The seabuckthorn carpenterworm E. hippophaecolus is a common forestry pest in China, the collection of which was made with the direct permission of the Jianping forest bureau. This species is not included in the “List of Endangered and Protected Animals in China.” All operations were performed according to ethical guidelines in order to minimize pain and discomfort to the insects.

Eogystia hippophaecolus were collected from a damaged seabuckthorn forest using light and sex pheromone traps from the middle of June to the end of July in 2014 and 2015 in Jianping, Liaoning, China. Antennae, legs (propodeums, mesopodiums, metapedes), external genitals, labipalps from adult males and females were excised and stored in RNAlater (Ambion, Austin, TX, United States). Then all samples were taken back indoor and stored at -80°C.

Total RNA was extracted from the antennae of 10 males and 10 females using TRIzol reagent (Ambion) and the RNeasy Plus Mini Kit (No. 74134; Qiagen, Hilden, Germany) following the manufacturer’s instructions. RNA quantity was detected using the NanoDrop 2008 (Thermo, Waltham, MA, United States). cDNA was synthesized from total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser to remove gDNA (No. RR047A; TaKaRa, Shiga, Japan), and immediately used for PCR amplification or stored at -20°C until further use.

Fluorescence quantitative real-time PCR was performed to examine the expression of EhipPBP1 in six tissues with chemosensory functions of females and males. Antennae, legs (including the propodeum, mesopodium, and metapedes), external genitals, labial palps were collected from ten female and male E. hippophaecolus, respectively, and total RNA of six tissues with chemosensory functions were extracted following the methods described above. The propodeum, mesopodium, and metapedes RNA were accounted for one third of all leg RNA. NanoDrop 2008 and agarose gel electrophoresis examined density and quality of RNA. cDNA Synthesis was performed as previously indicated. Gene-specific primers were designed using Primer3¹. The sequence of the gene-specific primers of EhipPBP1 were as follow: forward primer: 5′-CGAATGCAAACAAGAGCTGA-3′; reverse primer: 5′- TTTGC GTTTCCATGGTGTAA-3′. According to Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) (Bustin et al., 2009), an appropriate reference gene is fundamental for optimum qPCR analysis. The sequences of the actin gene primers were based on those reported in previous publication and were as follow: forward primer 5′-CGACT TCGAACAGGAGATGG -3′; reverse primer 5′- TCGTCTCATGAATGCCACAG -3′ (Hu et al., 2016). A PCR analysis was conducted using the Bio-Rad CFX96 PCR System (Hercules, CA, United States). SYBR Premix Ex Taq II (No. RR820A; TaKaRa) was used for the PCR reaction under a two-steps amplification. Each PCR reaction was conducted in a 25 μl reaction mixture containing 12.5 μl of SYBR Premix Ex Taq^TM II, 1 μl of each primer (10 mM), 2 μl of sample cDNA (2.5 ng of RNA), and 8.5 μl of dH₂O (sterile distilled water). The RT-qPCR cycling parameters were as follow: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and 65°C to 95°C in increments of 0.5°C for 5 s to generate the melting curves. To examine reproducibility, each qPCR reaction for each tissue was performed in three biological replicates and three technical replicates, in which each biological replication was with 10 individuals, each biological replication with three technical replicates. Negative controls without either template were included in each experiment. Bio-Rad CFX Manager (version 3.1.1517.0823) was used to normalize expression based on ΔΔCq values, with female labial palps in analyze mode as control samples, and the 2^-ΔΔCT method was used (the amplification efficiency of EhipPBP1 was equal to 100%) (Livak and Schmittgen, 2001). Before comparative analyses, we examined the normal distribution and performed an equal variances test to make sure the data followed a normal distribution and presented an equal variances. The results of comparative analysis of EhipPBP1 in four tissue types were assessed by a one-way nested analysis of variance (ANOVA), followed by Tukey’s honestly significance difference (HSD) tests implemented in SPSS Statistics 18.0 (IBM Corporation, United States) Values are presented as means ± SE.

