<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Physiol.</journal-id>
<journal-title>Frontiers in Physiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Physiol.</abbrev-journal-title>
<issn pub-type="epub">1664-042X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fphys.2016.00687</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Physiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Integrated Analysis of Long Non-coding RNAs (LncRNAs) and mRNA Expression Profiles Reveals the Potential Role of LncRNAs in Skeletal Muscle Development of the Chicken</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Li</surname> <given-names>Zhenhui</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/376397/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Ouyang</surname> <given-names>Hongjia</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/402663/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Zheng</surname> <given-names>Ming</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/402658/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Cai</surname> <given-names>Bolin</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/402655/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Han</surname> <given-names>Peigong</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/402661/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Abdalla</surname> <given-names>Bahareldin A.</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/401688/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Nie</surname> <given-names>Qinghua</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>&#x0002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/378467/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Zhang</surname> <given-names>Xiquan</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Department of Animal Genetics, Breeding and Reproduction, College of Animal Science, South China Agricultural University</institution> <country>Guangzhou, China</country></aff>
<aff id="aff2"><sup>2</sup><institution>Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding and Key Lab of Chicken Genetics, Breeding and Reproduction, Ministry of Agriculture</institution> <country>Guangzhou, China</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: Xiaogang Wu, Institute for Systems Biology, USA</p></fn>
<fn fn-type="edited-by"><p>Reviewed by: Stephen K. Anderson, National Cancer Institute-Frederick, USA; Hongli Du, South China University of Technology, China; Zhonglin Tang, Institute of Animal Science, Chinese Academy of Agricultural Sciences, China</p></fn>
<fn fn-type="corresp" id="fn001"><p>&#x0002A;Correspondence: Qinghua Nie <email>nqinghua&#x00040;scau.edu.cn</email></p></fn>
<fn fn-type="other" id="fn002"><p>This article was submitted to Systems Biology, a section of the journal Frontiers in Physiology</p></fn></author-notes>
<pub-date pub-type="epub">
<day>09</day>
<month>01</month>
<year>2017</year>
</pub-date>
<pub-date pub-type="collection">
<year>2016</year>
</pub-date>
<volume>7</volume>
<elocation-id>687</elocation-id>
<history>
<date date-type="received">
<day>25</day>
<month>10</month>
<year>2016</year>
</date>
<date date-type="accepted">
<day>23</day>
<month>12</month>
<year>2016</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x000A9; 2017 Li, Ouyang, Zheng, Cai, Han, Abdalla, Nie and Zhang.</copyright-statement>
<copyright-year>2017</copyright-year>
<copyright-holder>Li, Ouyang, Zheng, Cai, Han, Abdalla, Nie and Zhang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>Long non-coding RNAs (lncRNAs) play important roles in transcriptional and post-transcriptional regulation. However, little is currently known about the mechanisms by which they regulate skeletal muscle development in the chicken. In this study, we used RNA sequencing to profile the leg muscle transcriptome (lncRNA and mRNA) at three stages of skeletal muscle development in the chicken: embryonic day 11 (E11), embryonic day 16 (E16), and 1 day after hatching (D1). In total, 129, 132, and 45 differentially expressed lncRNAs, and 1798, 3072, and 1211 differentially expressed mRNAs were identified in comparisons of E11 vs. E16, E11 vs. D1, and E16 vs. D1, respectively. Moreover, we identified the <italic>cis</italic>- and <italic>trans</italic>-regulatory target genes of differentially expressed lncRNAs, and constructed lncRNA-gene interaction networks. In total, 126 and 200 <italic>cis</italic>-targets, and two and three <italic>trans</italic>-targets were involved in lncRNA-gene interaction networks that were constructed based on the E11 vs. E16, and E11 vs. D1 comparisons, respectively. The comparison of the E16 vs. D1 lncRNA-gene network comprised 25 <italic>cis</italic>-targets. We determined that lncRNA target genes are potentially involved in cellular development, and cellular growth and proliferation using Ingenuity Pathway Analysis. The gene networks identified for the E11 vs. D1 comparison were involved in embryonic development, organismal development and tissue development. The present study provides an RNA sequencing based evaluation of lncRNA function during skeletal muscle development in the chicken. Comprehensive analysis facilitated the identification of lncRNAs and target genes that might contribute to the regulation of different stages of skeletal muscle development.</p>
</abstract>
<kwd-group>
<kwd>chicken</kwd>
<kwd>long non-coding RNA</kwd>
<kwd><italic>cis</italic>-acting</kwd>
<kwd><italic>trans</italic>-acting</kwd>
<kwd>skeletal muscle development</kwd>
</kwd-group>
<counts>
<fig-count count="8"/>
<table-count count="3"/>
<equation-count count="0"/>
<ref-count count="32"/>
<page-count count="14"/>
<word-count count="7885"/>
</counts>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p>Embryonic patterning and organogenesis in metazoans entail complicated processes, including cellular differentiation, migration proliferation, and programmed cell death. These complex cellular and developmental processes depend on the precise spatiotemporal expression of regulatory factors. Evidence suggests that in complex organisms, RNA contains a hidden layer of regulatory information. It not only functions as a messenger between DNA and the protein, but also plays a role in the regulation of genome organization and gene expression (Morris and Mattick, <xref ref-type="bibr" rid="B23">2014</xref>). Data from high-throughput sequencing studies have revealed that only a very small percentage (1&#x02013;2%) of the mammalian genome encodes proteins, but tens of thousands of intergenic sites are transcribed to non-coding RNA. This transcription plays a critical role in regulating gene expression during several biological processes (Muers, <xref ref-type="bibr" rid="B24">2011</xref>). Many small non-coding RNAs, such as microRNAs (miRNAs), PIWI-interacting RNAs (piRNAs), and small nucleolar RNAs (snoRNAs) have been the subject of many functional studies; however, systematic identification of the functions of lncRNA has yet to be conducted.</p>
<p>LncRNAs, or mRNA-like long non-coding RNAs, are a novel class of regulatory RNAs, with sizes ranging from 200 bp to &#x0003E;100 kb (Novikova et al., <xref ref-type="bibr" rid="B26">2013</xref>). LncRNAs are transcribed by RNA polymerase II, but do not encode proteins. There is evidence to suggest that lncRNAs, by a variety of mechanisms, serve as versatile regulators of diverse aspects of biology. The <italic>Xist</italic> gene is a master regulatory switch that controls the inactivation of the X chromosome in mammals, and is one of the first known examples of a lncRNA that directly participates in the formation of repressive chromatin (Lee and Bartolomei, <xref ref-type="bibr" rid="B16">2013</xref>). Recently, specific roles of lncRNAs in the development of diverse organs and tissue types have been identified. For example, Bvht and Fendrr are two important lncRNAs that are involved in cardiac development in the mouse. In neonatal cardiomyocytes, knockdown of Bvht by RNAi changes cardiac-specific gene expression and inhibits normal development to mature cardiomyocytes (Klattenhoff et al., <xref ref-type="bibr" rid="B15">2013</xref>). Similarly, knockout of Fendrr impairs heart function, leads to deficits in the body wall, and ultimately results in embryonic lethality (Grote et al., <xref ref-type="bibr" rid="B10">2013</xref>). In addition to their extensive roles in organ development, lncRNAs are also known to play a role in skeletal muscle differentiation. Linc-MD1 is one of the first lncRNAs that was observed to be involved in myogenesis. This lncRNA acts as a competing endogenous RNA and &#x0201C;sponges&#x0201D; miR-133 and miR-135 to regulate the expression of MAML1 and MEF2C, which are transcription factors that activate late-differentiation muscle genes (Cesana et al., <xref ref-type="bibr" rid="B4">2011</xref>). Moreover, lncRNA H19, which is highly expressed in the developing embryo and in adult muscle, functions as a molecular sponge for the let-7 family of miRNAs, and thereby regulates muscle differentiation (Kallen et al., <xref ref-type="bibr" rid="B14">2013</xref>). LncRNAs can be <italic>cis</italic>-acting or <italic>trans</italic>-acting, and the location of the target gene is commonly used to distinguish between the two. <italic>Cis</italic>-acting lncRNAs regulate the expression of target genes that are located at or near the same genomic locus, whereas <italic>trans</italic>-acting lncRNAs can either inhibit or activate gene transcription at independent chromosomal loci (Fatica and Bozzoni, <xref ref-type="bibr" rid="B8">2014</xref>). For example, lincRNA-p21 activates <italic>p21</italic> expression in <italic>cis</italic> to influence the chromatin state, activate <italic>p53</italic> pathway genes, and enforce the G1/S checkpoint (Dimitrova et al., <xref ref-type="bibr" rid="B6">2014</xref>). In addition, the lncRNA Six3OS acts in <italic>trans</italic> to regulate retinal development by modulating <italic>Six3</italic> activity (Rapicavoli et al., <xref ref-type="bibr" rid="B27">2011</xref>).</p>
