Immortalized mouse lung epithelial 12 (MLE12) and non-cancerous human bronchial epithelial immortalized with Ad12-SV40 2B (BEAS-2B) cell lines were purchased from the American Type Culture Collection and cultured as per their instructions (Wikenheiser et al., 1993) (US patent 4,885,238, dated December 05, 1989). The MLE12 cells were cultured in RPMI 1640 medium (Gibco, cat. #11875085) and BEAS-2B cells were cultured in DMEM/F-12 (Gibco, cat. #11320033), both supplemented with 4% of fetal bovine serum (Serum International, Laval, QC, Canada), insulin-transferrin-selenous acid (ITS) premix (BD Biosciences, San Jose, CA, United States), 10 nM of hydrocortisone (Sigma-Aldrich), 10 nM of estradiol (Sigma-Aldrich), 10 mM of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 2 mM of glutamine (CellGro), 100 U/ml of penicillin, and 100 g/ml of streptomycin. The BEAS-2B cells were grown using plates precoated overnight at 37°C with a mixture of 0.01 mg/ml of fibronectin (Sigma-Aldrich, cat. #F2006-5MG), 0.03 mg/ml of bovine collagen type I (Advanced Biomatrix, cat. #5005-100 ml), and 0.01 mg/ml of bovine serum albumin (heat shock fraction) with the pH of 5.2 (Sigma-Aldrich, cat. #A8022-100G) dissolved in Dulbecco’s Modified Eagle Medium (DMEM) (Corning, cat. #10-013-CM). All experiments were performed on cells between passages 2 and 12 (Kenche et al., 2013, 2016).

We used the first 20 nt of mmu-mito-ncR-805 as a seed region (GAATTGATCAGGACATAGGG) in a BLAT search against the human nuclear and mitochondrial genomes (hg19 and NC_012920) and identified human mitochondrial homolog sequence, 16516-GAAGTAGGAACCAGATGTCG-16497. This human sequence was used to extend the species distribution analysis via the Multiz alignment algorithm available at the UCSC Genome Browser (Blanchette et al., 2004).

The MLE12 or BEAS-2B cells were seeded at the desired density (10,000 cells/well of 96-well plates, 40,000 cells/well of 24-well plates, and 150,000 cells/well of 6-well plates) in their respective media and left to adhere for 6–8 h. The medium was removed and replaced with OptiMEM. After 12 h, the cells were transfected with siPORT NeoFX (Life Technologies, Thermo Fisher Scientific) transfection reagent with 5 nM of RNA oligos (Table 1).

Similar conditions were used for siRNAs targeting TRIB3, which was purchased from Ambion: Silencer Select predesigned siRNA of TRIB3 silencer (cat. #4390771, siRNA ID s105984 targeting RefSeq NM_175093.2 at 2 exons on location 256)¹. A negative control oligo (Ambion, cat. #4390843) was used for siRNA control, as per the manufacturer’s instructions. After 6 h, the transfection complexes were removed, and the cells were incubated in their regular medium for further analysis.

The cells were seeded on coverslips at a density of 40,000 cells/well and transfected with FAM-labeled mmu-CR805 as described above. Twenty-four hours after transfection, the cells were fixed with 3.8% of paraformaldehyde for 20 min at room temperature, washed three times with PBS, and permeabilized with 0.05% of saponin-PBS. Non-specific staining was blocked by incubation with 5% of goat serum in 0.05% of saponin-PBS for 30 min at room temperature before incubating the cells for 2 h at room temperature with anti-Tom20 antibodies (Cell Signaling Technology, cat. #CS42406, at dilution 1:300). The cells were again washed three times, incubated with secondary antibodies conjugated to Alexa Fluor 568 (Invitrogen, cat. #A-11004, at dilution 1:500) for 1 h at room temperature, and washed twice with 0.05% of saponin-PBS. Nuclei were stained with Hoechst 33258 (Sigma-Aldrich, cat. #14530), and the cells were washed once with 0.05% of saponin-PBS and once with PBS and mounted on slides using Gold Antifade mounting medium (Thermo Fisher, cat. #P36930).