Analysis of the antennal transcriptome of E. hippophaecolus indicates that the EhipPBP1 gene has an open reading frame (ORF) >400 bp that includes a sequence encoding a signal peptide, and so it is a complete gene (Hu et al., 2016). Part of the coding region (ORF) of EhipPBP1 was amplified by polymerase chain reaction (PCR) with the following gene-specific primers: forward primer, 5′-GGACAACTGCAA CTCTTTGTCG-3′; reverse primer, 5′-GAGACCACAGATGGTGATGAGC-3′ and cDNA of male antenna as template. Primers were designed to contain the full ORF sequence, so target band sequence contain all ORF and longer than ORF. PCR was performed using Ex Taq DNA polymerase (Takara, Dalian, China) with 34 cycles of 98°C for 10 s, 55°C for 50 s, and 72°C for 5 s. The PCR products were digested and ligated into the pEASY-T Easy Vector (TransGen, Beijing, China). The recombinant plasmid was transformed into Escherichia coli DH5α competent cells and plated onto LB agar medium containing ampicillin (1 ml LB: 1 μl ampicillin). Colony PCR was used to select positive clones and the amplified DNA was then sequenced (Qingke, Beijing, China).

From the coding sequence of EhipPBP1, the ORFs were deduced using the Open Reading Frame Finder². Putative signal peptides were predicted using the SignalP 4.1 Server³ (Petersen et al., 2011). The molecular weights of the proteins were predicted using SWISS-PROT⁴. Three-dimensional models of EhipPBP1 were predicted using the SWISS MODEL online tools⁵ (Biasini et al., 2014). Template search with Blast (Altschul et al., 1997) and HHBlits (Remmert et al., 2011) in default parameters has been performed against the SWISS-MODEL template library (SMTL, last update: 2017-12-06, last included PDB release: 2017-12-01). The templates with the highest quality have then been selected for model building. Models are built based on the target-template alignment using ProMod3 (Guex and Peitsch, 1997) in default parameters. The rationale underlying the model evaluation was based on a Ramachandran plot (Ramachandran et al., 1963).

The coding sequence of EhipPBP1 (441 bp), omitting the sequence encoding the signal peptide was amplified using cDNA from male antennae with Ex Taq DNA polymerase (TaKaRa) by PCR using gene-specific primers containing the restriction enzyme sites NdeI in the forward primer (5′-CATATGGAGATAGATAGTTCAGC AGAAACAA-3′) and BglII in the reverse primer (5′-AGATCTTTACATTTCAGT AAGTACTTCAGTAACG-3′). The amplification conditions were 34 cycles of 98°C for 10 s, 55°C for 50 s, and 72°C for 5 s. After analysis on a 1.5% agarose gel, PCR product was purified with the Axygen Gel Extraction Kit (Axygen, NY, United States) and cloned into pEASY-T Easy Vector (Transgen, Beijing China). Positive clones were selected by PCR and sequenced. Plasmids were extracted with the Axyprep Plasmid Miniprep Kit (Axygen, NY, United States), and digested with NdeI and BglII, and the fragment encoding the correct EhipPBP1 sequence was purified and sub-cloned into the bacterial expression vector pET30a (+) (Novagen, Madison, WI, United States), and then verified by sequencing. Plasmids containing the correct insert (pET30a-EhipPBP1) were then transformed into E. coli BL21 (DE3) pLysS cells. Expression of EhipPBP1 was induced with isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 1 mM at 37°C for 6 h. Samples were then sonicated and centrifuged with 6000 g at 4°C for 15 min, and the supernatant and pellet were analyzed by sodium dodecyl sulfate polyacrylamide-gel electrophoresis (SDS-PAGE). EhipPBP1 occurred as inclusion bodies in pellet, which were purified by Ni-ion affinity chromatography (Qiagen, Hilden, Germany). Soluble protein was obtained by denaturation of the inclusion bodies, followed by renaturation with 8–0.5 M urea renaturation buffer. The protein was concentrated by the use of Amicon Ultra concentrators with a 10 kDa cutoff (Millipore, Billerica, MA, United States), and purity was confirmed by SDS-PAGE analysis. The concentration of EhipPBP1 protein was measured by the Bradford method with BSA as the standard protein.