<p>Skeletal muscle development in the chicken is a multi-step process that comprises four major stages: in the initial stage, muscle precursor cells differentiate from the somite; in the second stage, myogenic precursor proliferation, and differentiation give rise to myoblasts; in the third stage, myoblast differentiation gives rise to myotubes; and finally, myofibers are formed from the myotubes (Luo et al., <xref ref-type="bibr" rid="B21">2013</xref>). Many genes, such as paired box 3 (<italic>Pax3</italic>), paired box 7 (<italic>Pax7</italic>), myogenic differentiation (<italic>MyoD</italic>), myogenic factor 5 (<italic>Myf5</italic>), and myogenin (<italic>MyoG</italic>) (Sobolewska et al., <xref ref-type="bibr" rid="B28">2011</xref>) are involved in the regulation of skeletal muscle development in the chicken; however, research on the role of lncRNAs in the regulation of this process remains scarce. With the aid of non-coding RNA (ncRNA) library construction, 125 ncRNAs have been identified in the chicken that play important roles in tissue development and lineage/species specification during evolution (Zhang et al., <xref ref-type="bibr" rid="B31">2009</xref>). In another study, 281 new intergenic lncRNAs were identified in chicken embryo skeletal muscle, and further analyses suggested that these lncRNAs were less conserved than protein-coding genes, but slightly more conserved than random non-coding sequences (Li T. et al., <xref ref-type="bibr" rid="B17">2012</xref>). Although an increasing number of lncRNAs are being characterized by high-throughput sequencing studies, few examples of regulatory mechanisms involving lncRNAs in chicken muscle development have been described.</p>
<p>In this study, we identified lncRNA and mRNA expression profiles in three different stages of chicken skeletal muscle development. Differentially expressed lncRNAs were then used in bioinformatics analyses to predict <italic>cis</italic>- and <italic>trans</italic>-target genes. These findings were integrated with differentially expressed mRNA data to improve the accuracy of target prediction. The predicted <italic>cis</italic>- and <italic>trans</italic>-targets were then used for the construction of lncRNA-gene correlation networks. Ingenuity Pathway Analysis (IPA) and gene ontology (GO) analysis were performed to investigate the functions associated with network genes. In summary, this study provides predictions about the functional interactions of lncRNAs and protein-coding genes, and the information generated from these predictions can be utilized in further studies of lncRNA function in chicken skeletal muscle development.</p>
</sec>
<sec sec-type="materials and methods" id="s2">
<title>Materials and methods</title>
<sec>
<title>Ethics statement</title>
<p>All animal experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee at the South China Agricultural University (Guangzhou, People&#x00027;s Republic of China). All experiments were conducted in compliance with the regulations and guidelines established by that committee.</p>
</sec>
<sec>
<title>Chicken embryo incubation and tissue collection</title>
<p>Fertilized eggs of a native Chinese yellow meat-type chicken known as Xinghua chickens were used in the this study. The Xinghua chicken is an indigenous chicken breed from Xinghua town, Fengkai County, Guangdong province, China is characterized by a relatively slow growth rate. The fertilized eggs were incubated in a humidified incubator at 37.5&#x000B0;C and 65% humidity. Skeletal leg muscles were resected at embryonic day 11 (E11), embryonic day 16 (E16), and 1 day after hatching (D1). All tissues were immediately frozen in liquid nitrogen and stored at &#x02212;80&#x000B0;C until RNA extraction. The sex of the chicken was determined by PCR amplification of the <italic>CHD1</italic> gene using sex-specific primers (Li Z. L. et al., <xref ref-type="bibr" rid="B18">2012</xref>). Chickens with two bands of 600 bp and 450 bp were born as females, whereas those with one band of 600 bp were born as males. The sex-specific primer sequences are presented in Table <xref ref-type="table" rid="T1">1</xref>.</p>
<table-wrap position="float" id="T1">
<label>Table 1</label>
<caption><p><bold>Sex-specific primers and real-time qPCR primers</bold>.</p></caption>
<table frame="hsides" rules="groups">
<thead><tr>
<th valign="top" align="center" colspan="2"><bold>Gene and lncRNA</bold></th>
<th valign="top" align="left"><bold>Primer sequence (5&#x02032;&#x02212;3&#x02032;)</bold></th>
<th valign="top" align="center"><bold>Product length (bp)</bold></th>
<th valign="top" align="center"><bold>Annealing temperature (&#x000B0;C)</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Sex-specific primers</td>
<td valign="top" align="left">CHD1-F</td>
<td valign="top" align="left">GTTACTGATTCGTCTACGAGA</td>
<td valign="top" align="center">600 or 450</td>
<td valign="top" align="center">55</td>
</tr>
<tr style="border-bottom: thin solid #000000;">
<td/>
<td valign="top" align="left">CHD1-R</td>
<td valign="top" align="left">ATTGAAATGATCCAGTGCTTG</td>
<td/>
<td/>
</tr>
<tr>
<td valign="top" align="left">qPCR primers</td>
<td valign="top" align="left">TEAD4-F</td>
<td valign="top" align="left">CTTTCCTTCTTCTCACCCTC</td>
<td valign="top" align="center">168</td>
<td valign="top" align="center">53</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">TEAD4-R</td>
<td valign="top" align="left">TAGCAACCCTTCGTCCTT</td>
<td/>
<td/>
</tr>
<tr>
<td/>
<td valign="top" align="left">DMD-F</td>
<td valign="top" align="left">ATGATTTTCGAGATGGACG</td>
<td valign="top" align="center">81</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">DMD-R</td>
<td valign="top" align="left">TGGAGCCCTTTTCTTTTG</td>
<td/>
<td/>
</tr>
<tr>
<td/>
<td valign="top" align="left">FGF13-F</td>
<td valign="top" align="left">GCTATACAGCAGGCAAGG</td>
<td valign="top" align="center">118</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">FGF13-R</td>
<td valign="top" align="left">CACTCGTAAACCCACAGG</td>
<td/>
<td/>
</tr>
<tr>
<td/>
<td valign="top" align="left">DLK1-F</td>
<td valign="top" align="left">CAGGAAAGGACCATGTATTA</td>
<td valign="top" align="center">100</td>
<td valign="top" align="center">52</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">DLK1-R</td>
<td valign="top" align="left">AGGGCATAGACAGGAAGC</td>
<td/>
<td/>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00003323-F</td>
<td valign="top" align="left">ACATCTTTATCCGTGCTG</td>
<td valign="top" align="center">197</td>
<td valign="top" align="center">57</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00003323-R</td>
<td valign="top" align="left">AAGACTTACTCCAGGTGGT</td>
<td/>
<td/>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00005738-F</td>
<td valign="top" align="left">CACCTGTAATAAACCCATAA</td>
<td valign="top" align="center">185</td>
<td valign="top" align="center">57</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00005738-R</td>
<td valign="top" align="left">CTCCCACTTTAGTAAACTCC</td>
<td/>
<td/>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00023378-F</td>
<td valign="top" align="left">TTCCATGAACAGCACCCA</td>
<td valign="top" align="center">128</td>
<td valign="top" align="center">57</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00023378-R</td>
<td valign="top" align="left">AGATGAGCAGCGATAACACC</td>
<td/>
<td/>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00073545-F</td>
<td valign="top" align="left">CTTCTAGCAAGCCTAATG</td>
<td valign="top" align="center">118</td>
<td valign="top" align="center">52</td>
</tr>
<tr>
<td/>
<td valign="top" align="left">lnc00073545-R</td>
<td valign="top" align="left">CTAACAAACCCTAACTCCT</td>
<td/>
<td/>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec>
<title>Illumina deep sequencing and sequence analysis</title>
<p>Total RNA for RNA sequencing (RNA-seq) was isolated from six chicken leg muscle samples (two each from E11, E16, and D1), using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer&#x00027;s protocol. RNA quantity and quality were evaluated on an Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany), and RNA integrity was further examined using agarose gel electrophoresis. Ribosomal RNA (rRNA) was removed from the total RNA using the Epicentre Ribo-Zero&#x02122; rRNA Removal Kit (Epicentre, Madison, Wisconsin, USA) following the manufacturer&#x00027;s instructions. High-throughput RNA-seq was performed on the Illumina Hiseq 2500 platform (Illumina, San Diego, CA, USA). The Illumina sequencing raw reads were cleaned by removing empty reads, adapter sequences, reads with over 10% N sequences, and low quality reads, in which the number of bases with a quality value <italic>Q</italic> &#x02264; 10 was &#x0003E;50%. In addition, rRNA reads were identified, by blasting against the rRNA database (<ext-link ext-link-type="uri" xlink:href="http://www.arb-silva.de/">http://www.arb-silva.de/</ext-link>) using Simple Object Access Protocol (SOAP) software, and removed from the dataset. The filtered reads were mapped to the chicken reference genome (<ext-link ext-link-type="uri" xlink:href="ftp://ftp.ensembl.org/pub/release-73/fasta/gallus_gallus/dna/">ftp://ftp.ensembl.org/pub/release-73/fasta/gallus_gallus/dna/</ext-link>) using the Tophat2 software. The mapped reads were assembled and transcripts were constructed using the Cufflinks 2.0.2 software. The Ensembl, NCBI RefGene, and UCSC databases were chosen as annotation references for lncRNA analyses. The Coding Potential Calculator (CPC), Coding-Non-Coding Index (CNCI) and Phylogenetic codon substitution frequency (PhyloCSF) were applied to estimate coding ability of potential lncRNAs. An RNA length &#x02265; 200 nt, CPC score &#x02264; 0, CNCI score &#x02264; 0, and PhyloCSF score &#x02264; &#x02212;20 were used to evaluate the coding potential of transcripts. The RefSeq and Ensembl databases were used for gene analysis. The expression levels of the transcripts were expressed as FPKM (fragments per kilobase of transcript per million mapped reads) values using the Cuffnorm program. Differentially expressed lncRNAs and mRNAs for each comparison (E11 vs. E16, E11 vs. D1, and E16 vs. D1) were identified using Cuffdiff (the differential expression analysis tool packaged with the Cufflinks software), with a <italic>q</italic> &#x0003C; 0.05 and |(fold change)| &#x02265; 2 as the cut-off points. The sequencing data obtained from RNA-seq were released to the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database under the accession number <ext-link ext-link-type="NCBI:geo" xlink:href="GSE91060">GSE91060</ext-link>.</p>