Z-stack optical sections of 0.364 μm were acquired at a magnification of 100 times and zoom of 3.37 times using a Leica TCS SP8 (Leica Microsystems) equipped with an HC PL APO CS2 100×/1.4 oil immersion lens objective and hybrid detectors controlled by LAS X 3.5.7.23225 software. Tom20-labeled structures were excited at 578 nm, with an emission peak at 603 nm. FAM-labeled mmu-CR805 was excited at 495 nm, with an emission peak at 520 nm. Lightning Wizard was used for the acquisition of images, and for subsequent deconvolution processing of the images using Leica Lightning GPU-accelerated deconvolution. Green fluorescent carboxylate-modified microspheres, (505/515), 100 nm in diameter (Thermo Fisher, Invitrogen, cat. # F8888) were imaged at the identical conditions, and were used to calculate achieved resolution via full width at half maximum of the central peak of the intensity profile. The achieved resolution was calculated as 135 ± 16 nm. Individual experiments were performed with identical laser output levels, exposure times, and scaling.

The line scan function of LAS X 3.5.7.23225 software was used to further determine the spatial proximity of green (FAM-labeled mmu-CR805) and red (Tom20) signals. Line scans were obtained manually from multiple representative regions under each condition (specified in the figure legends). The fluorescence intensities along the line scan for red and green channels and for green and blue (Hoechst) were imported into Microsoft Excel, plotted as a function of distance (nm) and intensities (Supplementary Table 1). Colocalization was confirmed when the intensity peaks of the green channel coincided with the intensity peaks of the red channel.

RNA was extracted from MLE12 cells using an miRNeasy kit (Qiagen), which enriches the small non-coding RNAs, as per the manufacturer’s protocol. Northern blot analysis was performed using Signosis High Sensitive miRNA Northern blot assay kit (cat. #NB-1001 and 1002; Signosis, Inc., Santa Clara, CA, United States). Probes were 5′-biotin-CCCTATGTCCTGATCAATTC-3′ for the detection of mito-ncR-805 and 5′-biotin-ATCGTTCCAATTTTA GTATATGTGCTGCCGAAGCGAGCAC-3′for U6 (Signosis, cat. #MP-0512). Northern blots were probed with mito-ncR-805, stripped by incubating in 0.5% of sodium dodecyl sulfate (SDS) at 60°C for 60 min, and reprobed with U6 probe for a loading control.

Complementary DNA (cDNA) synthesis was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, United States) on a T100 thermal cycler (Bio-Rad, cat. #186-1096). The following program was used for random primers cDNA synthesis: 25°C for 10 min, followed by 37°C for 2 h, and 85°C for 5 min. TaqMan^® miRNA Looped Primer cDNA synthesis was carried out using the same kit, using the following program: 16°C for 30 min, followed by 42°C for 30 min, and 85°C for 5 min. Primers were from TaqMan assays (Life Technologies and Thermo Fisher Scientific): for the transcripts containing CR of mito-ncR-805^{1–20 nt}, cat. #4427975, the assay ID 002045 was used; for sno55 to normalize the expression levels of small RNAs, cat. #4427975, the assay ID 001228 was used; for TRIB3, Mm00454879-m1 was used; for RNR2, Mm04260181_s1 was used; and for GAPDH, Mm99999915_g1 (cytosolic marker and as a normalization of TRIB3 data) was used. All TaqMan assay qPCRs were performed using TaqMan Universal Master Mix II, no UNG, from Life Technologies (cat. #4440040) and a C1000 Touch Thermal Cycler chassis (Bio-Rad, cat. #1841100) equipped with a CFX96 real-time PCR detection system (Bio-Rad, cat. #1845097) and controlled by CFX Maestro software (Bio-Rad, cat. #12004110). The manufacturer’s standard program 10 min at 95°C, then 40 cycles for 15 s at 95°C, and 1 min at 60°C was used. Real time PCR results were compared using comparative C(T) methods and calculated as folds 2^–ΔΔCt (Schmittgen and Livak, 2008). The relative abundance of mmu-CR805 in different fraction was calculated using identical inputs of RNA as Ct^{fraction transfected} − Ct^{fraction total} (Wang et al., 2020).

