chemical-free approach, is used to protect stored grains and pulses against insect pests (<xref ref-type="bibr" rid="B26">Kharel et al., 2019</xref>). Although some grain-feeding insects were control by air-tight packaging successfully, a number of storage pests show remarkable air resistance to hypoxia, including <italic>T. castaneum</italic> and <italic>Callosobruchus maculatus</italic>, can survive days of low oxygen treatment (<xref ref-type="bibr" rid="B24">Hoback and Stanley, 2001</xref>; <xref ref-type="bibr" rid="B15">Chi et al., 2011</xref>), which means hypoxia alone is not enough. Oxidative injury can be induced by too low O<sub>2</sub> level in organisms which result in morbidity and mortality, whereas CO<sub>2</sub> toxicity raises in a concentration-dependent manner (<xref ref-type="bibr" rid="B7">Cao et al., 2015a</xref>,<xref ref-type="bibr" rid="B9">b</xref>), Several studies have looked at less than 3% oxygen or more than 60% carbon dioxide is effective in controlling most eggs and adults of storage pests (<xref ref-type="bibr" rid="B43">Sauer and Shelton, 2002</xref>; <xref ref-type="bibr" rid="B36">Navarro, 2006</xref>; <xref ref-type="bibr" rid="B1">Azzam et al., 2010</xref>; <xref ref-type="bibr" rid="B26">Kharel et al., 2019</xref>). As a consequence, a modified atmospheres with depleted O<sub>2</sub> accompanied by elevated CO<sub>2</sub> maybe can control stored grain insect pests effectively, become an environmentally friendly alternative to fumigants, it can be used for gas controlled grain storage in the warehouses. (<xref ref-type="bibr" rid="B13">Cheng et al., 2012</xref>). This inhibits insect respiration, therefore, controls insect pests and enables green grain storage.</p>
<p>Trehalose is the most important carbohydrate in the insect hemolymph, accounting for 80&#x2013;90% of the total insect hemolymph sugar, and is therefore, called the &#x201c;blood sugar&#x201d; of insects (<xref ref-type="bibr" rid="B19">Elbein et al., 2003</xref>; <xref ref-type="bibr" rid="B10">Chen et al., 2010</xref>). The trehalose concentration in the hemolymph is not regulated by a steady state in its body, but by a stress metabolite. A drastic change in the nutritional status or the external environment induces changes in the trehalose concentration in the hemolymph, for adapting to the environment and enabling growth (<xref ref-type="bibr" rid="B55">Zhu et al., 2018</xref>). It has been reported that trehalose protects <italic>Drosophila</italic> and mammalian cells from hypoxia and anoxic injury (<xref ref-type="bibr" rid="B11">Chen et al., 2003</xref>). Trehalose-6-phosphate synthase (TPS), which synthesize trehalose, is essential for insect growth and development, and overexpression of TPS increases trehalose levels and insect pest tolerance to anoxic (<xref ref-type="bibr" rid="B11">Chen et al., 2003</xref>; <xref ref-type="bibr" rid="B12">Chen et al., 2018</xref>). Trehalose plays a very important role in the physiological life activities and dealing with abiotic stresses of insects, one of the key regulatory hormones is insulin (<xref ref-type="bibr" rid="B52">Yu et al., 2008</xref>; <xref ref-type="bibr" rid="B45">Shukla et al., 2015</xref>; <xref ref-type="bibr" rid="B47">Tang et al., 2018</xref>). In insects, the insulin/insulin-like growth factor signaling (IIS) pathway regulates carbohydrate and lipid metabolism and it associate with trehalose. Insulin is responsible for lowering blood sugar and promotes synthesis of glycogen, fat, and protein. Multiple insulin-like peptides (ILPs) and a single insulin receptor (InR), in coordination with the other pathways, control the physiological activities in different tissues (<xref ref-type="bibr" rid="B22">He, 2015</xref>). Among of them, ILPs are a crucial controller of carbohydrate reserve depletion in insects. ILPs are involved in the regulation of hemolymph trehalose levels in various insects (<xref ref-type="bibr" rid="B42">Satake et al., 1997</xref>; <xref ref-type="bibr" rid="B4">Broughton et al., 2005</xref>; <xref ref-type="bibr" rid="B50">Xu et al., 2013</xref>). <italic>ILP2</italic> has been proven that regulate carbohydrate, protein, and lipid metabolism during starvation (<xref ref-type="bibr" rid="B50">Xu et al., 2013</xref>; <xref ref-type="bibr" rid="B25">Hun et al., 2019</xref>), so we chose to interfere with <italic>ILP2</italic> for research.</p>
<p>High carbon dioxide concentration being toxic to insects while also can effectively control most storage pests (<xref ref-type="bibr" rid="B8">Cao et al., 2019</xref>). It is an indisputable fact that changes in trehalose levels can help insects acclimatize to adverse environments, however, whether <italic>ILP2</italic> could counteract hypoxia/hypercapnia by regulating trehalose metabolism have rarely been reported. <italic>T. castaneum</italic> is a model insect used for genetic research, which has the most complete sequenced and annotated genome, thus providing the most advanced genetic model of coleopteran pests (<xref ref-type="bibr" rid="B32">Lorenzen et al., 2007</xref>). In our study, hypoxia stress induced by hypoxia/hypercapnia and combined with RNAi of <italic>ILP2</italic> were assessed for its effects on trehalose metabolism.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and Methods</title>
<sec id="s2-1">
<title>Insect Culture</title>
<p>The <italic>T. castaneum,</italic> continuously bred in the laboratory on whole wheat flour containing 5% yeast in an incubator at 28 &#xb1; 1&#xb0;C and 65 &#xb1; 5% relative humidity under a constant 24&#xa0;h dark (0L:24D). The <italic>T. castaneum</italic> were treated with 25% CO<sub>2</sub> &#x2b; 75% air, 50% CO<sub>2</sub> &#x2b; 50% air, 75% CO<sub>2</sub> &#x2b; 25% air and 95% CO<sub>2</sub> &#x2b; 5% air. The group treated with normal concentration of CO<sub>2</sub> was the control group (CK). <italic>T. castaneum</italic> on the first day of eighth instar larvae were cultured under different levels of CO<sub>2</sub> for 48&#xa0;h and assay <italic>ILP</italic> genes (<italic>ILP1</italic>, <italic>ILP2</italic>, <italic>ILP3</italic> and <italic>ILP4</italic>) relative expression (<xref ref-type="bibr" rid="B39">Pan et al., 2020</xref>). <italic>T. castaneum</italic> on the first day of the eighth instar larvae was used in this study.</p>
</sec>
<sec id="s2-2">
<title>Injection of dsRNA and Samples Collection</title>
<p>Premier 5.0 software was used to design specific dsRNA primers for <italic>TcILP2</italic>, following homologous alignment, and the production was cloned using T cloning, that dsRNA was synthesized using primers containing T7 promoter sequences, and the control <italic>dsGFP</italic> was synthesized similarly. <italic>dsILP2</italic> or <italic>dsGFP</italic> (200&#xa0;ng of each) was injected into the soft part between the third and fourth abdominal segments of <italic>T. castaneum</italic> on the first day of eighth instar larvae. The larvae were collected 48&#xa0;h after dsRNA (<italic>dsILP2</italic> or <italic>dsGFP</italic>) injection combined with different concentration CO<sub>2</sub> treatment, and stored at &#x2212;80&#xb0;C. Fifteen insects each were used for the analysis of interferent-effect of dsRNA, gene expression, sugar content, and activity of the enzymes in the glucose metabolism pathways. All assays were performed in triplicate.</p>
<p>The mortality observed within 24&#xa0;h of the injection was recorded as mechanical death. The mortality after 48&#xa0;h of processing, the pupal rate, and the emergence rate were recorded.</p>
</sec>
<sec id="s2-3">
<title>Total RNA Extraction and First Strand cDNA Synthesis</title>
<p>Total RNA was isolated from each sample by using the MiniBEST Universal Extraction Kit (TaKaRa, Dalian, China), following the manufacturer&#x2019;s instructions. The RNA integrity was verified by 1% agarose gel electrophoresis, and the RNA concentration was measured by a NanoDrop2000 spectrophotometer (Thermo Scientific, Waltham, MA, United States). First-strand complementary DNA (cDNA) synthesis was performed using the PrimeScript&#xae; RT Reagent Kit (TaKaRa, Dalian, China) following manufacturer&#x2019;s instructions.</p>