Polyclonal antibody were obtained by subcutaneous injection of adult rabbits with 300 μg of recombinant EhipPBP1 protein, followed by three additional injections of 250 μg on the 21st, 35th, and 49th day. Two rabbits were used in a parallel study. The proteins were emulsified with an equal volume of Freund’s complete adjuvant on the first injection and Freund’s incomplete adjuvant on the second and subsequent injections. The polyclonal sera was tested by enzyme-linked immunosorbent assay (ELISA). Rabbits were exsanguinated 10 days after the last injection, and then used Protein G (GE Healthcare, United States) purification sera to obtain polyclonal antibody.

Protein extracts were separately prepared from female and male E. hippophaecolus antennae, legs (extract propodeum, mesopodium, and metapedes protein first, then mixing one-third of them), external genitals, and labial palps. Protein concentrations were measured by the Bradford method with BSA as the standard protein (Bradford, 1976). After protein electrophoresis under denaturing conditions (15% SDS-PAGE), duplicate gels were prepared for analysis. One gel was stained with 0.1% Coomassie brilliant blue R-250 (in 10% acetic acid and 45% methanol), and proteins were transferred from the other gel by transfer membrane electrophoresis onto nitrocellulose membrane (Millipore). After electrophoresis, the membrane was incubated with 5% powdered skimmed milk (in tris-buffered saline containing 0.05% Tween 20) overnight. The blocked membrane was incubated sequentially with anti-PBP1 antibody at a dilution of 1:2,000 for 2 h, and then alkaline phosphatase-conjugated goat anti- rabbit IgG-HRP (Sigma-Aldrich, St. Louis, MO, United States) at a dilution of 1:1,000 for 1 h. Immunoreactive bands were detected using 5-bromo-4-chloro-3-indolyl phosphate (BCIP, 0.15 mg/ml) and nitrotetrazolium blue chloride (NBT, 0.3 mg/ml) at a ratio of 1:2.

N-phenyl-1-naphthylamine (1-NPN) was selected for use as a selectively fluorescent probe to measure the affinity of ligand binding to recombinant EhipPBP1 (Yin et al., 2012; Zhong et al., 2012). Seven pheromone and analog compounds were a gift from Professor Zhang Jintong of Shanxi Agricultural University (Table 1) and were >97% pure. A fluorescence binding assay was performed on a multiscan Spectrum Molecular Device SpectraMax i3 (Thermo Scientific, Wilmington, DE, United States) with an excitation wavelength of 337 nm and recording of emission spectra between 380 and 520 nm. Parameter selection was such that the slit widths for both excitation and emission were 10 nm. Spectra were recorded using high-speed scanning. 2 μM solution of EhipPBP1 was prepared in 20 mM Tris-HCl buffer (pH 7.4), and the ligands were dissolved in chromatographically pure methanol as 1 mM stock solutions. The affinity of EhipPBP1 for the labeled probe was determined by adding aliquots of 1-NPN stock solution to give final concentrations of 2–20 μM. The affinity of EhipPBP1 for the different ligands was estimated by competitive binding assays with both 1-NPN and EhipPBP1 at 2 μM, and final concentrations of seven competitive pheromone and analog compounds in the range of 2–20 μM. To determine dissociation constants, intensity values corresponding to maximum fluorescence emission were plotted against free ligand concentrations. Assuming that the protein was 100% active and that the stoichiometric ratio between protein and ligand was 1:1 at saturation, the bound ligand was determined from the fluorescence intensity values. EhipPBP1 binding with every component was replicated six times. The curves were then linearized using Scatchard plots to calculate K_1-NPN values. Dissociation constants of the competitors (K_i) were calculated from the corresponding IC₅₀ values by the following equation: K_i = [IC₅₀]/(1 + [1–NPN]/K_1-NPN), where [IC₅₀] was the concentration of a competitor that caused a 50% reduction in the fluorescence intensity, [1–NPN] represented the free concentration of 1–NPN, and K_1-NPN represented the dissociation constant of the complex of protein with 1–NPN (Campanacci et al., 2001).