Separation of mitochondrial and cytosolic fractions was performed using a mitochondrial isolation kit from Sigma-Aldrich (cat. #MITOISO2) according to the manufacturer’s instructions for the isolation of the mitochondria from the cells with modifications. Briefly, the cells grown on plates were washed twice with PBS, scraped into lysis buffer, which is 1 time extraction buffer supplemented with protease inhibitory cocktail (Sigma-Aldrich Roche Biochemical Reagents) and 1:200 dilution of cell lysis solution, incubated 5 min on ice, and diluted with two volumes of 1 time extraction buffer. Lysates were centrifuged at 600 × g for 10 min at 4°C. One-third of the supernatant was removed for the analysis of the total fraction, which was further divided for protein analysis and RNA extraction. The remainder of the lysates were centrifuged at 11,000 × g for 10 min at 4°C. The supernatant was carefully removed and saved for further analysis as the cytosolic fraction, which was divided for protein and RNA analyses. Mitochondrial pellets were considered crude mitochondria and further purified by resuspension in 16% Percoll-PBS using the following Percoll gradient: 2 ml of 40% Percoll at the bottom, overlayed with 2 ml of 23% Percoll, followed by 16% of Percoll containing crude mitochondria. Percoll gradients were prepared using 1 time storage buffer provided in the mitochondrial isolation kit from Sigma-Aldrich as per the manufacturer’s instructions. The gradient was separated using SW41 Ti swinging bucket rotor 3,33,790 at 31,000 × g for 8 min at 4°C in a Beckman Coulter Optima XPN-100 ultracentrifuge.

The mitochondrial band was harvested at the lowest interface, diluted with four volumes of ice-cold 1 time storage buffer, and centrifuged in a fixed-angle Sorvall Legend RT centrifuge at 17,000 × g at 4°C for 10 min. The purified mitochondria were resuspended in 150 μl of 1 times storage buffer and treated with RNase I (Ambion, cat. #AM2294, 250 U/150 μl) at 4°C for 1 h to eliminate cytosolic RNAs. The treated mitochondria were suspended in Trizol for further RNA extraction and analysis.

The nuclear extracts were prepared by modification of the protocol by Wang et al. (2000). Briefly, MLE12 cells, collected by trypsinization, were resuspended in 10 mM of HEPES (pH 7.9), 10 mM of KCl, 1.5 mM of MgCl₂, and 0.5 mM of dithiothreitol supplemented with protease inhibitory tablet (Sigma-Aldrich Roche Biochemical Reagents), incubated for 15 min on ice, followed by the addition of Non-idet P-40 to a final concentration of 0.325%. The cells were allowed to swell 10 min on ice with occasional shaking. Nuclear pellets were separated by centrifugation at 2,500 rpm for 4 min at 4°C. The nuclear pellets were washed once in the lysis buffer and resuspended in 20 mM of HEPES (pH 7.9), 0.45 M of NaCl, 1 mM of ethylenediaminetetraacetic acid (EDTA), 0.5 mM of dithiothreitol, 0.3 U/μl of RNase inhibitor (RNaseOUT recombinant ribonuclease inhibitor; Thermo, cat. #10777019), and 1 protease inhibitor tablet (cOmplete mini, EDTA free; Sigma-Aldrich Roche Biochemical Reagents) per 10 ml of lysis buffer. The nuclei were incubated with rocking at 4°C for 30 min. The nuclear extracts were cleared by centrifugation at 12,000 rpm for 10 min. The supernatant was divided for Western blot analysis and for RNA extraction and analysis. To eliminate cytosolic RNAs, the nuclear pellets were resuspended in the lysis buffer supplemented with 0.3 M of sorbitol and treated with RNase I (Ambion, cat. #AM2294, 100 U/100 μl) at 4°C for 1 h and suspended in Trizol for further RNA analysis.