</sec>
<sec>
<title><italic>Cis</italic>- and <italic>trans</italic>-analyses</title>
<p>Differentially expressed lncRNAs were selected for <italic>cis</italic>- and <italic>trans</italic>-target gene prediction, and these findings were integrated with differentially expressed mRNA data to improve the accuracy of target prediction. To classify lncRNA <italic>cis</italic>-target genes, we used the UCSC Genome Bioinformatics tool to identify differentially expressed genes (DEGs) located &#x0007E;300 kb upstream and downstream of differentially expressed lncRNAs, and determined the potential that the lncRNA was <italic>cis</italic>-acting. To classify lncRNA <italic>trans</italic>-target genes, the BLAST (<italic>e</italic> &#x0003C; 1E &#x02212; 5) software was used to assess the impact of lncRNA binding on complete mRNA molecules. The RNAplex program (&#x02212;e &#x02212;20) was then used to identify possible <italic>trans</italic>-target genes of the lncRNAs. Differentially expressed lncRNAs and their corresponding differentially expressed <italic>cis</italic>- and <italic>trans</italic>-target genes were used to construct lncRNA-gene interaction networks using the Cytoscape program.</p>
</sec>
<sec>
<title>IPA, gene ontology, and pathway analysis</title>
<p>Gene interaction network and biological process enrichment analyses for the <italic>cis</italic>- and <italic>trans</italic>-target genes of differentially expressed lncRNAs were performed using IPA (<ext-link ext-link-type="uri" xlink:href="http://www.ingenuity.com">www.ingenuity.com</ext-link>). Ingenuity Pathway Analysis is a web-based software from Ingenuity Systems&#x000AE; (Qiagen, Redwood City, CA, USA) that enables investigators to analyze data derived from high-throughput sequencing. IPA provides a comprehensive database of known networks and pathways that are continuously being updated based on published work on gene functions and interactions. Each gene identifier was imported and mapped to its corresponding gene object in the Ingenuity Pathways Knowledge Base (IPKB) and superimposed onto a global molecular network, based on the information stored in the IPKB. IPA uses computational algorithms to identify local networks that are particularly enriched for the genes of interest. A network score that is used to rank networks is also provided. This numerical score, which is based on the hyper-geometric distribution, is calculated using a right-tailed Fisher&#x00027;s exact test and is represented as the negative log of the <italic>P</italic>-value. Functional enrichment analysis was also performed on these networks to understand the significance of the biological functions and/or disease phenotypes of the genes in the network. The predicted lncRNA target genes were entered into the Molecule Annotation System (MAS) 3.0 (<ext-link ext-link-type="uri" xlink:href="http://bioinfo.capitalbio.com/mas3">http://bioinfo.capitalbio.com/mas3</ext-link>), which is based on the Kyoto Encyclopedia of Genes and Genomes database (KEGG) (CapitalBio, Beijing, China). The MAS uses GO data as an advantage to identify the molecular functions represented in the gene profile. The MAS 3.0 software was used to perform GO and KEGG analyses.</p>
</sec>
<sec>
<title>Real-time qPCR analysis</title>
<p>Single-strand cDNA was synthesized from 1 &#x003BC;g of total RNA using the PrimeScript&#x02122; RT reagent kit with gDNA Eraser (Takara, Osaka, Japan). The qPCR reactions were performed on a Bio-Rad CFX96 Real-Time Detection system to detect the RNA expression level of each gene, using the iTaq&#x02122; Universal SYBR&#x000AE; Green Supermix kit (Bio-Rad Laboratories Inc., Hercules, CA, USA), for which the chicken &#x003B2;<italic>-actin</italic> gene was used as an internal control. Data analysis was carried out with the 2<sup>&#x02212;&#x00394;&#x00394;Ct</sup> method as described previously (Livak and Schmittgen, <xref ref-type="bibr" rid="B19">2001</xref>). Real-time qPCR primers were designed using the Premier Primer 5.0 software (Premier Biosoft International, Palo Alto, CA, USA). The qPCR primer sequences are presented in Table <xref ref-type="table" rid="T1">1</xref>.</p>
</sec>
<sec>
<title>Statistical analysis</title>
<p>Quantitative expressions of the data are presented as mean &#x000B1; S.E.M of three independent experiments. In each experiment, the assay was performed in triplicate. Statistical significance of the data was tested by performing one-sample or paired <italic>t</italic>-tests when required. When applicable, the specific types of tests and the <italic>P</italic> &#x0003C; 0.05 are indicated in the figure legends.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec>
<title>Overview of RNA-sequencing</title>
<p>The Illumina Hiseq 2500 platform was used to perform RNA-seq for the six cDNA libraries, and 125 bp paired-end reads were generated. The number of raw reads generated from each library was exceeded 100 million reads (Table <xref ref-type="table" rid="T2">2</xref>). After filtering the low quality reads, most of the clean reads still comprised more than 90% of the raw data, with the exception of the E16-2 group (85.13%) and D1-1 group (89.47%). More than 73.70% of the clean reads were perfectly mapped to the chicken reference genome. The unique mapped reads ranged from 95.62 to 96.54% of the total mapped reads (Table <xref ref-type="table" rid="T2">2</xref>).</p>
<table-wrap position="float" id="T2">
<label>Table 2</label>
<caption><p><bold>Summary of draft reads of six libraries by RNA-sequencing</bold>.</p></caption>
<table frame="hsides" rules="groups">
<thead><tr>
<th valign="top" align="left"><bold>Sample</bold></th>
<th valign="top" align="center"><bold>Raw reads</bold></th>
<th valign="top" align="center"><bold>Clean reads</bold></th>
<th valign="top" align="center"><bold>Total residues (bp)</bold></th>
<th valign="top" align="center"><bold>Total mapped reads</bold></th>
<th valign="top" align="center"><bold>Unique mapped reads</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">E11-1</td>
<td valign="top" align="center">120,024,130</td>
<td valign="top" align="center">109,367,542 (91.12%)</td>
<td valign="top" align="center">14,797,215,325</td>
<td valign="top" align="center">81,510,188 (74.50%)</td>
<td valign="top" align="center">78,561,396 (96.38%)</td>
</tr>
<tr>
<td valign="top" align="left">E11-2</td>
<td valign="top" align="center">108,620,754</td>
<td valign="top" align="center">99,583,044 (91.68%)</td>
<td valign="top" align="center">13,488,389,034</td>
<td valign="top" align="center">73,440,167 (73.70%)</td>
<td valign="top" align="center">70,902,173 (96.54%)</td>
</tr>
<tr>
<td valign="top" align="left">E16-1</td>
<td valign="top" align="center">104,403,766</td>
<td valign="top" align="center">98,171,720 (94.03%)</td>
<td valign="top" align="center">13,415,537,569</td>
<td valign="top" align="center">74,087,627 (75.50%)</td>
<td valign="top" align="center">70,893,952 (95.68%)</td>
</tr>
<tr>
<td valign="top" align="left">E16-2</td>
<td valign="top" align="center">123,268,886</td>
<td valign="top" align="center">104,948,578 (85.13%)</td>
<td valign="top" align="center">14,065,328,305</td>
<td valign="top" align="center">78,594,049 (74.90%)</td>
<td valign="top" align="center">75,172,271(95.65%)</td>
</tr>
<tr>
<td valign="top" align="left">D1-1</td>
<td valign="top" align="center">127,403,762</td>
<td valign="top" align="center">113,984,606 (89.47%)</td>
<td valign="top" align="center">15,479,331,668</td>
<td valign="top" align="center">84,119,306 (73.80%)</td>
<td valign="top" align="center">80,432,724 (95.62%)</td>
</tr>
<tr>
<td valign="top" align="left">D1-2</td>
<td valign="top" align="center">123,022,016</td>
<td valign="top" align="center">117,366,974 (95.40%)</td>
<td valign="top" align="center">16,020,192,921</td>
<td valign="top" align="center">88,208,260 (75.20%)</td>
<td valign="top" align="center">84,401,995 (95.68%)</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec>
<title>Identification of lncRNAs in chicken leg skeletal muscle</title>
<p>After a stringent filtering process to discard transcripts that did not have the characteristics of lncRNAs, RNA-seq yielded 1995 lncRNA transcripts. The length of the lncRNAs ranged from 204 to 32984 bp, with 30.78 and 25.31% of lncRNAs having a length of 204&#x02013;1000 and 1000&#x02013;2000 bp, respectively (Figure <xref ref-type="fig" rid="F1">1A</xref>). The lncRNA genes had an average length of 2941 bp and 2.9 exons (Figures <xref ref-type="fig" rid="F1">1A,B</xref>). The 1995 lncRNA transcripts were distributed among chicken chromosomes 1&#x02013;28, 33, MT, Z, and W. Quite notably, 316 lncRNAs were located in the chromosome 1 (Figure <xref ref-type="fig" rid="F1">1C</xref>).</p>
<fig id="F1" position="float">
<label>Figure 1</label>