</sec>
<sec id="s2-4">
<title>Quantitative Real-Time Polymerase Chain Reaction</title>
<p>The relative expression levels of <italic>TcILP2</italic> were assessed using qRT-PCR. The insects from each treatment were collected 48&#xa0;h after dsRNA injection, for assessing the efficiency of the RNAi, using qPCR. Following <italic>TcILP2</italic> knockdown under different concentrations of CO<sub>2</sub>, the transcript levels of six genes pertaining to the trehalose metabolic pathway, including five trehalase genes (<italic>TcTre1-1</italic>, <italic>TcTre1-2</italic>, <italic>TcTre1-3</italic>, <italic>TcTre1-4</italic>, and <italic>TcTre2</italic>) and trehalose-6-phosphate synthase gene (<italic>TcTPS</italic>), were analyzed. The qPCR was carried out on a CFX-96 real-time detection system (Bio-Rad, Hercules, CA, United States) in a 20&#xa0;&#xb5;L reaction containing 1&#xa0;&#xb5;L (100&#xa0;ng/&#x3bc;L) cDNA, 1&#xa0;&#xb5;L (10&#xa0;&#xb5;M) of each primer, 7&#xa0;&#xb5;L nuclease-free water, and 10&#xa0;&#xb5;L of GoTaq qPCR MasterMix (Promega). The reaction was performed under the following conditions: pre-incubation at 95&#xb0;C for 2&#xa0;min, followed by 40 cycles of 95&#xb0;C for 30&#xa0;s and annealing at 60&#xb0;C for 30&#xa0;s, with melting curves obtained at 65&#x2013;95&#xb0;C. Ribosomal protein L13a (RPL13a) was the internal control. Specific primers shown in <xref ref-type="table" rid="T1">Table 1</xref>. The experiments were performed in triplicate, with three technical replicates each. Relative gene expression was analyzed using the 2<sup>&#x2212;&#x25b3;&#x25b3;CT</sup> method (<xref ref-type="bibr" rid="B31">Livak and Schmittgen, 2001</xref>).</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primers used in this study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Application of Primers</th>
<th align="center">Gene</th>
<th align="center">Primer sequence (5&#x2032;&#x2013;3&#x2032;)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="10" align="left">qPCR analysis</td>
<td align="left">
<italic>TcILP1</italic>
</td>
<td align="left">F: CTG&#x200b;GTC&#x200b;TTC&#x200b;ACC&#x200b;GCA&#x200b;CAT, R: GAG&#x200b;GAC&#x200b;CAG&#x200b;AGT&#x200b;TGG&#x200b;GAT&#x200b;T</td>
</tr>
<tr>
<td align="left">
<italic>TcILP2</italic>
</td>
<td align="left">F:GCTGTCCACGGTATGCA, R: GAAGGAAGCGTCGTGGT</td>
</tr>
<tr>
<td align="left">
<italic>TcILP3</italic>
</td>
<td align="left">F: CGGCAAATAGTGGACGA, R: CATTCATAATCCGGTGCC</td>
</tr>
<tr>
<td align="left">
<italic>TcILP4</italic>
</td>
<td align="left">F: TTTGTACTGGGCTTGCG, R: GGA&#x200b;AGA&#x200b;ATA&#x200b;CGC&#x200b;CGA&#x200b;ATA&#x200b;C</td>
</tr>
<tr>
<td align="left">
<italic>TcTRE1-1</italic>
</td>
<td align="left">F: AAC&#x200b;CAA&#x200b;ACA&#x200b;CTC&#x200b;ACT&#x200b;CAT&#x200b;TCC, R: AAT&#x200b;CCA&#x200b;ATA&#x200b;AGT&#x200b;GTC&#x200b;CCA&#x200b;GTA&#x200b;G</td>
</tr>
<tr>
<td align="left">
<italic>TcTRE1-2</italic>
</td>
<td align="left">F: GAA&#x200b;GTA&#x200b;TCG&#x200b;GTT&#x200b;GGC&#x200b;TCG, R:GAGTGGGGTTGATTGTGC</td>
</tr>
<tr>
<td align="left">
<italic>TcTRE1-3</italic>
</td>
<td align="left">F: CTT&#x200b;GAA&#x200b;CGC&#x200b;CTT&#x200b;CCT&#x200b;CTG, R: CCA&#x200b;TCC&#x200b;TCG&#x200b;TGG&#x200b;TCA&#x200b;TAA&#x200b;A</td>
</tr>
<tr>
<td align="left">
<italic>TcTRE1-4</italic>
</td>
<td align="left">F:CTACCTAAACCGCTCCCA, R: TGT&#x200b;CCA&#x200b;GCC&#x200b;AGT&#x200b;ACC&#x200b;TCA&#x200b;G</td>
</tr>
<tr>
<td align="left">
<italic>TRE2</italic>
</td>
<td align="left">F: TGT&#x200b;TGT&#x200b;GCG&#x200b;TTT&#x200b;GTG&#x200b;CTC, R: GGA&#x200b;CGG&#x200b;CTT&#x200b;ATT&#x200b;GTT&#x200b;GTT&#x200b;TA</td>
</tr>
<tr>
<td align="left">
<italic>TPS</italic>
</td>
<td align="left">F: GAT&#x200b;TCG&#x200b;CTA&#x200b;CAT&#x200b;TTA&#x200b;CGG&#x200b;G, R: GAA&#x200b;CGG&#x200b;AGA&#x200b;CAC&#x200b;TAT&#x200b;GAG&#x200b;GAC</td>
</tr>
<tr>
<td rowspan="2" align="left">dsRNA synthesis</td>
<td align="left">ds<italic>ILP2</italic>
</td>
<td align="left">F: AGG&#x200b;CAA&#x200b;TTA&#x200b;CAA&#x200b;CAC&#x200b;GCT&#x200b;C, R:GTTCTTCCAGTGAACAGGGT</td>
</tr>
<tr>
<td align="left">ds<italic>GFP</italic>
</td>
<td align="left">F: TAA&#x200b;TAC&#x200b;GAC&#x200b;TCA&#x200b;CTA&#x200b;TAG&#x200b;GGC&#x200b;AGT&#x200b;TCT&#x200b;TGT&#x200b;GAA&#x200b;TTA&#x200b;GAT, R: TAA&#x200b;TAC&#x200b;GAC&#x200b;TCA&#x200b;CTA&#x200b;TAG&#x200b;GGA&#x200b;ATG&#x200b;TTA&#x200b;CCA&#x200b;TCT&#x200b;TCT&#x200b;TTA&#x200b;A</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-5">
<title>Trehalase Activity and Sugar Content Following RNAi Combined With High Concentration CO<sub>2</sub> Treatment</title>
<p>Following the dsRNA injection, the insects were cultured under different levels of CO<sub>2</sub>, and the samples were collected. <italic>T. castaneum</italic> samples were homogenized through ultrasonication, mixed using centrifugation, and suspended in PBS. The concentrations of glucose, trehalose, and glycogen were evaluated, the activities of soluble trehalase and membrane-bound trehalase were detected using absorption/emission at different wavelengths. Standard glucose curve and trehalase activity curve were prepared according to the kit instructions (Sigma-Aldrich, St. Louis, MO, United States). Trehalose was quantified using the anthrone-sulfuric acid method (<xref ref-type="bibr" rid="B28">Leyva et al., 2008</xref>). Glucose and glycogen content were quantified, as described previously (<xref ref-type="bibr" rid="B54">Zhang et al., 2017</xref>).</p>
</sec>
<sec id="s2-6">
<title>Statistical Analyses</title>
<p>Analyses were carried out with SPSS Statistics 21 software (IBM Japan). Bars represent mean &#xb1; standard error (SE). Data were statistically evaluated using the unpaired two-tailed Student&#x2019;s t test for two groups, and values were considered statistically significant when <italic>p</italic> &#x3c; 0.05.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>The Expression of Insulin Pathway-Related Genes After High-Concentration CO<sub>2</sub> Treatment for 48&#xa0;h and the Different Expression of <italic>TcILP2</italic> Gene of <italic>T. castaneum</italic> After RNAi</title>
<p>High concentration of CO<sub>2</sub> stress influenced the expression of the insulin pathway genes. The expression of <italic>TcILP1</italic> was upregulated in 25% CO<sub>2</sub> &#x2b; 75% air group and 95% CO<sub>2</sub> &#x2b; 5% air, <italic>TcILP2</italic> was upregulated in 25% CO<sub>2</sub> &#x2b; 75% air group, and <italic>TcILP3</italic> was upregulated in 25% CO<sub>2</sub> &#x2b; 75% air group, while that of <italic>TcILP4</italic> was downregulated in 50% CO<sub>2</sub> &#x2b; 50% air group (<xref ref-type="fig" rid="F1">Figure 1A</xref>). The relative expression levels of <italic>TcILP2</italic> in response to RNAi were detected using qPCR. The expression of <italic>TcILP2</italic> gene was downregulated in CK group after RNAi, indicating that dsRNA successfully inhibited the expression of the target gene, <italic>TcILP2</italic>. When combined with high-concentration CO<sub>2</sub> stress treatment, highly expressed under the 25% CO<sub>2</sub> &#x2b; 75% air treatment, while, <italic>TcILP2</italic> was significantly inhibited under other concentrations of CO<sub>2</sub> (<xref ref-type="fig" rid="F1">Figure 1B</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Relative expression of <italic>TcILP</italic> in different concentration CO<sub>2</sub> treatment <bold>(A)</bold> and <italic>TcILP2</italic> <bold>(B)</bold> detection of RNAi interference effect after normal concentration and high concentration CO<sub>2</sub> respectively. <italic>T. castaneum</italic> larvae were divided into three groups (each group covered 10 larvae) and used to treat with 25% CO<sub>2</sub> &#x2b; 75% air, 50% CO<sub>2</sub> &#x2b; 50% air, 75% CO<sub>2</sub> &#x2b; 25% air and 95% CO<sub>2</sub> &#x2b; 5% air, respectively. Samples were collected for 48&#xa0;h treatment and mRNA expression level were detected by q-PCR. The mRNA level was normalized to that of TcRPL13a mRNA. Significant differences were identified by Student&#x2019;s t-test (<italic>p</italic> &#x3c; 0.05 was expressed by &#x2a;, <italic>p</italic> &#x3c; 0.01 was expressed by &#x2a;&#x2a;), the same below.</p>