Western blotting was performed as described by Kenche et al. (2013). Briefly, the cells were either lysed in RIPA buffer (150 mM of NaCl, 1.0% of Non-idet P-40 or 0.1% of Triton X-100, 0.5% of sodium deoxycholate, 0.1% of SDS, 50 mM of Tris-HCl, pH 8.0) or the subcellular fractions were obtained as described above. Proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes (Bio-Rad, cat. #162-0115) by using a Trans-Blot Turbo transfer system (Bio-Rad, cat. #1704150) in Trans-Blot Turbo 5 times transfer buffer (Bio-Rad, cat. #10026938). High-molecular-weight proteins run using 1.5-mm of SDS gels were transferred using the setting of 25 V, 1.3 A constant, for 15 min (10 min for H3). Membranes were blocked in Tris-buffered saline (TBS) with 0.1% of Tween (TBST) supplemented with 5% of non-fat dry milk (Blotto; Santa Cruz Biotechnology, cat. #sc-2324) for 1 h at room temperature, washed with TBST twice, and incubated with primary antibodies in either TBST with 5% of bovine serum albumin or 5% of milk overnight at 4°C. The primary antibodies against the following were used: lactate dehydrogenase A (LDHA; Cell Signaling, cat. #2012, 1:1,000), succinate dehydrogenase subunit A (SDHA; Abcam, cat. #ab14715, 1:1,000), H3 (Cell Signaling, cat. #9715, 1:4,000), nucleophosmin (Abcam, cat. #ab10530 [FC82291], 1:1,000), β-actin (Abcam, cat. #ab6276, 1:10,000), TRIB3 (LSBio, LifeSpan BioSciences, cat. #LS-C164592, 1:250), and phospho-Akt (Trh308) (Cell Signaling, cat. #2965, 1:500). The blots were washed three times in TBST for 5 min each, incubated in TBST supplemented with 5% of milk with secondary antibodies for 1–2 h at room temperature, washed three times with TBST, and developed using Pierce ECL Western blotting substrate (Thermo Scientific, cat. #32106). The secondary antibodies included were goat anti-mouse IgG horseradish peroxidase (Thermo Fisher Scientific, cat. #31430, 1:5,000) and goat anti-rabbit IgG horseradish peroxidase (Thermo Fisher Scientific, cat. #31460, 1:5,000). Probed membranes were imaged using ChemiDoc MP imaging system (Bio-Rad, cat. #17001402) equipped with a blot/UV/stain-free sample tray for ChemiDoc MP/ChemiDoc imaging systems (Bio-Rad, cat. #12003028) and processed using Bio-Rad Image Lab version 6.1.0 (build 7 SE for Mac).

The MLE12 cells were transfected with either CR805 or a non-targeting sequence; 30 h post-transfection, the cells were exposed to 20 mM [U-¹³C]glucose for 12 h and harvested. Metabolic flux was determined following ¹³C label incorporation into various metabolites. After incubation, 0.5 ml of removed medium was saved from one well of each condition and from each plate. The cells were washed while attached on the plates with PBS (three times, at room temperature wash, moving to 10°C, and completed with ice-cold PBS wash), fixed by adding 1 ml of 80% ethanol cooled at −20°C, collected by scraping and placing on dry ice ethanol bath, and stored at −80°C for further analysis.

Glucose isotopic enrichment was determined according to Gao et al. (2015) with modifications. Briefly, the glucose was extracted by the addition of 500 μl of ice-cold ethanol into 50 μl of a medium. Samples were mixed and incubated on ice for 30 min. The samples were centrifuged at 4°C for 10 min at 14,000 rpm, and ethanol was transferred to GC/MS vials and evaporated to dryness in a SpeedVac evaporator. Glucose was converted into its pentaacetate derivative by its reaction with 150 μl of acetic anhydride in pyridine (2:1 [vol/vol]) at 60°C for 30 min. The samples were evaporated to dryness, and the glucose derivative was reconstituted in 80 μl of ethyl acetate and transferred to a GC/MS insert. The samples were injected in duplicates, and the masses 331–337, containing M0–M5 isotopomers, were monitored. Enrichment was determined as a ratio of M5 to Σ_M0–M5.