<caption><p><bold>The features of chicken lncRNAs. (A)</bold> Exon length distribution of chicken lncRNAs. <bold>(B)</bold> Exon numbers per transcript of chicken lncRNAs. <bold>(C)</bold> Chromosome distribution of lncRNA transcripts identified in chicken leg muscle.</p></caption>
<graphic xlink:href="fphys-07-00687-g0001.tif"/>
</fig>
</sec>
<sec>
<title>Differential expression analysis of lncRNAs and mRNAs</title>
<p>To investigate the key lncRNAs and mRNAs involved in chicken skeletal muscle development, RNA-seq (with rRNA removed) was performed to detect the differentially expressed lncRNAs (DE-lncRNAs) and DEGs at three stages of leg muscle development in the chicken (E11, E16, and D1). DE-lncRNAs and DEGs were identified by Cuffdiff analysis (<italic>q</italic> &#x0003C; 0.05; |(fold change)| &#x02265; 2). Among three comparisons, E11 vs. E16, E11 vs. D1, and E16 vs. D1, 129, 132, and 45 DE-lncRNAs were detected, respectively. Among these DE-lncRNAs, 26, 24, and 6 lncRNAs were uniquely expressed in one of the two samples in the E11 vs. E16 (Table <xref ref-type="supplementary-material" rid="SM1">S1</xref>), E11 vs. D1 (Table <xref ref-type="supplementary-material" rid="SM2">S2</xref>), and E16 vs. D1 (Table <xref ref-type="supplementary-material" rid="SM3">S3</xref>) comparisons, respectively. Of these DE-lncRNAs, six, including lnc00060568, lnc00057952, lnc00019955, lnc00064868, lnc00002354, and lnc00029488, were identified as differentially expressed among all three comparisons, whereas 61, 54, and 7 lncRNAs were found exclusively in the E11 vs. E16, E11 vs. D1, and E16 vs. D1 comparisons, respectively (Figure <xref ref-type="fig" rid="F2">2A</xref>).</p>
<fig id="F2" position="float">
<label>Figure 2</label>
<caption><p><bold>Venn diagrams of differentially expressed lncRNAs (DE-lncRNAs) and differentially expressed genes (DEGs) showing comparisons of three stages of skeletal muscle development in the chicken (A)</bold> Number of DE-lncRNAs for three comparisons: E11 vs. E16, E11 vs. D1, and E16 vs. D1. <bold>(B)</bold> Numbers of DEGs for three comparisons: E11 vs. E16, E11 vs. D1, and E16 vs. D1. E11, E16, and D1 indicate the developmental stages of skeletal muscle development: embryonic day 11, embryonic day 16, and 1 day after hatching, respectively.</p></caption>
<graphic xlink:href="fphys-07-00687-g0002.tif"/>
</fig>
<p>Comparisons of gene expression levels among the three developmental stages revealed that there were 1798 DEGs (<italic>q</italic> &#x0003C; 0.05; |(fold change)| &#x02265; 2) between E11 and E16 (E11 vs. E16), 3072 DEGs between E11 and D1 (E11 vs. D1), and 1211 DEGs between E16 and D1 (E16 vs. D1). Among these DEGs, 27, 50, and 5 genes were uniquely expressed in one of the two samples in the E11 vs. E16 (Table <xref ref-type="supplementary-material" rid="SM4">S4</xref>), E11 vs. D1 (Table <xref ref-type="supplementary-material" rid="SM5">S5</xref>), and E16 vs. D1 (Table <xref ref-type="supplementary-material" rid="SM6">S6</xref>) comparisons, respectively. Of these DEGs, 386 genes were detected in all three comparisons, whereas 281, 1019, and 110 genes were exclusively differentially expressed in E11 vs. E16, E11 vs. D1, and E16 vs. D1 comparisons, respectively (Figure <xref ref-type="fig" rid="F2">2B</xref>).</p>
</sec>
<sec>
<title>lncRNA-gene interaction network construction</title>
<p>To address the question of how lncRNAs function in concert with their target genes (mRNAs) to regulate chicken muscle development, and to identify the key molecular players in this process, <italic>cis</italic>- and <italic>trans</italic>-targets of the differentially expressed lncRNAs were predicted, and the possible regulatory networks of interactions between lncRNAs and their target genes (mRNAs) were constructed. Previous studies have confirmed that lncRNAs regulate the expression of neighboring protein-coding genes through <italic>cis</italic>-acting mechanisms (Bu et al., <xref ref-type="bibr" rid="B3">2012</xref>; Han et al., <xref ref-type="bibr" rid="B11">2012</xref>). In addition, lncRNAs can regulate the expression of genes that are located on other chromosomes; such regulation is called <italic>trans</italic>-acting (Han et al., <xref ref-type="bibr" rid="B11">2012</xref>). In the present study, bioinformatics analysis was used to predict potential <italic>cis</italic>- and <italic>trans</italic>-target genes of DE-lncRNAs, and further construct a lncRNA-gene interaction network between the DE-lncRNAs and their corresponding differentially expressed <italic>cis</italic>- and <italic>trans</italic>-target genes. Construction of the lncRNA-gene network consisted of three steps (Figure <xref ref-type="fig" rid="F3">3</xref>). Firstly, the genes within 300 kb upstream and downstream of the lncRNA were identified using the UCSC Genome Browser. Among these genes, those that were coexpressed with the lncRNA were classified as potential lncRNA <italic>cis</italic>-target genes. Secondly, BLAST and RNAplex software were used to identify <italic>trans</italic>-target genes. To narrow the field and improve the accuracy of target prediction, only those putative <italic>trans</italic>-target genes that were coexpressed with the lncRNAs were classified as <italic>trans</italic>-lncRNA target genes. Thirdly, Cytoscape was used to construct a lncRNA-gene interaction network based on the DE-lncRNAs and their corresponding differentially expressed <italic>cis</italic>- and <italic>trans</italic>-target genes. For the E11 vs. E16 comparison, the lncRNA-gene interaction network comprised 211 network nodes and 148 lncRNA-gene connections among 83 lncRNAs and 128 protein-coding genes (Figure <xref ref-type="fig" rid="F4">4</xref>, Table <xref ref-type="supplementary-material" rid="SM7">S7</xref>). For the E11 vs. D1 comparison, the lncRNA-gene interaction network comprised 305 network nodes and 242 lncRNA-gene connections among 102 lncRNAs and 203 protein-coding genes (Figure <xref ref-type="fig" rid="F5">5</xref>, Table <xref ref-type="supplementary-material" rid="SM8">S8</xref>). For the E16 vs. D1 comparison, the lncRNA-gene interaction network comprised 46 network nodes and 28 lncRNA-gene connections among 21 lncRNAs and 25 protein-coding genes (Figure <xref ref-type="fig" rid="F6">6</xref>, Table <xref ref-type="supplementary-material" rid="SM9">S9</xref>).</p>
<fig id="F3" position="float">
<label>Figure 3</label>
<caption><p><bold>Schematic of lncRNA-gene interaction network construction</bold>.</p></caption>
<graphic xlink:href="fphys-07-00687-g0003.tif"/>
</fig>
<fig id="F4" position="float">
<label>Figure 4</label>
<caption><p><bold>LncRNA-gene network for comparison of E11 vs. E16</bold>. E11 vs. E16, differentially expressed lncRNAs and their corresponding differentially expressed <italic>cis</italic>- and <italic>trans</italic>-target genes were used to construct a lncRNA-gene interaction network. In this network, up-regulated genes are displayed as pink circles, down-regulated genes are displayed as green circles, up-regulated lncRNAs are displayed as pink triangles, and down-regulated lncRNAs are displayed as green triangles. Solid lines represent the interactions between differentially expressed lncRNAs and their corresponding <italic>cis</italic> target genes, whereas the dashed lines represent interactions between differentially expressed lncRNAs and their corresponding <italic>trans</italic>-target genes.</p></caption>
<graphic xlink:href="fphys-07-00687-g0004.tif"/>
</fig>
<fig id="F5" position="float">
<label>Figure 5</label>
<caption><p><bold>LncRNA-gene network for comparison of E11 vs. D1</bold>. E11 vs. D1, differentially expressed lncRNAs and their corresponding differentially expressed <italic>cis</italic>- and <italic>trans</italic>-target genes were used to construct a lncRNA-gene interaction network. In this network, up-regulated genes are displayed as pink circles, down-regulated genes are displayed as green circles, up-regulated lncRNAs are displayed as pink triangles, and down-regulated lncRNAs are displayed as green triangles. Solid and dashed lines represent the interactions between differentially expressed lncRNAs and their corresponding <italic>cis</italic>- and <italic>trans</italic>-target genes, respectively.</p></caption>
<graphic xlink:href="fphys-07-00687-g0005.tif"/>
</fig>
<fig id="F6" position="float">
<label>Figure 6</label>
<caption><p><bold>LncRNA-gene network for comparison of E16 vs. D1</bold>. E16 vs. D1, differentially expressed lncRNAs and their corresponding differentially expressed <italic>cis</italic>-target genes were used to construct a lncRNA-gene interaction network. In this network, up-regulated genes are displayed as pink circles, down-regulated genes are displayed as green circles, up-regulated lncRNAs are displayed as pink triangles, and down-regulated lncRNAs are displayed as green triangles. Solid lines represent the interactions between the differentially expressed lncRNAs and their corresponding <italic>cis</italic>-target genes.</p></caption>
<graphic xlink:href="fphys-07-00687-g0006.tif"/>
</fig>
<p>We then analyzed the expression correlation between the network lncRNAs and their corresponding target genes. In the network constructed from DE-lncRNAs and target genes identified from the E11 vs. E16 comparison, 92 lncRNA-gene connections were positively correlated, whereas another 56 connections were negatively correlated (Figure <xref ref-type="fig" rid="F4">4</xref>, Table <xref ref-type="supplementary-material" rid="SM7">S7</xref>). For the E11 vs. D1 comparison, 138 lncRNA-gene connections were positively correlated and 104 connections were negatively correlated (Figure <xref ref-type="fig" rid="F5">5</xref>, Table <xref ref-type="supplementary-material" rid="SM8">S8</xref>). For the E16 vs. D1 comparison, 16 lncRNA-gene connections were positively correlated and 12 connections were negatively correlated (Figure <xref ref-type="fig" rid="F6">6</xref>, Table <xref ref-type="supplementary-material" rid="SM9">S9</xref>). Directionality analysis showed that for all three contrast networks, the number of positive correlations between lncRNA-gene pairs was higher than the number of negative correlations.</p>