</caption>
<graphic xlink:href="fphys-13-857239-g001.tif"/>
</fig>
</sec>
<sec id="s3-2">
<title>Effects of TcILP2 Knockdown Combined With Different Concentrations of CO<sub>2</sub> on the Content of Trehalose, Glucose, and Glycogen</title>
<p>Injection of <italic>dsILP2</italic> did not influence the trehalose content significantly (<xref ref-type="fig" rid="F2">Figure 2A</xref>), but the concentrations of glycogen and glucose increased significantly (<xref ref-type="fig" rid="F2">Figures 2B,C</xref>). When combined with the high-concentration CO<sub>2</sub> stress treatment, the concentrations of trehalose, glycogen, and glucose decreased, however, the changes in trehalose concentration were not significant, when compared with that in the <italic>dsGFP</italic> group.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Effects of <italic>TcILP2</italic> knockdown on content of trehalose <bold>(A)</bold>, glycogen <bold>(B)</bold>, and glucose <bold>(C)</bold>. <italic>T. castaneum</italic> larvae were divided into three groups (each group covered 15 larvae) and injected with dsILP2 and dsGFP and combined with treatments of 25% CO<sub>2</sub> &#x2b; 75% air, 50% CO<sub>2</sub> &#x2b; 50% air, 75% CO<sub>2</sub> &#x2b; 25% air and 95% CO<sub>2</sub> &#x2b; 5% air, respectively. Insects were collected and used to detect trehalose, glycogen, and glucose content after treatments for 48&#xa0;h.</p>
</caption>
<graphic xlink:href="fphys-13-857239-g002.tif"/>
</fig>
</sec>
<sec id="s3-3">
<title>Effects of TcILP2 Knockdown Combined With Different Concentrations of CO<sub>2</sub> on Trehalase Activity</title>
<p>The result shown that knockdown <italic>TcILP2</italic> could use to increase content of soluble trehalose activity (<xref ref-type="fig" rid="F3">Figure 3A</xref>). When RNAi was combined with high-concentration CO<sub>2</sub> treatment, the soluble trehalase activity did not change significantly under 50% CO<sub>2</sub> &#x2b; 50% air and 75% CO<sub>2</sub> &#x2b; 25% air treatments. However, it increased significantly in response to the other treatments (<xref ref-type="fig" rid="F3">Figure 3A</xref>). The activity of the membrane-bound trehalase decreased significantly under the stress of 75% CO<sub>2</sub> &#x2b; 25% air and 95% CO<sub>2</sub> &#x2b; 5% air, but there was no significant change under other treatments (<xref ref-type="fig" rid="F3">Figure 3B</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Changes of trehalase activity after RNAi combined with high concentration CO<sub>2</sub>. <bold>(A)</bold> soluble trehalase activity; <bold>(B)</bold> membrane-bound trehalase activity. After dsRNA (dsILP2 and dsGFP) injection, <italic>T. castaneum</italic> larvae were treated with 25% CO<sub>2</sub> &#x2b; 75% air, 50% CO<sub>2</sub> &#x2b; 50% air, 75% CO<sub>2</sub> &#x2b; 25% air and 95% CO<sub>2</sub> &#x2b; 5% air for 48&#xa0;h. Insects were collected and divided into three groups (each group covered 15 larvae), and used to detect two trehalase enzyme activity.</p>
</caption>
<graphic xlink:href="fphys-13-857239-g003.tif"/>
</fig>
</sec>
<sec id="s3-4">
<title>Effects of <italic>TcILP2</italic> Knockdown Combined With Different Concentrations of CO<sub>2</sub> on the Expression of Genes in the Trehalose Metabolic Pathway</title>
<p>The expression level of <italic>TcTRE1-2</italic> and <italic>TcTPS</italic> were increased significantly at 48&#xa0;h after <italic>TcILP2</italic> inhibition (<italic>p</italic> &#x3c; 0.05) in CK group (<xref ref-type="fig" rid="F4">Figures 4B,F</xref>), on the contrary the expression level of <italic>TcTRE1-1</italic> was downregulated significantly (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figure 4A</xref>), expression level of other genes had no change. Contrary to the relative expression level of <italic>TcTRE1-1</italic>, <italic>TcTRE1-3</italic>, and <italic>TcTRE1-4</italic> were decreased significantly (<italic>p</italic> &#x3c; 0.01) (<xref ref-type="fig" rid="F4">Figures 4A,C,D</xref>), the relative expression level of <italic>TcTRE1-2</italic>, <italic>TcTRE2</italic>, and <italic>TcTPS</italic> were increased significantly (<italic>p</italic> &#x3c; 0.01) (<xref ref-type="fig" rid="F4">Figures 4B,E,F</xref>) after treatment of <italic>dsILP2</italic> combined with 25% CO<sub>2</sub> &#x2b; 75% air. The relative expression level of <italic>TcTRE1-2</italic> and <italic>TcTRE1-4</italic> were significant decrease (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figures 4B,D</xref>), and <italic>TcTRE1-3</italic>, <italic>TcTRE2</italic> and <italic>TcTPS</italic> were significant increase (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figures 4C,E,F</xref>) when cultivate <italic>T. castaneum</italic> under 50% CO<sub>2</sub> &#x2b; 50% air after <italic>dsILP2</italic> injection. 75% CO<sub>2</sub> &#x2b; 25% air treatments group after treatment of <italic>dsILP2</italic>, the expression level of <italic>TcTRE1-1</italic> and <italic>TcTRE1-4</italic> decreased significantly (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figures 4A,D</xref>), on the contrary, <italic>TcTRE1-2</italic>, <italic>TcTRE1-3</italic>, <italic>TcTRE2</italic>, and <italic>TcTPS</italic> were upregulated significantly (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figures 4B,C,E,F</xref>). As for <italic>dsILP2</italic> combined with 95% CO<sub>2</sub> &#x2b; 5% air treatments, the expression of <italic>TcTRE1-1</italic> only has any change, while other genes (<italic>TcTRE1-2</italic>, <italic>TcTRE1-3</italic>, <italic>TcTRE1-4</italic>, <italic>TcTRE2</italic>, <italic>TcTPS</italic>) increased significantly (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figures 4B&#x2013;F</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Effects of <italic>TcILP2</italic> knockdown on the expressions of six trehalose metabolic pathway genes. <italic>T. castaneum</italic> larvae were divided into three groups (each group covered 10 larvae) and injected with dsILP2 and dsGFP, and 48&#xa0;h combined with treatments of 25% CO<sub>2</sub> &#x2b; 75% air, 50% CO<sub>2</sub> &#x2b; 50% air, 75% CO<sub>2</sub> &#x2b; 25% air and 95% CO<sub>2</sub> &#x2b; 5% air, respectively. Samples were collected and mRNA expression level were detected by q-PCR. The mRNA level was normalized to that of TcRPL13a mRNA. Five trehalase genes including <italic>TcTre1-1</italic>, <italic>TcTre1-2</italic>, <italic>TcTre1-3</italic>, <italic>TcTre1-4</italic>, <italic>TcTre2</italic> <bold>(A&#x2013;E)</bold> and one trehalose-6-phosphate synthases gene [<italic>TcTPS</italic>, <bold>(F)</bold>].</p>
</caption>
<graphic xlink:href="fphys-13-857239-g004.tif"/>
</fig>
</sec>
<sec id="s3-5">
<title>Effects of TcILP2 Knockdown Combined With Different Concentrations of CO<sub>2</sub> for 48&#xa0;h on the Death, Pupation, and Emergence of the <italic>T. castaneum</italic>
</title>
<p>The mortality increased in both the <italic>dsGFP</italic> and the <italic>dsILP2</italic> treatments 48&#xa0;h with the increase in the CO<sub>2</sub> concentration, the mortality rate had been reached 100% at 50% CO<sub>2</sub> &#x2b; 50% air concentration (<xref ref-type="fig" rid="F5">Figure 5A</xref>). In addition, at normal CO<sub>2</sub> concentration, the mortality rate of the <italic>dsILP2</italic> group was significantly higher than that of the control group, however, there was no significant difference between the groups at other concentrations. The pupation rate and emergence rate decreased with the increase in CO<sub>2</sub> concentration (<xref ref-type="fig" rid="F5">Figures 5B,C</xref>). The pupation rate was nearly 0 at 75% CO<sub>2</sub> &#x2b; 20% air concentration (<xref ref-type="fig" rid="F5">Figure 5B</xref>), while the feathering rate was nearly 0&#xa0;at 50% CO<sub>2</sub> &#x2b; 50% air concentration (<xref ref-type="fig" rid="F5">Figure 5C</xref>).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>The mortality, pupation rate, and emergence rate of the red rice pirate treated with RNAi combined with high concentration CO<sub>2</sub>. <bold>(A)</bold> mortality; <bold>(B)</bold> pupation rate; <bold>(C)</bold> emergence rate. <italic>T. castaneum</italic> larvae were divided into three groups, each group covered 150 larvae. The samples used to be counted mortality, pupation, and emergence rate.</p>