The MLE12 cells were treated as previously described (Yang et al., 2008). Briefly, cell extract was vortexed and sonicated using an ultrasonicator alternating 30 s on 30 s off for 10 min. The cells were pelleted by centrifugation at 4°C for 10 min at 14,000 rpm. The supernatant was transferred to GC/MS vials and evaporated to dryness under a gentle stream of nitrogen. Keto and aldehyde groups were reduced by the addition of 10 μl of 1 N NaOH and 15 μl of NaB₂H₄ (prepared as 10 mg/ml in 50 mM of NaOH). After mixing, the samples were incubated at room temperature for 1 h, acidified by 55 μl of 1 N HCl (dropping the acid slowly), and evaporated to dryness. Fifty microliters of methanol were added to precipitate boric acid. Internal standard was added (10 μl of 17:0 formic acid, 0.1 mg/ml). The samples were evaporated to dryness and reacted with 40 μl of pyridine and 60 μl of tert-butylbis(dimethylsilyl) trifluoroacetamide with 10% trimethylchlorosilane (Regisil) tert-butyl(dimethylsilyl) at 60°C for 1 h. Resulting tert-butyl(dimethylsilyl) derivatives were injected into the GC/MS equipment.

Analyses were carried out on an Agilent 5973 mass spectrometer equipped with a 6890 Gas Chromatograph. An HP-5MS capillary column (60 m × 0.25 mm × 0.25 μm) was used in all the assays, with a helium flow of 1 ml/min. The samples were analyzed in selected ion- monitoring mode using electron impact ionization. Ion dwell time was set to 10 ms. The following metabolites were detected: α-ketoglutarate, alanine, aspartate, citrate, fumarate, glutamate, lactate, malate, oxaloacetate, pyruvate, serine, and succinate.

Fractional metabolic flux was determined according to the relationship between the precursor ([U-¹³C]glucose) and the product ([¹³C]-labeled metabolites). Molar percent enrichment (MPE) of the metabolites was determined in the same manner as for glucose (refer to GC/MS conditions). Fractional metabolic flux was calculated as follows: MPE_product/MPE_precursor. The absolute metabolic rate shown in Figures 4A–C was determined as a product of the fractional metabolic flux and pool size, i.e., the relative concentration of the metabolite of interest (Supplementary Table 2).

The MLE12 cells were seeded at 10,000 cells/well (80 μl) and transfected with either CR805 or a negative control as described above. Forty hours after transfection and 1 h before the measurements, RPMI medium was changed to unbuffered DMEM (Seahorse Bioscience, United States) supplemented with 1% of fetal bovine serum, 4 mM of glutamine (Sigma-Aldrich), 2 mM of sodium pyruvate (Gibco), 10 mM of glucose (Sigma-Aldrich), 100 μM of insulin (Sigma-Aldrich), and mitochondrial bioenergetics were measured using a Seahorse XFe96 extracellular flux analyzer and the XF Cell Mito Stress kit (Seahorse Bioscience) as described before (Zhang et al., 2018). Real-time measurement of oxygen consumption rate was obtained as per the manufacturer’s instructions by sequential treatment with 1 μM of oligomycin, 1 μM of carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP), and 1 μM mixture of rotenone/antimycin A, and normalized to total protein amount measured by a Pierce BCA protein assay kit (Thermo Scientific). Basal respiration was calculated as the average of the first three readings before the addition of oligomycin minus the average of the last 3 readings after the addition of rotenone addition. Proton leak was calculated as the average from three readings after the addition of oligomycin minus the average of the last three readings. ATP production was calculated as basal respiration minus the proton leak. Maximal respiration was calculated as the average of the three readings after FCCP stimulation minus the average of the last three readings. Spare respiratory capacity was calculated as the maximal respiration minus the basal respiration. Coupling efficiency was calculated as 100× ATP production/non-mitochondrial respiration, where the non-mitochondrial respiration was the average of the last three readings after the addition of rotenone and antimycin A (Supplementary Table 3).