</sec>
<sec>
<title>Ingenuity pathway analysis</title>
<p>In total, 128, 203, and 25 DEGs that were also targets of DE-lncRNAs belonged to the E11 vs. E16, E11 vs. D1, and E16 vs. D1 comparison lncRNA-gene networks, respectively. To identify the functions of the DE-lncRNAs target genes and their potential network connections, we used IPA to determine which gene networks might be affected by these DE-lncRNAs target genes. For the E11 vs. E16 comparison, we identified a total of ten networks, and the top four were related to cancer, organismal injury and abnormalities, cell cycle, developmental disorders, hereditary disorders, metabolic disease, reproductive system disease, cellular development, cellular growth and proliferation, and connective tissue development and function (Figures <xref ref-type="fig" rid="F7">7A&#x02013;D</xref>, Table <xref ref-type="table" rid="T1">1</xref>). In total, 23 (Figure <xref ref-type="fig" rid="F7">7A</xref>), 22 (Figure <xref ref-type="fig" rid="F7">7B</xref>), 20 (Figure <xref ref-type="fig" rid="F7">7C</xref>), and 15 (Figure <xref ref-type="fig" rid="F7">7D</xref>) DEGs belonged to these top four gene-gene networks. For the E11 vs. D1 comparison, 16 networks were identified and the top two were related to cell morphology, organ morphology, reproductive system development and function, embryonic development, organismal development, and tissue development (Figures <xref ref-type="fig" rid="F7">7E,F</xref>, Table <xref ref-type="table" rid="T1">1</xref>). A total of 22 (Figure <xref ref-type="fig" rid="F7">7E</xref>), and 19 (Figure <xref ref-type="fig" rid="F7">7F</xref>) DEGs belonged to these top two gene-gene networks. In addition, for the E16 vs. D1 comparison, we identified a total of four networks, and the top two were related to nervous system development and function, cellular development, cellular growth and proliferation, developmental disorders, hereditary disorders, and ophthalmic disease (Figures <xref ref-type="fig" rid="F7">7G,H</xref>, Table <xref ref-type="table" rid="T1">1</xref>). A total of 11 (Figure <xref ref-type="fig" rid="F7">7G</xref>), and 10 (Figure <xref ref-type="fig" rid="F7">7H</xref>) DEGs belonged to these top two gene-gene networks.</p>
<fig id="F7" position="float">
<label>Figure 7</label>
<caption><p><bold>Ingenuity Pathway Analysis (IPA) identification of gene networks affected by differentially expressed lncRNA (DE-lncRNA) target genes</bold>. IPA online software was used to identify the gene-gene interaction networks, using differentially expressed DE-lncRNA target genes as input. <bold>(A&#x02013;D)</bold> Four major gene networks identified for the E11 vs. E16 comparison. <bold>(E,F)</bold> Two major gene networks identified for the E11 vs. D1 comparison. <bold>(G,H)</bold> Two major gene networks identified for the E16 vs. D1 comparison. Nodes shaded in blue represent the DE-lncRNA target genes that are also involved in the IPA interaction network. White nodes represent transcription factors (as opposed to DE-lncRNAs target genes) that are associated with the regulation of some of these genes, based on the evidence stored in the IPA knowledgebase. Edges and nodes are annotated with labels that illustrate the nature of the relationship between the genes and their functions.</p></caption>
<graphic xlink:href="fphys-07-00687-g0007.tif"/>
</fig>
</sec>
<sec>
<title>GO and KEGG pathway analysis</title>
<p>We then conducted GO and KEGG pathway analyses to gain insight into the functions of DE-lncRNA target genes. GO analysis was done to uncover enriched (<italic>q</italic> &#x0003C; 0.01) biological process terms for each contrast. A total of 107 enriched GO terms, including 43 for E11 vs. E16 (Figure <xref ref-type="supplementary-material" rid="SM16">S1A</xref>, Table <xref ref-type="supplementary-material" rid="SM10">S10</xref>); 51 for E11 vs. D1 (Figure <xref ref-type="supplementary-material" rid="SM16">S1B</xref>, Table <xref ref-type="supplementary-material" rid="SM11">S11</xref>); and 13 for E16 vs. D1 (Figure <xref ref-type="supplementary-material" rid="SM16">S1C</xref>, Table <xref ref-type="supplementary-material" rid="SM12">S12</xref>), were identified. Among these terms, 71 were unique GO terms that each appeared only once among all three comparisons. Many of the GO terms that were enriched in more than one comparison were related to muscle maintenance, lysine transport, ornithine transport, arginine transport, and peptide biosynthesis. A total of seven DE-lncRNA target genes involved in muscle maintenance, embryonic skeletal joint morphogenesis, post-embryonic development and organ growth were identified in the E11 vs. E16, and E11 vs. D1 comparisons, including well-known genes that affect muscle growth, such as dystrophin (<italic>DMD</italic>) and delta like non-canonical notch ligand 1 (<italic>DLK1</italic>).</p>
<p>KEGG pathway analysis of DE-lncRNAs target genes was done to identify pathways that were enriched in DE-lncRNA target genes. For the E11 vs. E16, E11 vs. D1, and E16 vs. D1 comparisons, 18 (Table <xref ref-type="supplementary-material" rid="SM13">S13</xref>), 17 (Table <xref ref-type="supplementary-material" rid="SM14">S14</xref>), and one (Table <xref ref-type="supplementary-material" rid="SM15">S15</xref>) enriched pathways (<italic>q</italic> &#x0003C; 0.001) were detected, respectively. For the E11 vs. E16 comparison, 11 DE-lncRNAs target genes played a role in the most significantly enriched pathways, including fatty acid metabolism, valine, leucine and isoleucine degradation, fatty acid elongation in mitochondria, and benzoate degradation via CoA ligation. In contrast, for the E11 vs. D1 comparison, the mitogen-activated protein kinase (MAPK) signaling pathway, mismatch repair, beta-Alanine metabolism, and chondroitin sulfate biosynthesis were identified as the most significantly enriched pathways, with 13 DE-lncRNAs target genes being associated with these pathways.</p>
</sec>
<sec>
<title>Verification of gene expression profiles using qRT-PCR</title>
<p>To confirm the accuracy and reproducibility of the DE-lncRNA and DEG expression levels obtained from RNA-seq, four well-known DE-lncRNA target genes that affect muscle development, including the TEA domain transcription factor 4 (<italic>TEAD4</italic>) (Jacquemin et al., <xref ref-type="bibr" rid="B13">1996</xref>), <italic>DMD</italic> (Ghahramani et al., <xref ref-type="bibr" rid="B9">2010</xref>), fibroblast growth factor 13 (<italic>FGF13</italic>) (Itoh and Ornitz, <xref ref-type="bibr" rid="B12">2008</xref>), and <italic>DLK1</italic> (Andersen et al., <xref ref-type="bibr" rid="B1">2013</xref>), and their corresponding lncRNA regulators, lnc00003323, lnc00005738, lnc00023378, and lnc00073545, were selected for real-time qRT-PCR validation. The qRT-PCR primers for these lncRNAs and genes are shown in Table <xref ref-type="table" rid="T1">1</xref>. All four lncRNAs and their target genes had similar expression patterns in comparison to the RNA-seq data (Figure <xref ref-type="fig" rid="F8">8</xref>), indicating the reliability of our RNA-seq data.</p>
<fig id="F8" position="float">
<label>Figure 8</label>
<caption><p><bold>Quantitative real-time PCR validation of differentially expressed lncRNAs and their corresponding target genes</bold>. <bold>(A)</bold> The expression of TEAD4 was down-regulated in the E11 group compared with that in the E16 group. <bold>(B)</bold> The expression of lnc00003323 was down-regulated in the E11 group compared with that in the E16 group. <bold>(C)</bold> The expression of DMD was down-regulated in the E11 group compared with that in the E16 group. <bold>(D)</bold> The expression of lnc00005738 was down-regulated in the E11 group compared with that in the E16 group. <bold>(E)</bold> The expression of FGF13 was down-regulated in the E11 group compared with that in the D1 group. <bold>(F)</bold> The expression of lnc00023378 was down-regulated in the E11 group compared with that in the D1 group. <bold>(G)</bold> The expression of DLK1 was down-regulated in the E11 group compared with that in the E16 group. <bold>(H)</bold> The expression of lnc00073545 was down-regulated in the E11 group compared with that in the E16 group. RNA expression levels were determined by RT-qPCR analysis. Data are shown as means &#x000B1; S.E.M. of at least three biological replicates. Asterisks denote statistically significant differences. <sup>&#x0002A;</sup>, <sup>&#x0002A;&#x0002A;</sup>, and <sup>&#x0002A;&#x0002A;&#x0002A;</sup> indicate <italic>P</italic> &#x0003C; 0.05, <italic>P</italic> &#x0003C; 0.01, and <italic>P</italic> &#x0003C; 0.001, respectively.</p></caption>