</caption>
<graphic xlink:href="fphys-13-857239-g005.tif"/>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>There are four ILP(<italic>ILP1-LIP4</italic>) genes in <italic>T. castaneum</italic> (<xref ref-type="bibr" rid="B29">Li et al., 2008</xref>), the gene expression levels of <italic>ILP</italic>s were changed significantly with different concentrations of carbon dioxide when <italic>T. castaneum</italic> treated by four air and high CO<sub>2</sub> combinations. It evidenced that changes of CO<sub>2</sub> concentration level have a significant effect on IIS pathway. Exposed to starvation <italic>Drosophila</italic>, <italic>dilp2</italic> was upregulated and <italic>dilp3</italic> was downregulated (<xref ref-type="bibr" rid="B2">Birse et al., 2011</xref>). <italic>AccILP-2</italic> might play an important role in the response to abiotic stress including light, H<sub>2</sub>O<sub>2</sub>, heavy metals (HgCl<sub>2</sub> and CdCl<sub>2</sub>) and pesticides (dichlorvos, paraquat and cyhalothrin) in <italic>Apis cerana cerana</italic> (<xref ref-type="bibr" rid="B14">Chi et al., 2018</xref>). Those proves that insect stress resistance requires the participation of ILPs. Therefore, we inferred that the endogenous metabolites in the larvae of the <italic>T. castaneum</italic> under different carbon dioxide stress changed to resist adversity. In current research, <italic>TcILP2</italic> was inhibited significantly in CK group which indicated dsRNA effective noticeably, it is worth noting that, only 25% CO<sub>2</sub> &#x2b; 75% air group appear <italic>TcILP2</italic> upregulation significantly, it was the same with <xref ref-type="fig" rid="F1">Figure 1A</xref>, it indicated at 25% CO<sub>2</sub> &#x2b; 75% air could still stimulate the <italic>TcILP2</italic> transcription when RNAi was effective. In contrast, <italic>TcILP2</italic> was also significantly inhibited in stress of other high CO<sub>2</sub> concentrations after gene interference successfully. <italic>AccILP-2</italic> expression was downregulated at 44&#xb0;C (<xref ref-type="bibr" rid="B14">Chi et al., 2018</xref>), we inferred that high stress coupled with dsRNA could also repress target gene.</p>
<p>RNAi of TcILP2 up-regulated glycogen and glucose levels in the hemolymph of <italic>T. castaneum</italic> rather trehalose levels, in line with previous reports (<xref ref-type="bibr" rid="B34">N&#xe4;ssel and Broeck, 2016</xref>; <xref ref-type="bibr" rid="B51">Xue et al., 2020</xref>). It suggests that <italic>TcILP2</italic> is responsible for downregulation glycogen and glucose levels in the <italic>T. castaneum</italic>. mRNA expression levels of other IIS genes elevated by the reduction of <italic>ILP</italic>s (<xref ref-type="bibr" rid="B21">Gr&#xf6;nke et al., 2010</xref>; <xref ref-type="bibr" rid="B48">Walsh and Smith, 2011</xref>; <xref ref-type="bibr" rid="B20">Fu et al., 2016</xref>). In our results, though knockout <italic>TcILP2</italic> can increase <italic>TPS</italic> transcript level and soluble trehalase activity, trehalose content had no obvious change, thus trehalose content may be regulated by other <italic>ILP</italic>s in <italic>T. castaneum</italic>. The decrease in glycogen and glucose content levels in 25% CO<sub>2</sub> &#x2b; 75% air group was likely due to <italic>TcILP2</italic> upregulation. However, we trended towards the interaction of CO<sub>2</sub> and <italic>ILP2</italic>, the sudden increase in CO<sub>2</sub> is clearly harmful to pest insects, and explaining the dramatic rise in mortality.</p>
<p>The addition of hypercapnia made a complex alteration on the hypoxia response of <italic>Callosobruchus chinensis</italic> transcriptome, carbohydrate metabolism was one of the most highly enriched pathways for genes significantly changed (<xref ref-type="bibr" rid="B18">Cui et al., 2017</xref>; <xref ref-type="bibr" rid="B17">2019</xref>). Furthermore, JH regulates the expression of genes encoding trehalase and <italic>TRE</italic> through the <italic>ILP2</italic> and IIS pathways, further affects trehalose homeostasis in <italic>T. castaneum</italic> (<xref ref-type="bibr" rid="B30">Ling and Raikhel, 2021</xref>). Further detected relative expression levels of trehalose metabolism genes we discovered the high expression for <italic>TPS</italic> and <italic>TRE2</italic> in any modified atmosphere. In <italic>Drosophila</italic>, overexpression of <italic>TPS</italic> was found toward increase trehalose levels and tolerance to hypoxia (<xref ref-type="bibr" rid="B11">Chen et al., 2003</xref>). It was reported that glucose and glycogen are used to synthesize trehalose by <italic>TPS</italic> in insect tissue, <italic>TRE2</italic> mainly resides in fat body functions to hydrolyze membrane-bound trehalase for contribute energy, and <italic>TcILP2</italic> is mainly in the brain and fat body (<xref ref-type="bibr" rid="B33">Nardelli et al., 2019</xref>; <xref ref-type="bibr" rid="B16">Chowa&#x144;ski et al., 2021</xref>). Then we postulated that <italic>T. castaneum</italic> enhance the expressions of <italic>TPS</italic> and <italic>TRE</italic> resist hypoxia/hypercapnia under adverse conditions. Interestingly, trehalose and glucose contents were decrease rather than increase. While the effect of <italic>TcILP2</italic> was effectively eliminated trehalose pathway genes begin to respond successively in order to endure increasing concentrations of CO<sub>2</sub> (<italic>TRE 1-3</italic> expressed first followed by T<italic>RE 1-2</italic> then <italic>TRE 1-4</italic>). Those results revealed, <italic>T. castaneum</italic> tried to strengthen the trehalose or glucose content at the transcript levels of the trehalose pathway genes, but in high CO<sub>2</sub> concentrations, fat body consumes too much energy bring on the content of trehalose or glucose extremely lower than the normal.</p>
<p>We found that under 25% CO<sub>2</sub> &#x2b; 75% air mix, the <italic>T. castaneum</italic> can still survive partially, and the mortality rate reaches 100% at 50% CO<sub>2</sub> &#x2b; 50% air, 75% CO<sub>2</sub> &#x2b; 25% air, and 95% CO<sub>2</sub> &#x2b; 5% air. The matching situation was 25% under CO<sub>2</sub>, <italic>dsILP2</italic> not only has a lower mortality rate than <italic>dsGFP</italic>, but also a significant increase in pupation rate and emergence rate&#x2014;may be attributed to the increase in <italic>TcILP2</italic> expression&#x2014;which is similar to Xu&#x2019;s research results (<xref ref-type="bibr" rid="B50">Xu et al., 2013</xref>). Insulin signaling pathway plays a role in the material, sugar, and energy metabolism of insects. It has important regulatory effects on various physiological processes such as metabolism, growth and development, reproduction, and stress resistance (<xref ref-type="bibr" rid="B53">Yuan et al., 2018</xref>; <xref ref-type="bibr" rid="B35">N&#xe4;ssel and Zandawala, 2019</xref>; <xref ref-type="bibr" rid="B46">Strilbytska et al., 2020</xref>; <xref ref-type="bibr" rid="B27">Leyria et al., 2021</xref>). Moreover, high CO<sub>2</sub> stress causes hypoxia, which directly limits energy supply and free radical damage and other processes, and ultimately leads to insect death (<xref ref-type="bibr" rid="B37">Nystul and Roth, 2004</xref>; <xref ref-type="bibr" rid="B23">Helenius et al., 2009</xref>). Combination of <italic>ILP2</italic> knockout and hypoxia/hypercapnia could accelerate the carbohydrates consumption and affect survival and development of insects. Thus, we hypothesized that the <italic>TcILP2</italic> could participate in the regulation of the trehalose metabolism during hypoxia to maintain insects alive.</p>
</sec>
</body>
<back>
<sec id="s5">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6">
<title>Author Contributions</title>
