The procedures involving animals and their care conformed to the United States National Institute of Health guidelines (NIH Pub. No. 85–23, revised 1996). The experiments were conducted under the approval of the Ethics Committee of Yangzhou University for Laboratory and Experimental Animals. The fertilized eggs of Rugao yellow chicken were purchased from the Poultry Research Institute of Chinese Academy of Agricultural Sciences and hatched under the environment of 37°C with 70% humidity.

The experimental eggs were hatched after 0 days of blunt-end injection. A total of three groups were divided into blank, sh-Tle4z1 and oe-Tle4z1 group, with 140 fertilized eggs in each group. Embryos at different stages were collected according to the chicken embryo development map (Hamburger Hamilton stage) and stored in −80°C for gonadal isolation and extraction.

The organs, such as heart, liver, spleen, lung, kidney, intestine, eye, ear, brain and gonad of chickens were collected from healthy roosters and hens, which growing in great feeding conditions, and were used to detect the expression profile of Tle4z1 organs. Blood samples were taken for sex identification.

ESCs were derived from E0 chicken embryos and PGCs from the genital ridge of embryos at E4.5. All eggs were incubated under the environment of 37.5°C and 65% relative humidity. The separation and cultivation detailed steps of ESCs and PGCs are introduced in previous article (Zhang et al., 2015). Isolated ESCs and PGCs were used to detect the expression of Tle4z1 by qRT-PCR.

According to the chicken Tle4z1 (NM_204237.1) gene sequence provided by Genebank, the RNA interference target sequence was designed (Supplementary Table 1), and the oligo sequence was synthesized(Supplementary Table 2). After annealing, the double-stranded DNA vector was formed. The ligated products were transformed into Escherichia coli supercells overnight culture, positive single bacteria were sequenced, and the correct sequences were compared. The plasmid was extracted and packaged with lentivirus (5 × 10⁸TU/ml). The vector was transfected into DF-1 cells and the fluorescence expression was observed 72 h. The RNA was reverse transcribed into cDNA, and the interference efficiency was detected by qRT-PCR.

The full-length cDNA sequence of Tle4z1 was obtained by using the cDNA of chicken PGCs as template. The amplification primer sequence is as follows: F: ATGATCCGCGACCTGAGCAAG; R: CTAATAAATAACTTCATAGACTGTAGCTTTCTTGTCCC CA. The target fragment was ligated with the enzyme-digested pCDH-CMV-MCS-EF1-TagRFP + Puro, and the competent cells were transformed and cultured overnight. The positive colonies were sequenced, and the plasmids were extracted for lentivirus packaging (1 × 10⁸TU/ml). The vector was transfected into DF-1 cells, and the overexpression efficiency was detected.

The MOI of lentiviral vector was optimized to be 10. The lentivirus concentrate of overexpression group (oe-Tle4z1) and interference group (sh-Tle4z1) was diluted with DMEM according to the ratio of 100 μL of each egg to the blunt end of E0. After being sealed with paraffin, the eggs were incubated normally at 38°C.

Genomic DNA from blood was extracted to identify the sex of the embryo. Amplification was performed using CHD1 specific primers (CHD1-F: CTGCGAGAACGTGGCAACAGAGT; CHD1-R: ATTGAAATGATCCAGTGCTTG). The results showed that the hereditary female (ZW) had two strips at 580 and 423 bp, while the hereditary male (ZZ) had only one strip at 580 bp.

The embryonic gonad of E18.5 was fixed with 4% paraformaldehyde for 24 h, and transferred to 70–100% ethanol was dehydrated. The tissue was embedded in paraffin after being immersed in xylene for 1 h. The paraffin tissue was continuously sliced with a thickness of 5–6 μm and baked at 55–60°C overnight. The slices were dewaxed with xylene and the ethanol concentration was permeated with water from high to low gradient. The treated slices were stained, soaked in hematoxylin dye for 2.5 min, rinsed under flowing water for 10 min, then soaked in eosin staining for 3–5 min, rinsed with flowing water for 5 min, dehydrated and sealed. The sections were observed under microscope.

The intact fetal gonads were taken. The hereditary female and male gonads of the control group, 15 pairs of male gonads of the interference group and female gonads of the overexpression group were set. The morphology was taken under stereoscopic microscope, and the surface area of gonads was measured, and the ratio of surface area of bilateral gonads was calculated.

Total RNA was extracted from tissues and cells to synthesize cDNA by reverse transcription. The internal reference gene: β-actin, n = 3. And primers are shown in the Supplementary Table 3. The PCR reaction was carried out in the condition of 95°C 30 s, 95°C 10 s, 60°C 30 s, 40 cycles.

The gonads at different developmental stages were weighed and crushed with PBS, and the supernatant was taken after 3,000 rpm centrifugation for 25–30 min at 4°C. The hormone of testosterone was detected with an ELISA kit for color development, and the absorbance value was detected at 450 nm. According to the concentration and OD value, the testosterone content of each group was analyzed.

Relative gene expression was calculated using the 2-ΔΔCt method after qPCR. All experiments were performed in triplicate, and the data are presented as mean ± standard error. Significant differences between the groups were determined with two-sample t-tests in SPSS 17.0. (*P < 0.05, significant difference. ^**P < 0.01, extremely significant difference, ^***P < 0.001, ^****P < 0.0001). Prism7 software was used for mapping.