<graphic xlink:href="fphys-07-00687-g0008.tif"/>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>Over the past few years, many studies have demonstrated pervasive transcription across 70&#x02013;90% of mammalian genomes (Wang and Chang, <xref ref-type="bibr" rid="B30">2011</xref>; Derrien et al., <xref ref-type="bibr" rid="B5">2012</xref>). Surprisingly, &#x0003C;2% of the genome encodes protein-coding genes, indicating that non-coding RNAs comprise the majority of the transcriptome. Based on their length, non-coding transcripts can generally be divided into two major classes. Small non-coding RNAs have been relatively well-characterized, and include piRNAs, small interfering RNAs (siRNAs), microRNAs (miRNAs), and some bacterial regulatory RNAs (Fatica and Bozzoni, <xref ref-type="bibr" rid="B8">2014</xref>). In contrast, lncRNAs can vary in size from 200 bp to 100 kb, and have been implicated in imprinting control (Lee and Bartolomei, <xref ref-type="bibr" rid="B16">2013</xref>), cell differentiation and development (Dong et al., <xref ref-type="bibr" rid="B7">2014</xref>), and skeletal muscle growth (Kallen et al., <xref ref-type="bibr" rid="B14">2013</xref>). However, the function of lncRNAs in chicken muscle development remains unclear. In the present study, Illumina high-throughput sequencing was performed to provide an extensive lncRNA and gene expression profile in the previously unexamined chicken leg skeletal muscle at stages E11, E16, and D1. Multiple comparisons of lncRNA and gene transcript levels allowed us to identify 129, 132, and 45 lncRNAs, and 1798, 3072, and 1211 genes that were differentially expressed in the E11 vs. E16, E11 vs. D1, and E16 vs. D1 comparisons, respectively. Li et al. have been reported in their study the first systematic identification of lncRNAs during the development of the chicken pectoralis muscle (Li T. et al., <xref ref-type="bibr" rid="B17">2012</xref>). Using RNA-seq to sample the transcriptome, they successfully identified 281 new intergenic lncRNAs in the chicken genome. However, they did not identify the targets of lncRNAs or clarify their potential functions.</p>
<p>LncRNAs exert their effects by targeting protein-coding genes. There is accumulating evidence to suggest that lncRNAs are important factors that control gene expression through both <italic>cis</italic> and <italic>trans</italic>-acting regulatory mechanisms (Han et al., <xref ref-type="bibr" rid="B11">2012</xref>). To gain insight into how interactions between lncRNAs and their target genes regulate muscle development, interaction networks composed of DE-lncRNAs and their predicted <italic>cis</italic>- and <italic>trans</italic>-acting targets were constructed. The information about the direction (sense or antisense) of lncRNA transcripts are presented in the Tables <xref ref-type="supplementary-material" rid="SM1">S1</xref>&#x02013;<xref ref-type="supplementary-material" rid="SM3">S3</xref>, <xref ref-type="supplementary-material" rid="SM7">S7</xref>&#x02013;<xref ref-type="supplementary-material" rid="SM9">S9</xref>. There is not a correlation between sense <italic>cis</italic>-acting lncRNA and gene activation or antisense <italic>cis</italic>-acting lncRNA and gene silencing based on data presented in Tables <xref ref-type="supplementary-material" rid="SM7">S7</xref>&#x02013;<xref ref-type="supplementary-material" rid="SM9">S9</xref>. 54.03% of <italic>cis</italic>-acting lncRNAs is located in the upstream of their corresponding target genes, while 45.48% of <italic>cis</italic>-acting lncRNAs is located in the downstream of their corresponding target genes, and only 0.49% of <italic>cis</italic>-acting lncRNAs is located in their target genes body. Using IPA system, the function of lncRNA target genes were identified. Among three contrasts (E11 vs. E16, E11 vs. D1, E16 vs. D1), the lncRNA target genes of E11 vs. E16 comparisons were independently enriched in &#x0201C;cancer,&#x0201D; &#x0201C;organismal injury and abnormalities,&#x0201D; &#x0201C;cell cycle,&#x0201D; and &#x0201C;connective tissue development and function&#x0201D;; whereas the lncRNA target genes of E11 vs. D1 comparisons were independently enriched in &#x0201C;cell morphology,&#x0201D; &#x0201C;organ morphology,&#x0201D; &#x0201C;embryonic development,&#x0201D; &#x0201C;organismal development,&#x0201D; and &#x0201C;tissue development&#x0201D;; and the lncRNA target genes of E16 vs. D1 comparisons were independently enriched in &#x0201C;nervous system development and function&#x0201D; and &#x0201C;ophthalmic disease&#x0201D; (Table <xref ref-type="table" rid="T3">3</xref>).</p>
<table-wrap position="float" id="T3">
<label>Table 3</label>
<caption><p><bold>Summary of the most highly represented networks generated by IPA analysis</bold>.</p></caption>
<table frame="hsides" rules="groups">
<thead><tr>
<th valign="top" align="left"><bold>Data</bold></th>
<th valign="top" align="center"><bold>ID</bold></th>
<th valign="top" align="left"><bold>Molecules in networks</bold></th>
<th valign="top" align="center"><bold>Score</bold></th>
<th valign="top" align="center"><bold>Focus gene</bold></th>
<th valign="top" align="left"><bold>Top functions</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">E11 vs. E16</td>
<td valign="top" align="center">1</td>
<td valign="top" align="left"><bold>ACADL</bold>; <bold>ANO6</bold>; <bold>CAP2</bold>; <bold>COLEC11</bold>;, Cg; Cyclin A; <bold>DLK1</bold>; <bold>EGR1</bold>; <bold>EPCAM</bold>; <bold>ERBB4</bold>; ERK1/2; <bold>FGL2</bold>; FSH; <bold>GPSM1</bold>; <bold>HSD3B2</bold>; Igm; Immunoglobulin; Lh; <bold>MTUS1</bold>; Mitochondrial complex 1; <bold>NDUFA8</bold>; <bold>NELL2</bold>; <bold>NOD1</bold>; Nos; Nr1h; <bold>PITX1</bold>; <bold>PLIN1</bold>; <bold>PTPN21</bold>; <bold>PTX3</bold>; <bold>RGN</bold>; <bold>SHOX</bold>; <bold>SOD2</bold>; <bold>SOX6</bold>; TCF; TSH</td>
<td valign="top" align="center">45</td>
<td valign="top" align="center">23</td>
<td valign="top" align="left">Cancer, organismal injury and abnormalities, cell cycle</td>
</tr>
<tr>
<td/>
<td valign="top" align="center">2</td>
<td valign="top" align="left"><bold>ACAT2</bold>; <bold>ANKRD44</bold>; Akt; <bold>CPS1</bold>; Ck2; <bold>DAB1</bold>; <bold>DECR1</bold>; <bold>DUSP8</bold>; <bold>ECHS1</bold>; <bold>EPHA4</bold>; <bold>EPHX2</bold>; <bold>FABP7</bold>; <bold>G6PC2</bold>; <bold>HADHA</bold>; <bold>HADHB</bold>; <bold>IL16</bold>; Jnk; <bold>LAMA4</bold>; LDL; <bold>MTMR7</bold>; <bold>MYL3</bold>; <bold>PBK</bold>; PDGF BB; PLC gamma; <bold>PTN</bold>; STAT5a/b; <bold>STRBP</bold>; <bold>TEAD4</bold>; <bold>TSC22D1</bold>; acetyl-CoA C-acetyltransferase; enoyl-CoA hydratase; hemoglobin; mediator; p85 (pik3r); phosphatase</td>
<td valign="top" align="center">45</td>
<td valign="top" align="center">22</td>
<td valign="top" align="left">Developmental disorder, hereditary disorder, metabolic disease</td>
</tr>
<tr>
<td/>
<td valign="top" align="center">3</td>
<td valign="top" align="left">26s Proteasome; ADRB, Actin; Alpha catenin; <bold>CALB1</bold>; CD3; <bold>CDH8</bold>; Creb; <bold>DHCR24</bold>; <bold>DMD</bold>; <bold>EGFL6</bold>; <bold>EGLN3</bold>; <bold>FHDC1</bold>; <bold>FREM2</bold>; Histone h3; Hsp90; Insulin; <bold>MLF1</bold>; <bold>MYL1</bold>; NFkB (complex); <bold>NSDHL</bold>; <bold>PPP2R2B</bold>; RNA polymerase II; <bold>ROBO1</bold>; <bold>SLC20A2</bold>; <bold>STOM</bold>; <bold>SVIL</bold>; Sos; <bold>TIPARP</bold>; <bold>TNNT3</bold>; <bold>TSPAN9</bold>; Ubiquitin; <bold>WNT7B</bold>; caspase; estrogen receptor</td>
<td valign="top" align="center">39</td>
<td valign="top" align="center">20</td>
<td valign="top" align="left">Cancer, organismal injury and abnormalities, reproductive system disease</td>
</tr>
<tr style="border-bottom: thin solid #000000;">
<td/>
<td valign="top" align="center">4</td>
<td valign="top" align="left">ABCA6; <bold>ADAMTS18</bold>; AMMECR1L; <bold>ASB12</bold>; CCND1; CDK1; CHUK; <bold>CUTA</bold>; <bold>FAT4</bold>; <bold>FGL1</bold>; <bold>HOXD4</bold>; HSF1; IL10; IL1A; <bold>LECT2</bold>; LZTS1; <bold>MFAP5</bold>; <bold>MRPL18</bold>; MYH10; <bold>RHCG</bold>; RUNX1; SEC16B; <bold>SFXN5</bold>; <bold>SLC13A3</bold>; SLC24A3; <bold>SMAD9</bold>; SMOC2; SPRR2B; SRPK2; STON1; <bold>THNSL1</bold>; TMPRSS11A; <bold>ZFHX4</bold>; beta-estradiol; cholesterol</td>
<td valign="top" align="center">27</td>
<td valign="top" align="center">15</td>
<td valign="top" align="left">Cellular development, cellular growth and proliferation, connective tissue development and function</td>
</tr> <tr>
<td valign="top" align="left">E11 vs. D1</td>
<td valign="top" align="center">5</td>
<td valign="top" align="left">Actin; Alpha catenin; <bold>CASP3</bold>; <bold>CDH4</bold>; <bold>CSRNP3</bold>; <bold>DCLK1</bold>; <bold>DMD</bold>; ERK; F Actin; <bold>GSN</bold>; <bold>LBR</bold>; <bold>MKL2</bold>; <bold>MYL3</bold>; Mlc; <bold>OSBP2</bold>; P glycoprotein; <bold>PAIP2</bold>; PARP; <bold>PARP1</bold>; <bold>PLEK2</bold>; Pro-inflammatory Cytokine; <bold>ROBO1</bold>; SAA; <bold>SCLT1</bold>; <bold>SH3PXD2A</bold>; <bold>SLC20A2</bold>; <bold>SLC38A2</bold>; <bold>STK39</bold>; <bold>STOM</bold>; <bold>SVIL</bold>; <bold>TNNT3</bold>; Tnf (family); Troponin t; calpain; caspase</td>
<td valign="top" align="center">36</td>
<td valign="top" align="center">22</td>
<td valign="top" align="left">Cell morphology, organ morphology, reproductive system development and function</td>
</tr>
<tr style="border-bottom: thin solid #000000;">
<td/>
<td valign="top" align="center">6</td>
<td valign="top" align="left"><bold>ASAH1</bold>; <bold>EPHA4</bold>; <bold>EPHB6</bold>; ERK1/2; Eph Receptor; <bold>FANCI</bold>; <bold>FGF13</bold>; <bold>FGFR1</bold>; Integrin; JINK1/2; <bold>LAMA4</bold>; <bold>MAP4K4</bold>; <bold>MTUS1</bold>; N-cor; <bold>NELL2</bold>; Nfatc; Nr1h; <bold>PAX3</bold>; PEPCK; PLC gamma; <bold>PLIN1</bold>; <bold>PPARGC1A</bold>; <bold>PTN</bold>; Proinsulin; Rar; Rxr; <bold>STRBP</bold>; T3-TR-RXR; <bold>TPT1</bold>; <bold>TSC22D1</bold>; Wnt; <bold>XYLT1</bold>; <bold>ZRANB1</bold>; creatine kinase; histone deacetylase</td>
<td valign="top" align="center">33</td>
<td valign="top" align="center">19</td>
<td valign="top" align="left">Embryonic development, organismal development, tissue development</td>
</tr> <tr>
<td valign="top" align="left">E16 vs. D1</td>
<td valign="top" align="center">7</td>