<p>CL and K-KX designed the overall study and provided financial support. MZ and Y-HS conducted statistical analyses of the data. Y-YW, X-YZ, X-RM, and MZ involved in the whole study. Y-YW, X-YZ, and XL prepared the manuscript. All authors reviewed and approved the final manuscript.</p>
</sec>
<sec id="s7">
<title>Funding</title>
<p>This work was supported in part by the National Natural Science Foundation of China (No. 31960542), Academician Workstation of Guiyang University, Guizhou Province [QKHRCP No. (2019) 5605], the special funding of Guiyang science and technology bureau and Guiyang University [GYU-KY-(2021)], the Project of Graduate Research Project of Guiyang University [GYU-YJS(2019)-13], Special key laboratory of higher education institution in Guizhou province [QJHKYZ(2011)001], and the Innovation Group Project of Education Department of Guizhou Province [(2021)013].</p>
</sec>
<sec sec-type="COI-statement" id="s8">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s9">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ack>
<p>We would like to thank the volunteers participating in the study for their consent and participation in this study.</p>
</ack>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Azzam</surname>
<given-names>Z. S.</given-names>
</name>
<name>
<surname>Sharabi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Guetta</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Bank</surname>
<given-names>E. M.</given-names>
</name>
<name>
<surname>Gruenbaum</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>The Physiological and Molecular Effects of Elevated CO2 levels</article-title>. <source>Cell Cycle</source> <volume>9</volume> (<issue>8</issue>), <fpage>1528</fpage>&#x2013;<lpage>1532</lpage>. <pub-id pub-id-type="doi">10.4161/cc.9.8.11196</pub-id> </citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Birse</surname>
<given-names>R. T.</given-names>
</name>
<name>
<surname>S&#xf6;derberg</surname>
<given-names>J. A. E.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Winther</surname>
<given-names>&#xc5;. M. E.</given-names>
</name>
<name>
<surname>N&#xe4;ssel</surname>
<given-names>D. R.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Regulation of Insulin-Producing Cells in the Adult <italic>Drosophila</italic> Brain via the Tachykinin Peptide Receptor DTKR</article-title>. <source>J. Exp. Biol.</source> <volume>214</volume> (<issue>Pt 24</issue>), <fpage>4201</fpage>&#x2013;<lpage>4208</lpage>. <pub-id pub-id-type="doi">10.1242/jeb.062091</pub-id> </citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boyer</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Lemp&#xe9;ri&#xe8;re</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>A Review of Control Methods and Resistance Mechanisms in Stored-Product Insects</article-title>. <source>Bull. Entomol. Res.</source> <volume>102</volume> (<issue>2</issue>), <fpage>213</fpage>&#x2013;<lpage>229</lpage>. <pub-id pub-id-type="doi">10.1017/s0007485311000654</pub-id> </citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Broughton</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Piper</surname>
<given-names>M. D. W.</given-names>
</name>
<name>
<surname>Ikeya</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Bass</surname>
<given-names>T. M.</given-names>
</name>
<name>
<surname>Jacobson</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Driege</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2005</year>). <article-title>Longer Lifespan, Altered Metabolism, and Stress Resistance in <italic>Drosophila</italic> from Ablation of Cells Making Insulin-like Ligands</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>102</volume> (<issue>8</issue>), <fpage>3105</fpage>&#x2013;<lpage>3110</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0405775102</pub-id> </citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Campbell</surname>
<given-names>J. F.</given-names>
</name>
<name>
<surname>Runnion</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Patch Exploitation by Female Red Flour Beetles, <italic>Tribolium castaneum</italic>
</article-title>. <source>J. Insect Sci. (Online)</source> <volume>3</volume>, <fpage>20</fpage>. <pub-id pub-id-type="doi">10.1093/jis/3.1.20</pub-id> </citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Campbell</surname>
<given-names>J. F.</given-names>
</name>
<name>
<surname>Toews</surname>
<given-names>M. D.</given-names>
</name>
<name>
<surname>Arthur</surname>
<given-names>F. H.</given-names>
</name>
<name>
<surname>Arbogast</surname>
<given-names>R. T.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Long-term Monitoring of <italic>Tribolium castaneum</italic> Populations in Two Flour Mills: Rebound after Fumigation</article-title>. <source>ec</source> <volume>103</volume> (<issue>3</issue>), <fpage>1002</fpage>&#x2013;<lpage>1011</lpage>. <pub-id pub-id-type="doi">10.1603/ec09348</pub-id> </citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>X. Y.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>L. H.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2015a</year>). <article-title>Toxicity of CO<sub>2</sub> to <italic>Stegobium Paniceum</italic> and Comparison of its Energy Metabolism</article-title>. <source>Chin. J. Biol. Control.</source> <volume>31</volume>, <fpage>57</fpage>&#x2013;<lpage>63</lpage>. <pub-id pub-id-type="doi">10.16409/j.cnki.2095-039x.2015.01.009</pub-id> </citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Role of Modified Atmosphere in Pest Control and Mechanism of its Effect on Insects</article-title>. <source>Front. Physiol.</source> <volume>10</volume>, <fpage>206</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2019.00206</pub-id> </citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>Y. F.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>W. J.</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>Z. L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L. J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2015b</year>). <article-title>Influence of Carbon Dioxide Controlled Atmosphere on <italic>Oryzaephilus Surinamensis</italic> Linne and its Utilization of Energy Substances</article-title>. <source>J. Zhejiang Univ.</source> <volume>41</volume>, <fpage>631</fpage>&#x2013;<lpage>640</lpage>. <pub-id pub-id-type="doi">10.3785/j.issn.1008-9209.2015.04.072</pub-id> </citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Different Functions of the Insect Soluble and Membrane-Bound Trehalase Genes in Chitin Biosynthesis Revealed by RNA Interference</article-title>. <source>PLoS One</source> <volume>5</volume> (<issue>4</issue>), <fpage>e10133</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0010133</pub-id> </citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Behar</surname>
<given-names>K. L.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Haddad</surname>
<given-names>G. G.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Expression of <italic>Drosophila</italic> Trehalose-Phosphate Synthase in HEK-293 Cells Increases Hypoxia Tolerance</article-title>. <source>J. Biol. Chem.</source> <volume>278</volume> (<issue>49</issue>), <fpage>49113</fpage>&#x2013;<lpage>49118</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.m308652200</pub-id> </citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Q. W.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>Q. D.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>Z. M.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Regulatory Functions of Trehalose-6-Phosphate Synthase in the Chitin Biosynthesis Pathway in <italic>Tribolium castaneum</italic> (Coleoptera: Tenebrionidae) Revealed by RNA Interference</article-title>. <source>Bull. Entomol. Res.</source> <volume>108</volume> (<issue>3</issue>), <fpage>388</fpage>&#x2013;<lpage>399</lpage>. <pub-id pub-id-type="doi">10.1017/s000748531700089x</pub-id> </citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Lei</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ahn</surname>
<given-names>J.-E.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>T.-X.</given-names>
</name>
<name>