Mitochondrial membrane potential was measured using a JC-10 mitochondrial membrane potential assay kit (Abcam, cat. #ab112134) according to the manufacturer’s instructions. The results were read by a BioTek Synergy HT spectrophotometer.

The cigarette smoke extract (CSE) was prepared using the method described by Kenche et al. (2013). Research-grade 1R5F cigarettes (Kentucky Tobacco and Health Research Institute, Lexington, KY, United States) were used to prepare the CSE. The CSE was made fresh for each experiment by bubbling the smoke from 1 cigarette through 5 ml of serum-free medium in a 15-ml conical tube and filtering it through a 0.22-μm of filter to remove large particles and to maintain the sterility. This solution was designated 100% CSE and diluted in a culture medium to yield the concentrations specified for each experiment.

Cells were plated at 50,000 cells/ml in 24-well plates. The cells were transfected as previously described; 20 h post-transfection, cells were exposed to 10% of CSE for 30 min. The medium was removed, the cells were washed twice with PBS, and fresh medium was added. The Cells were counted at time points specified in the figure legends.

Unless specified in text, data are expressed as means and standard deviations from at least three independent experiments. Fold-change for qPCR was determined using the 2^ΔΔCT method (Livak and Schmittgen, 2001; Schmittgen and Livak, 2008). Student’s t-tests were used to determine the P-values. P-values of ≤0.05 were considered statistically significant. ANOVAs were used to determine whether multiple groups differed from each other.

Since we focused on the delivery of a “functional bit” of mmu-mito-ncR-805 and its human ortholog, we wanted to see if those oligos have any biological activity in the transfected cells. According to our previous research (Blumental-Perry et al., 2020), the mmu-mito-ncR-805 accelerates the repopulation of cells lost after the stress from smoke, presumably due to the higher bioenergetics of cells with high levels of mmu-mito-ncR-805 and their ability to divide faster (Blumental-Perry et al., 2020). We therefore introduced mmu-CR805, its human ortholog hsa-LDL1, and the full-length ncR-805^FL into MLE12 cells and mmu-CR805 and hsa-LDL1 into BEAS-2B cells and compared their growth rates with and without stress. Figures 2A,B demonstrate that over 48 h, all the mmu-mito-ncR-805 derivatives and the human orthologs induced faster cell division of MLE12 and BEAS-2B cells, with respective orthologs being slightly less efficient than species-specific oligos but still significantly different from cells transfected with non-targeting oligos. Importantly, the growth rates of MLE12 cells carrying the functional bit oligo, mmu-CR805, and the full-length synthetic transcript, ncR-805^FL, were the same, supporting the idea that the 20-nt conserved region of mmu-mito-ncR-805 is indeed a functional bit. Next, the MLE12 and BEAS-2B cells were stressed by short-term exposure to CSE (30 min, 10% of CSE). This exposure was titrated to cause the death of approximately 50% of the cell population. Both the mouse and human orthologs conferred faster cell division following stress (Figures 2C,D). Therefore, we concluded that the first 20-nt segments of mmu-mito-ncR-805 and its human orthologous transcript are biologically active and function similarly to mito-ncR-805, which justified the functional studies that follow.

We previously demonstrated that mmu-mito-ncR-805 can be found in the nuclei of cells recovering from stress and is associated with an increase in the mRNA levels of genes for multiple subunits of ETC complexes and metabolic enzymes, including the enzymes of the TCA cycle and related pathways (Blumental-Perry et al., 2020). We therefore examined the metabolic flux of the TCA intermediates in MLE12 and BEAS-2B cells transfected with mmu-CR805 and hsa-LDL1, respectively, by direct measurements of metabolic flux using stable isotope incorporation and mass isotopomer analyses. Neither mmu-CR805 nor hsa-LDL1 affected the glycolytic flux, as seen from the small changes in alanine and lactate (Figures 3A,C,D); however, they increased the absolute flux of TCA intermediates (Figures 3B,E, and Supplementary Table 2). Moreover, the significant increase in fumarate/malate is indicative of further channeling of energy to increase pyruvate production via the so-called mitochondrial gas pedal (Gellerich et al., 2013). This corresponds to the same response we previously characterized in the MLE12 cells recovered from CSE exposure (Blumental-Perry et al., 2020). Therefore, the transfection with 20 nucleotides of mito-ncRNA-805 is sufficient to promote a metabolic response (Figure 3F).