<td valign="top" align="left"><bold>ACSL1</bold>; ANGPTL1; Akt; Ap1; <bold>CD82</bold>; <bold>CNR1</bold>; <bold>DKK3</bold>; ERK; GPR135; IL12 (complex); IL12 (family); <bold>IL15</bold>; <bold>IL18R1</bold>; Igm; Immunoglobulin; Insulin; Jnk; MARVELD3; MUC8; Mapk; NFkB (complex); NMUR1; P38 MAPK; <bold>PDK1</bold>; PROKR1; <bold>PTTG1</bold>; SLC22A17; <bold>SLC38A2</bold>; <bold>SLC4A7</bold>; TAS1R2; TLR3/4; <bold>TPD52L1</bold>; TRAF1-TRAF2-TRAF3; ZNF675; ethylene glycol</td>
<td valign="top" align="center">27</td>
<td valign="top" align="center">11</td>
<td valign="top" align="left">Nervous system development and function, cellular development, cellular growth and proliferation</td>
</tr>
<tr>
<td/>
<td valign="top" align="center">8</td>
<td valign="top" align="left">ALKBH6; ARL17A/ARL17B; CCND1; CMC2; COQ10B; <bold>COQ7</bold>; <bold>COTL1</bold>; CPED1; CYP3A43; Ca2&#x0002B;; EXO5; <bold>FREM2</bold>; FUK; FUT10; GRIP1; GUF1; HHLA2; HNF1A; HNF1&#x003B1; dimer; HNF4A; <bold>KCNIP1</bold>; <bold>NDUFA8</bold>; <bold>NDUFS3</bold>; PAFAH2; PPCS; PRIMPOL; <bold>RNF150</bold>; RPA2; <bold>SLC38A4</bold>; <bold>THNSL1</bold>; TNF; UBE2D3; UGT2B11; ZNF502; mead acid</td>
<td valign="top" align="center">23</td>
<td valign="top" align="center">9</td>
<td valign="top" align="left">Developmental disorder, hereditary disorder, ophthalmic disease</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p><italic>Gene symbols written in <bold>bold</bold> font indicate that the respective genes are DE-lncRNA target genes</italic>.</p>
</table-wrap-foot>
</table-wrap>
<p>Based on the lncRNA-gene interaction networks, <italic>TEAD4</italic> is predicted to be a target of lnc00003323. Moreover, the <italic>TEAD4</italic> gene plays an important role in the gene-gene network that is involved in developmental disorders and metabolic disease (Figure <xref ref-type="fig" rid="F7">7B</xref>). To our knowledge, prior to this analysis, no reports existed concerning the association between <italic>TEAD4</italic> and lncRNA. TEAD4 is a transcription factor that has a conserved TEA/ATTS DNA-binding domain, which recognizes the MCAT element in the promoters of muscle-specific genes (Benhaddou et al., <xref ref-type="bibr" rid="B2">2012</xref>). In mouse embryos, <italic>TEAD4</italic> is specifically expressed in developing skeletal muscle tissue (Jacquemin et al., <xref ref-type="bibr" rid="B13">1996</xref>). A previous study demonstrated that <italic>TEAD4</italic> is a direct target gene of the MYOD1 and MYOG transcription factors in the mouse C2C12 cell line (Jacquemin et al., <xref ref-type="bibr" rid="B13">1996</xref>). In mouse 2-cell embryos, ablation of the mouse <italic>TEAD4</italic> gene leads to lack of trophectoderm specification and early preimplantation lethality (Benhaddou et al., <xref ref-type="bibr" rid="B2">2012</xref>). Moreover, <italic>TEAD4</italic> is an important regulator of proliferation and organ size that plays a role in the Hippo signaling pathway of both <italic>Drosophila</italic> and mammalian cells (Zhao et al., <xref ref-type="bibr" rid="B32">2010</xref>). The aforementioned studies indicate that <italic>TEAD4</italic> in particular, is an important regulator of muscle development. In the present study, <italic>TEAD4</italic> was expressed at higher levels at stage E16 than at stage E11, in skeletal muscles of the leg (Figure <xref ref-type="fig" rid="F8">8A</xref>). The predicted regulatory lncRNA, lnc00003323, could control the expression of <italic>TEAD4</italic> via <italic>cis</italic>-acting mechanisms, and is expressed at higher levels in skeletal muscle at stage E16 than at stage E11 (Figure <xref ref-type="fig" rid="F8">8B</xref>). Authors of a previous study have suggested that lncRNAs could activate the transcription of nearby genes in <italic>cis</italic> by recruiting remodeling factors to local chromatin (Luo et al., <xref ref-type="bibr" rid="B22">2015</xref>). The positive relationship between lnc00003323 and <italic>TEAD4</italic> observed in the present study indicates that lnc00003323 targets <italic>TEAD4</italic> via <italic>cis</italic>-acting mechanisms to regulate skeletal muscle development in the chicken.</p>
<p>In the E11 vs. E16 comparison lncRNA-gene network (Figure <xref ref-type="fig" rid="F4">4</xref>), the <italic>DMD</italic> gene is the putative <italic>cis</italic>-target of lnc00005738. In addition, <italic>DMD</italic> plays an important role in gene-gene networks that are involved in organismal injury and abnormalities, cell morphology and organ morphology (Figures <xref ref-type="fig" rid="F7">7C,E</xref>). The <italic>DMD</italic> gene is the largest gene described in human beings that encodes a rod-like cytoskeletal protein that is found at the inner surface of muscle fibers in skeletal and cardiac muscles (Muntoni et al., <xref ref-type="bibr" rid="B25">2003</xref>). The encoded protein, dystrophin, is required for proper development and organization of myofibers, as contractile units in striated muscles (Ghahramani et al., <xref ref-type="bibr" rid="B9">2010</xref>).</p>
<p>In the E11 vs. D1 comparison lncRNA-gene network (Figure <xref ref-type="fig" rid="F5">5</xref>), <italic>FGF13</italic> is a predicted <italic>cis</italic>-target of lnc00023378 that is a part of the gene-gene interaction network that is related to embryonic development, organismal development, and tissue development (Figure <xref ref-type="fig" rid="F7">7F</xref>). <italic>FGF13</italic> is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion (Itoh and Ornitz, <xref ref-type="bibr" rid="B12">2008</xref>). A recent study demonstrated that <italic>FGF13</italic> regulates proliferation and differentiation of skeletal muscle by down-regulating <italic>Spry1</italic> (Lu et al., <xref ref-type="bibr" rid="B20">2015</xref>). <italic>DLK1</italic>, which encodes a transmembrane protein, is the putative <italic>cis</italic>-target of lnc00073545 (Figure <xref ref-type="fig" rid="F4">4</xref>). <italic>DLK1</italic> is an imprinted gene, the increased expression of which is associated with muscle hypertrophy in animal models. As with many imprinted genes, <italic>DLK1</italic> plays an important role in mammalian development, and its expression level exerts remarkable effects on cell proliferation and differentiation (Waddell et al., <xref ref-type="bibr" rid="B29">2010</xref>). Previous research has shown that <italic>DLK1</italic> is a crucial regulator of the myogenic program in skeletal muscle. During embryogenesis, <italic>DLK1</italic> knockout mice display developmental delays in gaining muscle mass and function, owing to inhibition of the myogenic program (Andersen et al., <xref ref-type="bibr" rid="B1">2013</xref>). In the present study, lnc00073545 and <italic>DLK1</italic> were expressed at higher levels in skeletal muscle of the leg at stage E16, as compared to stage E11 (Figures <xref ref-type="fig" rid="F8">8G,H</xref>). The positive correlation between lnc00073545 and <italic>DLK1</italic> expression patterns suggest that lnc00073545 might play an important role in skeletal muscle development in the chicken via its <italic>cis</italic>-regulation of <italic>DLK1</italic>.</p>
<p>In summary, we have identified a set of lncRNAs and genes that are differentially expressed at three different stages of skeletal muscle development in the chicken. The functions of, and biological processes associated with lncRNAs in skeletal muscle development were determined, based on IPA analysis and GO and KEGG pathway annotations of lncRNA target genes. The results of the <italic>cis</italic>- and <italic>trans</italic>-acting lncRNA target gene analyses and the lncRNA-gene interaction networks provide information that could be utilized in further studies of lncRNA function in skeletal muscle development in the chicken.</p>
</sec>
<sec id="s5">
<title>Author contributions</title>
<p>ZL: performed research, analyzed data, and wrote the paper. HO: analyzed data and was involved in the study design. MZ, BC, PH: analyzed data. BA: reviewed the manuscript. QN conceived the study, and was involved in its design and coordination. XZ was involved in the design of the study.</p>
</sec>
<sec id="s6">
<title>Funding</title>
<p>This research was supported by the Program for New Century Excellent Talents in University (NCET-13-0803) and the Foundation for High-level Talents in Higher Education of Guangdong, China.</p>
<sec>
<title>Conflict of interest statement</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
</sec>
</body>
<back>
<sec sec-type="supplementary-material" id="s7">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="http://journal.frontiersin.org/article/10.3389/fphys.2016.00687/full#supplementary-material">http://journal.frontiersin.org/article/10.3389/fphys.2016.00687/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Table1.XLSX" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table2.XLSX" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table3.XLS" id="SM3" mimetype="application/vnd.ms-excel" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table4.XLSX" id="SM4" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table5.XLSX" id="SM5" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table6.XLSX" id="SM6" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table7.XLSX" id="SM7" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table8.XLSX" id="SM8" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table9.XLSX" id="SM9" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table10.xlsx" id="SM10" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table11.xlsx" id="SM11" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table12.xlsx" id="SM12" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table13.xlsx" id="SM13" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table14.xlsx" id="SM14" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table15.xlsx" id="SM15" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.PDF" id="SM16" mimetype="application/pdf" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Andersen</surname> <given-names>D. C.</given-names></name> <name><surname>Laborda</surname> <given-names>J.</given-names></name> <name><surname>Baladron</surname> <given-names>V.</given-names></name> <name><surname>Kassem</surname> <given-names>M.</given-names></name> <name><surname>Sheikh</surname> <given-names>S. P.</given-names></name> <name><surname>Jensen</surname> <given-names>C. H.</given-names></name></person-group> (<year>2013</year>). <article-title>Dual role of delta-like 1 homolog (DLK1) in skeletal muscle development and adult muscle regeneration</article-title>. <source>Development</source> <volume>140</volume>, <fpage>3743</fpage>&#x02013;<lpage>3753</lpage>. <pub-id pub-id-type="doi">10.1242/dev.095810</pub-id><pub-id pub-id-type="pmid">23946446</pub-id></citation>