<surname>Zhu-Salzman</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Effects of Decreased O2 and Elevated CO2 on Survival, Development, and Gene Expression in Cowpea Bruchids</article-title>. <source>J. Insect Physiol.</source> <volume>58</volume> (<issue>6</issue>), <fpage>792</fpage>&#x2013;<lpage>800</lpage>. <pub-id pub-id-type="doi">10.1016/j.jinsphys.2012.02.005</pub-id> </citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chi</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Molecular Cloning and Characterization under Different Stress Conditions of Insulin-like Peptide 2 Gene (AccILP-2) from <italic>Apis cerana</italic> Cerana</article-title>. <source>J. Asia-Pacific Entomol.</source> <volume>21</volume> (<issue>2</issue>), <fpage>474</fpage>&#x2013;<lpage>481</lpage>. <pub-id pub-id-type="doi">10.1016/j.aspen.2018.02.007</pub-id> </citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chi</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Ahn</surname>
<given-names>J.-E.</given-names>
</name>
<name>
<surname>Yun</surname>
<given-names>D.-J.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>T.-X.</given-names>
</name>
<name>
<surname>Zhu-Salzman</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Changes in Oxygen and Carbon Dioxide Environment Alter Gene Expression of <italic>Cowpea Bruchids</italic>
</article-title>. <source>J. Insect Physiol.</source> <volume>57</volume> (<issue>1</issue>), <fpage>220</fpage>&#x2013;<lpage>230</lpage>. <pub-id pub-id-type="doi">10.1016/j.jinsphys.2010.11.011</pub-id> </citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chowa&#x144;ski</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Walkowiak-Nowicka</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Winkiel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Marciniak</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Urba&#x144;ski</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Pacholska-Bogalska</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Insulin-like Peptides and Cross-Talk with Other Factors in the Regulation of Insect Metabolism</article-title>. <source>Front. Physiol.</source> <volume>12</volume>, <fpage>701203</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2021.701203</pub-id> </citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname>
<given-names>S. F.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y. L.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z. C.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Comparative Transcriptome Analyses of Adzuki Bean Weevil (<italic>Callosobruchus Chinensis</italic>) Response to Hypoxia and Hypoxia/hypercapnia</article-title>. <source>Bull. Entomol. Res.</source> <volume>109</volume> (<issue>2</issue>), <fpage>266</fpage>&#x2013;<lpage>277</lpage>. <pub-id pub-id-type="doi">10.1017/s0007485318000512</pub-id> </citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Geng</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Comparative Metabolomics Analysis of <italic>Callosobruchus Chinensis</italic> Larvae under Hypoxia, Hypoxia/hypercapnia and Normoxia</article-title>. <source>Pest Manag. Sci.</source> <volume>73</volume> (<issue>6</issue>), <fpage>1267</fpage>&#x2013;<lpage>1276</lpage>. <pub-id pub-id-type="doi">10.1002/ps.4455</pub-id> </citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elbein</surname>
<given-names>A. D.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>Y. T.</given-names>
</name>
<name>
<surname>Pastuszak</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Carroll</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>New Insights on Trehalose: a Multifunctional Molecule</article-title>. <source>Glycobiology</source> <volume>13</volume>, <fpage>17R</fpage>&#x2013;<lpage>27</lpage>R. <pub-id pub-id-type="doi">10.1093/glycob/cwg047</pub-id> </citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fu</surname>
<given-names>K.-Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>T.-T.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>W.-C.</given-names>
</name>
<name>
<surname>Ahmat</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.-Q.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Knockdown of a Putative Insulin-like Peptide Gene LdILP2 in <italic>Leptinotarsa decemlineata</italic> by RNA Interference Impairs Pupation and Adult Emergence</article-title>. <source>Gene</source> <volume>581</volume> (<issue>2</issue>), <fpage>170</fpage>&#x2013;<lpage>177</lpage>. <pub-id pub-id-type="doi">10.1016/j.gene.2016.01.037</pub-id> </citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gr&#xf6;nke</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Clarke</surname>
<given-names>D.-F.</given-names>
</name>
<name>
<surname>Broughton</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Andrews</surname>
<given-names>T. D.</given-names>
</name>
<name>
<surname>Partridge</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Molecular Evolution and Functional Characterization of <italic>Drosophila</italic> Insulin-like Peptides</article-title>. <source>Plos Genet.</source> <volume>6</volume> (<issue>2</issue>), <fpage>e1000857</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pgen.1000857</pub-id> </citation>
</ref>
<ref id="B22">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>He</surname>
<given-names>S. F.</given-names>
</name>
</person-group> (<year>2015</year>). <source>Study on Insulin Gene Analysis and Function of Brown Planthopper</source>. <publisher-name>Hangzhou</publisher-name>: <publisher-name>Zhejiang University</publisher-name>. <comment>[dissertation/master&#x2019;s thesis]. [Zhejiang (CN)]</comment>. </citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Helenius</surname>
<given-names>I. T.</given-names>
</name>
<name>
<surname>Krupinski</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Turnbull</surname>
<given-names>D. W.</given-names>
</name>
<name>
<surname>Gruenbaum</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Silverman</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>E. A.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>Elevated CO2 Suppresses Specific Drosophila Innate Immune Responses and Resistance to Bacterial Infection</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>106</volume> (<issue>44</issue>), <fpage>18710</fpage>&#x2013;<lpage>18715</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0905925106</pub-id> </citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoback</surname>
<given-names>W. W.</given-names>
</name>
<name>
<surname>Stanley</surname>
<given-names>D. W.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Insects in Hypoxia</article-title>. <source>J. Insect Physiol.</source> <volume>47</volume> (<issue>6</issue>), <fpage>533</fpage>&#x2013;<lpage>542</lpage>. <pub-id pub-id-type="doi">10.1016/s0022-1910(00)00153-0</pub-id> </citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hun</surname>
<given-names>L. V.</given-names>
</name>
<name>
<surname>Luckhart</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Riehle</surname>
<given-names>M. A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Increased Akt Signaling in the Fat Body of <italic>Anopheles stephensi</italic> Extends Lifespan and Increases Lifetime Fecundity through Modulation of Insulin-like Peptides</article-title>. <source>J. Insect Physiol.</source> <volume>118</volume>, <fpage>103932</fpage>. <pub-id pub-id-type="doi">10.1016/j.jinsphys.2019.103932</pub-id> </citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kharel</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Mason</surname>
<given-names>L. J.</given-names>
</name>
<name>
<surname>Murdock</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>Baributsa</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Efficacy of Hypoxia against <italic>Tribolium castaneum</italic> (Coleoptera: Tenebrionidae) throughout Ontogeny</article-title>. <source>J. Econ. Entomol.</source> <volume>112</volume> (<issue>3</issue>), <fpage>1463</fpage>&#x2013;<lpage>1468</lpage>. <pub-id pub-id-type="doi">10.1093/jee/toz019</pub-id> </citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leyria</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Orchard</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Lange</surname>