We next used the XF Cell Mito Stress kit to measure the mitochondrial oxygen consumption rate in MLE12 cells at baseline and in response to the overexpression of different mmu-mito-ncR-805 oligos or their human orthologs of the functional bits (Figure 4A). We found that all tested oligos increased the maximal mitochondrial respiration and spared the respiratory capacity (Figures 4B,C and Supplementary Table 3). The rates of non-mitochondrial respiration were not affected, which was in agreement with the metabolomic data from the previous section, and demonstrated that it is not influenced by mmu-CR805 or by hsa-LDL1 (Figures 3, 4A).

High activity of the enzymes of the TCA cycle, reflected in our metabolomic data, and ETC, as indicated by the Mito Stress test results, should result in a higher mitochondrial membrane potential (ΔΨm). We therefore measured ΔΨm using a JC-10 assay (Reers et al., 1991) and found that the MLE12 cells expressing mmu-CR805 or hsa-LDL1 had lower depolarization of the mitochondrial membrane (higher ΔΨm) (Figure 4D). A similar analysis was performed in BEAS-2B cells either transfected with or not with mmu-ncR-805^FL, mmu-CR805, or hsa-LDL1. The mmu-ncR-805^FL, mmu-CR805, and hsa-LDL1 increased the maximal mitochondrial respiration, spared the respiratory capacity and the mitochondrial membrane potential (Figures 4E–H). In conclusion, both the mitochondrial respiration and the membrane polarization are increased by forced overexpression of the CR of mmu-mito-ncR-805 or its human ortholog in both the murine and human alveolar epithelial cells.

Akt1 kinase is activated during the stress of smoking (Nakayama et al., 2002; Nicoletti-Carvalho et al., 2010). The Akt1 stress-related activation is not a common feature of stress response, where downregulation of prosurvival Akt1 activity is expected, but a response is specific to the stress from smoke and nicotine exposure. It can have numerous effects, including but not limited to increased mitochondrial bioenergetics (Li et al., 2013). We previously found that a decrease in the mRNA levels of the Akt1 inhibitor pseudokinase, TRIB3 (Nicoletti-Carvalho et al., 2010; Mondal et al., 2016) coincides with the recovery of cells from the stress due to smoke and with an increase in the levels of mmu-mito-ncR-805 in MLE12 cells (Figure 5A) (Blumental-Perry et al., 2020). We therefore asked if the bioenergetic effect of mmu-CR805 may culminate in the lower levels of TRIB3 mRNA. Forced expression of mmu-CR805 indeed resulted in a decrease in the levels of TRIB3 mRNA and protein as well as an increase in Akt1 phosphorylation (Figures 5B–E). Depletion of mmu-mito-ncRNA-805 with antisense inhibitor, AI805 [refer Supplementary Figure 3 and (Blumental-Perry et al., 2020)] caused an increase in the expression of TRIB3 mRNA, but only in the stressed cells (Figure 5B). Without stress, the cells were able to function with lowered levels of mmu-ncR-805 without any correlation with TRIB3 levels (Figures 5C,D and Supplementary Figure 3).

We compared the recovery after acute CSE exposure of MLE12 cells transfected with non-targeting RNA, mmu-CR805, siRNA-TRIB3 (Figures 5C–H), and AI805. Both mmu-CR805 and siRNA-TRIB3 promoted post-stress cell growth, with mmu-CR805 being more efficient (Figure 5I), supporting the idea that mmu-CR805 has broader downregulation than that of the effects of TRIB3 mRNA. As expected, cells carrying AI805 grew slower after stress (Figure 5I). Therefore, one of the actions of mito-ncR-805 may culminate in the downregulation of TRIB3 expression, which in turn promotes higher activity of the Akt1 (Mondal et al., 2016) and cell health.