The coding sequence was identical to the previously identified PBP1 sequence in the E. hippophaecolus transcriptome. The EhipPBP1 ORF was 498 bp, and it encoded 166 amino acids, with a predicted size of 18.65 kDa and an isoelectric point of 4.01, and a 19 amino acid N-terminal signal peptide. The full-length ORF sequence was submitted to GenBank, with the accession number KX655931. A prediction of the three-dimensional structure of EhipPBP1, made with SWISS MODEL online tools, is shown in Figure 1. The QMEAN total score was 2.49. The structure contained seven α-helices: Ala25–Leu46 (α1), Glu50–Lys61 (α2), Cys73–Lys81 (α3), His93–Lys102 (α4), Glu107–Lys122 (α5), Glu130–Gln147 (α6), and Met154–Thr163 (α7). Six cysteine residues were predicted to form three pairs of disulfide bonds, Cys42–Cys77, Cys73–Cys131, and Cys120–Cys140, connecting α1–α3, α3–α6, and α5–α6, respectively, which corresponded to the known structure of PBPs.

Induction with IPTG resulted in a protein band on SDS-PAGE at about 16 kDa, consistent with the expected size (Supplementary Figure S1). After lysis and centrifugation of the cells, the recombinant protein was mainly located in the sediment, indicating that EhipPBP1 was expressed as an inclusion body. The recombinant protein was purified by affinity chromatography, and then denatured and renatured to obtain soluble purified protein.

Tissue-expression profile of the EhipPBP1 gene (Figure 2) indicated that it was most highly expressed in the antennae compared with other tissues, and that expression in male antennae was significantly higher than in female antennae. No difference in expression was observed between the different non-antennal tissues, with the exception of the female external genitals, in which there was no detectable expression.

Western blots of protein extracts from four tissues in male and female E. hippophaecolus showed that EhipPBP1 was expressed in male antennae, labipalps, legs, and external genitals, as well as female antennae and legs. According to the gradation of stripe color, PBP1 expression was highest in the antennae, particularly in males; apart from the antennae, expression was highest in the legs (Figure 3).

The 1-NPN probe, in isolation, produced weak fluorescence on excitation at 337 nm. With the addition of EhipPBP1 protein, the emission spectrum of 1-NPN shifted from 480 to 400 nm, with a considerable, 1-NPN-dose-dependent increase in fluorescence intensity (Figure 4). Use of the Scatchard method to linearize the curve resulted in a dissociation constant (K_1-NPN) of 3.7 ± 0.06 μM. In competitive binding assays with 1-NPN and elements of the female pheromone of E. hippophaecolus, the calculated K_d values were 1.58 ± 0.21 μM for E3-14:Ac and 1.18 ± 0.01 μM for Z7-14:Ac, indicating a greater affinity of EhipPBP1 for Z7-14:Ac (Figure 4 and Table 1). EhipPBP1 also demonstrated binding to structural analogs of the female pheromone. For E9-14: Ac, the K_d was 6.30 ± 0.52 μM, but binding to Z9-14:Ac do not reach 50% in the range of test concentrations, and so we could not calculate the K_d. No binding was detected with the structural analog Z3-14:Ac. Binding to 14 carbon-residue alcohols gave K_d values of 2.36 ± 0.20 μM for Z3-14: OH and 3.15 ± 0.32 μM for Z7-14:OH (Figure 4 and Table 1).