<given-names>A. B.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>The Involvement of insulin/ToR Signaling Pathway in Reproductive Performance of <italic>Rhodnius prolixus</italic>
</article-title>. <source>Insect Biochem. Mol. BiologyInsect Biochem. Mol. Biol.</source> <volume>130</volume>, <fpage>103526</fpage>. <pub-id pub-id-type="doi">10.1016/j.ibmb.2021.103526</pub-id> </citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leyva</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Quintana</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>S&#xe1;nchez</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rodr&#xed;guez</surname>
<given-names>E. N.</given-names>
</name>
<name>
<surname>Cremata</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>S&#xe1;nchez</surname>
<given-names>J. C.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Rapid and Sensitive Anthrone-Sulfuric Acid Assay in Microplate Format to Quantify Carbohydrate in Biopharmaceutical Products: Method Development and Validation</article-title>. <source>Biologicals</source> <volume>36</volume>, <fpage>134</fpage>&#x2013;<lpage>141</lpage>. <pub-id pub-id-type="doi">10.1016/j.biologicals.2007.09.001</pub-id> </citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Predel</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Neupert</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Hauser</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Cazzamali</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2008</year>). <article-title>Genomics, Transcriptomics, and Peptidomics of Neuropeptides and Protein Hormones in the Red Flour Beetle <italic>Tribolium castaneum</italic>
</article-title>. <source>Genome Res.</source> <volume>18</volume> (<issue>1</issue>), <fpage>113</fpage>&#x2013;<lpage>122</lpage>. <pub-id pub-id-type="doi">10.1101/gr.6714008</pub-id> </citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ling</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Raikhel</surname>
<given-names>A. S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Cross-talk of Insulin-like Peptides, Juvenile Hormone, and 20-hydroxyecdysone in Regulation of Metabolism in the Mosquito <italic>Aedes aegypti</italic>
</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>118</volume> (<issue>6</issue>), <fpage>e2023470118</fpage>. <pub-id pub-id-type="doi">10.1073/pnas.2023470118</pub-id> </citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname>
<given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2&#x2212;&#x394;&#x394;CT Method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id> </citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lorenzen</surname>
<given-names>M. D.</given-names>
</name>
<name>
<surname>Kimzey</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Shippy</surname>
<given-names>T. D.</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Denell</surname>
<given-names>R. E.</given-names>
</name>
<name>
<surname>Beeman</surname>
<given-names>R. W.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>PiggyBac-based Insertional Mutagenesis in <italic>Tribolium castaneum</italic> Using Donor/helper Hybrids</article-title>. <source>Insect Mol. Biol.</source> <volume>16</volume> (<issue>3</issue>), <fpage>265</fpage>&#x2013;<lpage>275</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2583.2007.00727.x</pub-id> </citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nardelli</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Vecchi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Mandrioli</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Manicardi</surname>
<given-names>G. C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The Evolutionary History and Functional Divergence of Trehalase (Treh) Genes in Insects</article-title>. <source>Front. Physiol.</source> <volume>10</volume>, <fpage>62</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2019.00062</pub-id> </citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>N&#xe4;ssel</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Broeck</surname>
<given-names>J. V.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Insulin/IGF Signaling in <italic>Drosophila</italic> and Other Insects: Factors that Regulate Production, Release and post-release Action of the Insulin-like Peptides</article-title>. <source>Cell. Mol. Life Sci.</source> <volume>73</volume> (<issue>2</issue>), <fpage>271</fpage>&#x2013;<lpage>290</lpage>. <pub-id pub-id-type="doi">10.1007/s00018-015-2063-3</pub-id> </citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>N&#xe4;ssel</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Zandawala</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Recent Advances in Neuropeptide Signaling in Drosophila, from Genes to Physiology and Behavior</article-title>. <source>Prog. Neurobiol.</source> <volume>179</volume>, <fpage>101607</fpage>. <pub-id pub-id-type="doi">10.1016/j.pneurobio.2019.02.003</pub-id> </citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Navarro</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Modified Atmospheres for the Control of Stored-Product Insects and Mites</article-title>. <source>Insect Manage. Food Storage Process.</source> <volume>101</volume>, <fpage>105</fpage>&#x2013;<lpage>145</lpage>. <pub-id pub-id-type="doi">10.1016/B978-1-891127-46-5.50016-7</pub-id> </citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nystul</surname>
<given-names>T. G.</given-names>
</name>
<name>
<surname>Roth</surname>
<given-names>M. B.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Carbon Monoxide-Induced Suspended Animation Protects against Hypoxic Damage in <italic>Caenorhabditis elegans</italic>
</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>101</volume> (<issue>24</issue>), <fpage>9133</fpage>&#x2013;<lpage>9136</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0403312101</pub-id> </citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Opit</surname>
<given-names>G. P.</given-names>
</name>
<name>
<surname>Phillips</surname>
<given-names>T. W.</given-names>
</name>
<name>
<surname>Aikins</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Hasan</surname>
<given-names>M. M.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Phosphine Resistance in <italic>Tribolium castaneum</italic> and Rhyzopertha dominica from Stored Wheat in oklahoma</article-title>. <source>Jnl. Econ. Entom.</source> <volume>105</volume> (<issue>4</issue>), <fpage>1107</fpage>&#x2013;<lpage>1114</lpage>. <pub-id pub-id-type="doi">10.1603/ec12064</pub-id> </citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pan</surname>
<given-names>B.-y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>K.-k.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>Y.-j.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.-y.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>The Sequence Characteristics and Functions on Regulating Trehalose Metabolism of Two PTP Genes in <italic>Tribolium castaneum</italic> (Herbst) (Coleoptera: Tenebrionidae)</article-title>. <source>J. Stored Prod. Res.</source> <volume>89</volume>, <fpage>101692</fpage>. <pub-id pub-id-type="doi">10.1016/j.jspr.2020.101692</pub-id> </citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perkin</surname>
<given-names>L. C.</given-names>
</name>
<name>
<surname>Oppert</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Gene Expression in <italic>Tribolium castaneum</italic> Life Stages: Identifying a Species-specific Target for Pest Control Applications</article-title>. <source>Peer J.</source> <volume>7</volume>, <fpage>e6946</fpage>. <pub-id pub-id-type="doi">10.7717/peerj.6946</pub-id> </citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pimentel</surname>
<given-names>M. A. G.</given-names>
</name>
<name>
<surname>Faroni</surname>
<given-names>L. R. D. A.</given-names>
</name>
<name>
<surname>Silva</surname>
<given-names>F. H. d.</given-names>
</name>
<name>
<surname>Batista</surname>
<given-names>M. D.</given-names>
</name>
<name>
<surname>Guedes</surname>