At different development stages of chicken embryos, germ cells were carried out by RNA-seq (Jin et al., 2020a). According to the result, 1021 differentially expressed genes (DEGs) were found in ESCs, including 517 DEGs in males and 504 DEGs in females, while 8,057 differentially expressed genes in PGCs, including 5,833 DEGs in males and 2,674 DEGs in females. In order to further study, the data of transcriptome sequencing between ESCs and PGCs between male and female were analyzed by Venn to find key candidate genes in the process of male sexual differentiation in chicken. 242 DEGs were screened. Map these genes on the chromosomes and watch out that there are six male highly expressed genes located on the Z chromosome (Figure 1A).

Among them, the expression of Tle4z1 appears male preference in ESCs and PGCs (Figure 1B), and we speculate that it may play a certain role in sex determination and differentiation. Further quantitative results showed that the expression of Tle4z1 in males was significantly higher than that in females in the stage of PGCs (P < 0.0001) (Figure 1C). Detection of adult chicken in different tissues also found that its specific high expression in testicular tissue, and the expression of Tle4z1 in male gonads was higher than that of female (P < 0.01) (Figure 1D). This phenomenon of sex preference expression also exists in the gonads of chicken embryos. From the development of chicken embryo E4.5, the level of Tle4z1 mRNA expression in male chicken embryo was significantly higher than that in female (P < 0.0001) (Figure 1E). These results suggest that Tle4z1, as a male-specific gene, may be involved in the process of male sex differentiation in chicken embryos.

In order to verify the function of Tle4z1 in the process of sex differentiation of chicken embryo, lentivirus interference and overexpression vector of Tle4z1 were designed and constructed (Figure 2A). The constructed vector with GFP fluorescent protein labeling was transfected into DF-1 cells. A large number of fluorescent expressions was observed 48 h later, indicating that the vector can be effectively expressed in vitro. The result showed that after interfering with Tle4z1, the level of Tle4z1 mRNA was downregulated. The interference activity of shRNA2-Tle4z1 was the strongest among the three shRNA targets (P < 0.05), so the target was selected to package lentivirus for follow-up experiments (Figure 2B). Meanwhile, the expression of Tle4z1 increased significantly after overexpression (P < 0.001) (Figure 2C). Further experiments showed that in the E4.5-E18.5 of chicken embryos, the mRNA level of Tle4z1 in female gonads of overexpression group was significantly higher than that of control group in vivo (P < 0.001) (Figure 2E), and Tle4z1 was inhibited after interference treatment in male gonads (P < 0.001) (Figure 2D), indicating that the recombinant vector could effectively interfere/overexpress Tle4z1 during chicken embryo development.

In order to explore the effect of Tle4z1 on the phenotypic differentiation of gonads, the gonads of chicken embryos hatched to 18.5 days after blunt injection of vectors were observed (Figure 3A). The statistical results showed that after interfering with the expression of Tle4z1, there was a significant asymmetric development of bilateral testes in the experimental group compared with the control group (P < 0.0001), while the atrophy of the right ovary in the experimental group was alleviated after overexpression of Tle4z1 (Figure 3B). HE staining of the gonadal sections showed that the female gonads overexpressing Tle4z1 were significantly thinner than normal female embryos, showing male characteristics, while the cortex of gonads after interference with Tle4z1 was significantly thicker, showing female-related characteristics (Figure 3C). These results indicate that Tle4z1 plays an important role in the development of gonads in chicken embryo.

In this study, it has been found that Tle4z1 can affect the gonadal phenotypic differentiation of chicken embryos. We detected the sex differentiation genes by qRT-PCR. The results showed that at E18.5, the expression of genes related to male sex differentiation like Dmrt1, AR, WT1 and Sox9 in the gonads of ZZ embryos in treated group of interference decreased significantly, while the mRNA level of Cyp19a1, which dominate female differentiation, was significantly higher than that in normal ZZ embryos (P < 0.0001) (Figure 4A). After overexpressing Tle4z1, the expression of genes related to male differentiation, like Dmrt1, AR, WT1 and Sox9 increased significantly, while Cyp19a1 decreased significantly (P < 0.0001) (Figure 4C). The above results suggest that regulating the expression of Tle4z1 has an important effect on the sex differentiation of chicken embryos.

Recently, studies have shown that hormones are involved in the process of sex determination and differentiation of chicken embryos (Morris et al., 2018; Wang et al., 2019). For further research on the role of Tle4z1 in the process of sex differentiation of chicken embryos, this study also detected the changes of sex hormone levels during incubation E4.5-E18.5 after interfering or overexpressing Tle4z1 by ELISA. The results showed that testosterone in ZZ chicken embryos interfering with Tle4z1 expression decreased significantly and reached the lowest point at E18.5 (Figure 4B). On the contrary, the level of testosterone in gonad of ZW chicken embryo in overexpression treatment was significantly higher than that in normal female chicken embryo (P < 0.01) (Figure 4D). These results suggest that Tle4z1 can regulate the secretion of testosterone and play an important role in the male differentiation of chicken embryos.