<given-names>R. N. C.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Spread of Phosphine Resistance Among Brazilian Populations of Three Species of Stored Product Insects</article-title>. <source>Neotrop. Entomol.</source> <volume>39</volume>, <fpage>101</fpage>&#x2013;<lpage>107</lpage>. <pub-id pub-id-type="doi">10.1590/s1519-566x2010000100014</pub-id> </citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Satake</surname>
<given-names>S. I.</given-names>
</name>
<name>
<surname>Masumura</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ishizaki</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nagata</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Kataoka</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Suzuki</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>1997</year>). <article-title>Bombyxin, an Insulin-Related Peptide of Insects, Reduces the Major Storage Carbohydrates in the Silkworm <italic>Bombyx mori</italic>
</article-title>. <source>Comp. Biochem. Physiol. B: Biochem. Mol. Biol.</source> <volume>118</volume> (<issue>2</issue>), <fpage>349</fpage>&#x2013;<lpage>357</lpage>. <pub-id pub-id-type="doi">10.1016/s0305-0491(97)00166-1</pub-id> </citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sauer</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Shelton</surname>
<given-names>M. D.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>High-temperature Controlled Atmosphere for post-harvest Control of Indian Meal Moth (Lepidoptera: Pyralidae) on Preserved Flowers</article-title>. <source>J. Econ. Entomol.</source> <volume>95</volume> (<issue>5</issue>), <fpage>1074</fpage>&#x2013;<lpage>1078</lpage>. <pub-id pub-id-type="doi">10.1093/jee/95.5.1074</pub-id> </citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shelby</surname>
<given-names>C. E.</given-names>
</name>
</person-group> (<year>1977</year>). <article-title>The Biology of Tribolium with Special Emphasis on Genetic Aspects</article-title>. <source>Bull. Entomol. Soc. America</source> <volume>23</volume> (<issue>4</issue>), <fpage>298</fpage>&#x2013;<lpage>299</lpage>. <pub-id pub-id-type="doi">10.1093/besa/23.4.298a</pub-id> </citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shukla</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Thorat</surname>
<given-names>L. J.</given-names>
</name>
<name>
<surname>Nath</surname>
<given-names>B. B.</given-names>
</name>
<name>
<surname>Gaikwad</surname>
<given-names>S. M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Insect Trehalase: Physiological Significance and Potential Applications</article-title>. <source>Glycobiology</source> <volume>25</volume> (<issue>4</issue>), <fpage>357</fpage>&#x2013;<lpage>367</lpage>. <pub-id pub-id-type="doi">10.1093/glycob/cwu125</pub-id> </citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Strilbytska</surname>
<given-names>O. M.</given-names>
</name>
<name>
<surname>Semaniuk</surname>
<given-names>U. V.</given-names>
</name>
<name>
<surname>Storey</surname>
<given-names>K. B.</given-names>
</name>
<name>
<surname>Yurkevych</surname>
<given-names>I. S.</given-names>
</name>
<name>
<surname>Lushchak</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Insulin Signaling in Intestinal Stem and Progenitor Cells as an Important Determinant of Physiological and Metabolic Traits in Drosophila</article-title>. <source>Cells</source> <volume>9</volume> (<issue>4</issue>), <fpage>803</fpage>. <pub-id pub-id-type="doi">10.3390/cells9040803</pub-id> </citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>X. P.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S. G.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Advances in Trehalose Metabolism and its Regulation of Insect Chitin Synthesis</article-title>. <source>Chin. Agric. Sci. (in China)</source> <volume>51</volume> (<issue>04</issue>), <fpage>697</fpage>&#x2013;<lpage>707</lpage>. <pub-id pub-id-type="doi">10.3864/j.issn.0578-1752.2018.04.009</pub-id> </citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walsh</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Smith</surname>
<given-names>W. A.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Nutritional Sensitivity of Fifth Instar Prothoracic Glands in the Tobacco Hornworm, <italic>Manduca Sexta</italic>
</article-title>. <source>J. Insect Physiol.</source> <volume>57</volume> (<issue>6</issue>), <fpage>809</fpage>&#x2013;<lpage>818</lpage>. <pub-id pub-id-type="doi">10.1016/j.jinsphys.2011.03.009</pub-id> </citation>
</ref>
<ref id="B49">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Wei</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2013</year>). <source>Regulating Functions of Trehalase in the Pathway of Energy Metabolism and Chitin Biosynthesis in <italic>Tribolium castaneum</italic> Revealed by RNA Interference</source>. <publisher-name>Hangzhou</publisher-name>: <publisher-name>Hangzhou Normal University</publisher-name>. <comment>[dissertation/master&#x2019;s thesis]. [Hangzhou (CN)]</comment>. </citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sheng</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Palli</surname>
<given-names>S. R.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Juvenile Hormone and Insulin Regulate Trehalose Homeostasis in the Red Flour Beetle, <italic>Tribolium castaneum</italic>
</article-title>. <source>Plos Genet.</source> <volume>9</volume> (<issue>6</issue>), <fpage>e1003535</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pgen.1003535</pub-id> </citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xue</surname>
<given-names>W. H.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y. L.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Y. Q.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S. F.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q. Q.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. N.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Molecular Characterization of Insulin&#x2010;like Peptides in the Brown Planthopper, Nilaparvata Lugens (Hemiptera: Delphacidae)</article-title>. <source>Insect Mol. Biol.</source> <volume>29</volume> (<issue>3</issue>), <fpage>309</fpage>&#x2013;<lpage>319</lpage>. <pub-id pub-id-type="doi">10.1111/imb.12636</pub-id> </citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>R. H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X. X.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Trehalose-the Blood Sugar in Insects</article-title>. <source>Chin. Bull. Entomol.</source> <volume>45</volume> (<issue>5</issue>), <fpage>832</fpage>&#x2013;<lpage>837</lpage>. </citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yuan</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G. B.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>G. Y.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Research Progress of Protein Tyrosine Phosphatase 1B and its Inhibitors</article-title>. <source>J. China Pharm. Univ.</source> <volume>49</volume> (<issue>01</issue>), <fpage>1</fpage>&#x2013;<lpage>9</lpage>. </citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>L.-Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>H.-L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.-J.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.-G.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Study on the Effect of Wing Bud Chitin Metabolism and its Developmental Network Genes in the Brown Planthopper, <italic>Nilaparvata Lugens</italic>, by Knockdown of TRE Gene</article-title>. <source>Front. Physiol.</source> <volume>8</volume>, <fpage>750</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2017.00750</pub-id> </citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname>
<given-names>J. Y.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X. X.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Advances in Research on the Trehalose Metabolism in Insects</article-title>. <source>J. Appl. Entomol.</source> <volume>55</volume> (<issue>02</issue>), <fpage>145</fpage>&#x2013;<lpage>152</lpage>. <comment>(in Chinese with English abstract)</comment>. </citation>
</ref>
</ref-list>
</back>
</article>