</ref>
<ref id="B2">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Benhaddou</surname> <given-names>A.</given-names></name> <name><surname>Keime</surname> <given-names>C.</given-names></name> <name><surname>Ye</surname> <given-names>T.</given-names></name> <name><surname>Morlon</surname> <given-names>A.</given-names></name> <name><surname>Michel</surname> <given-names>I.</given-names></name> <name><surname>Jost</surname> <given-names>B.</given-names></name> <etal/></person-group>. (<year>2012</year>). <article-title>Transcription factor TEAD4 regulates expression of myogenin and the unfolded protein response genes during C2C12 cell differentiation</article-title>. <source>Cell Death Differ.</source> <volume>19</volume>, <fpage>220</fpage>&#x02013;<lpage>231</lpage>. <pub-id pub-id-type="doi">10.1038/cdd.2011.87</pub-id><pub-id pub-id-type="pmid">21701496</pub-id></citation>
</ref>
<ref id="B3">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bu</surname> <given-names>Q.</given-names></name> <name><surname>Hu</surname> <given-names>Z.</given-names></name> <name><surname>Chen</surname> <given-names>F.</given-names></name> <name><surname>Zhu</surname> <given-names>R.</given-names></name> <name><surname>Deng</surname> <given-names>Y.</given-names></name> <name><surname>Shao</surname> <given-names>X.</given-names></name> <etal/></person-group>. (<year>2012</year>). <article-title>Transcriptome analysis of long non-coding RNAs of the nucleus accumbens in cocaine-conditioned mice</article-title>. <source>J. Neurochem.</source> <volume>123</volume>, <fpage>790</fpage>&#x02013;<lpage>799</lpage>. <pub-id pub-id-type="doi">10.1111/jnc.12006</pub-id><pub-id pub-id-type="pmid">22957495</pub-id></citation>
</ref>
<ref id="B4">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cesana</surname> <given-names>M.</given-names></name> <name><surname>Cacchiarelli</surname> <given-names>D.</given-names></name> <name><surname>Legnini</surname> <given-names>I.</given-names></name> <name><surname>Santini</surname> <given-names>T.</given-names></name> <name><surname>Sthandier</surname> <given-names>O.</given-names></name> <name><surname>Chinappi</surname> <given-names>M.</given-names></name> <etal/></person-group>. (<year>2011</year>). <article-title>A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA</article-title>. <source>Cell</source> <volume>147</volume>, <fpage>358</fpage>&#x02013;<lpage>369</lpage>. <pub-id pub-id-type="doi">10.1016/j.cell.2011.09.028</pub-id><pub-id pub-id-type="pmid">22000014</pub-id></citation>
</ref>
<ref id="B5">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Derrien</surname> <given-names>T.</given-names></name> <name><surname>Johnson</surname> <given-names>R.</given-names></name> <name><surname>Bussotti</surname> <given-names>G.</given-names></name> <name><surname>Tanzer</surname> <given-names>A.</given-names></name> <name><surname>Djebali</surname> <given-names>S.</given-names></name> <name><surname>Tilgner</surname> <given-names>H.</given-names></name> <etal/></person-group>. (<year>2012</year>). <article-title>The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression</article-title>. <source>Genome Res.</source> <volume>22</volume>, <fpage>1775</fpage>&#x02013;<lpage>1789</lpage>. <pub-id pub-id-type="doi">10.1101/gr.132159.111</pub-id><pub-id pub-id-type="pmid">22955988</pub-id></citation>
</ref>
<ref id="B6">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Dimitrova</surname> <given-names>N.</given-names></name> <name><surname>Zamudio</surname> <given-names>J. R.</given-names></name> <name><surname>Jong</surname> <given-names>R. M.</given-names></name> <name><surname>Soukup</surname> <given-names>D.</given-names></name> <name><surname>Resnick</surname> <given-names>R.</given-names></name> <name><surname>Sarma</surname> <given-names>K.</given-names></name> <etal/></person-group>. (<year>2014</year>). <article-title>LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint</article-title>. <source>Mol. Cell</source> <volume>54</volume>, <fpage>777</fpage>&#x02013;<lpage>790</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2014.04.025</pub-id><pub-id pub-id-type="pmid">24857549</pub-id></citation>
</ref>
<ref id="B7">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Dong</surname> <given-names>R.</given-names></name> <name><surname>Jia</surname> <given-names>D.</given-names></name> <name><surname>Xue</surname> <given-names>P.</given-names></name> <name><surname>Cui</surname> <given-names>X.</given-names></name> <name><surname>Li</surname> <given-names>K.</given-names></name> <name><surname>Zheng</surname> <given-names>S.</given-names></name> <etal/></person-group>. (<year>2014</year>). <article-title>Genome-wide analysis of long noncoding RNA (lncRNA) expression in hepatoblastoma tissues</article-title>. <source>PLoS ONE</source> <volume>9</volume>:<fpage>e85599</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0085599</pub-id><pub-id pub-id-type="pmid">24465615</pub-id></citation>
</ref>
<ref id="B8">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Fatica</surname> <given-names>A.</given-names></name> <name><surname>Bozzoni</surname> <given-names>I.</given-names></name></person-group> (<year>2014</year>). <article-title>Long non-coding RNAs: new players in cell differentiation and development</article-title>. <source>Nat. Rev. Genet.</source> <volume>15</volume>, <fpage>7</fpage>&#x02013;<lpage>21</lpage>. <pub-id pub-id-type="doi">10.1038/nrg3606</pub-id><pub-id pub-id-type="pmid">24296535</pub-id></citation>
</ref>
<ref id="B9">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ghahramani</surname> <given-names>S. M.</given-names></name> <name><surname>Trollet</surname> <given-names>C.</given-names></name> <name><surname>Athanasopoulos</surname> <given-names>T.</given-names></name> <name><surname>Graham</surname> <given-names>I. R.</given-names></name> <name><surname>Hu</surname> <given-names>P.</given-names></name> <name><surname>Dickson</surname> <given-names>G.</given-names></name></person-group> (<year>2010</year>). <article-title>Transcriptomic analysis of dystrophin RNAi knockdown reveals a central role for dystrophin in muscle differentiation and contractile apparatus organization</article-title>. <source>BMC Genomics</source> <volume>11</volume>:<fpage>345</fpage>. <pub-id pub-id-type="doi">10.1186/1471-2164-11-345</pub-id><pub-id pub-id-type="pmid">20515474</pub-id></citation>
</ref>
<ref id="B10">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Grote</surname> <given-names>P.</given-names></name> <name><surname>Wittler</surname> <given-names>L.</given-names></name> <name><surname>Hendrix</surname> <given-names>D.</given-names></name> <name><surname>Koch</surname> <given-names>F.</given-names></name> <name><surname>W&#x000E4;hrisch</surname> <given-names>S.</given-names></name> <name><surname>Beisaw</surname> <given-names>A.</given-names></name> <etal/></person-group>. (<year>2013</year>). <article-title>The tissue-specific lncRNA Fendrr is an essential regulator of heart and body wall development in the mouse</article-title>. <source>Dev. Cell</source> <volume>24</volume>, <fpage>206</fpage>&#x02013;<lpage>214</lpage>. <pub-id pub-id-type="doi">10.1016/j.devcel.2012.12.012</pub-id><pub-id pub-id-type="pmid">23369715</pub-id></citation>
</ref>
<ref id="B11">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Han</surname> <given-names>L.</given-names></name> <name><surname>Zhang</surname> <given-names>K.</given-names></name> <name><surname>Shi</surname> <given-names>Z.</given-names></name> <name><surname>Zhang</surname> <given-names>J.</given-names></name> <name><surname>Zhu</surname> <given-names>J.</given-names></name> <name><surname>Zhu</surname> <given-names>S.</given-names></name> <etal/></person-group>. (<year>2012</year>). <article-title>LncRNA profile of glioblastoma reveals the potential role of lncRNAs in contributing to glioblastoma pathogenesis</article-title>. <source>Int. J. Oncol.</source> <volume>40</volume>, <fpage>2004</fpage>&#x02013;<lpage>2012</lpage>. <pub-id pub-id-type="doi">10.3892/ijo.2012.1413</pub-id><pub-id pub-id-type="pmid">22446686</pub-id></citation>
</ref>
<ref id="B12">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Itoh</surname> <given-names>N.</given-names></name> <name><surname>Ornitz</surname> <given-names>D. M.</given-names></name></person-group> (<year>2008</year>). <article-title>Functional evolutionary history of the mouse Fgf gene family</article-title>. <source>Dev. Dyn.</source> <volume>237</volume>, <fpage>18</fpage>&#x02013;<lpage>27</lpage>. <pub-id pub-id-type="doi">10.1002/dvdy.21388</pub-id><pub-id pub-id-type="pmid">18058912</pub-id></citation>
</ref>
<ref id="B13">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jacquemin</surname> <given-names>P.</given-names></name> <name><surname>Hwang</surname> <given-names>J. J.</given-names></name> <name><surname>Martial</surname> <given-names>J. A.</given-names></name> <name><surname>Doll&#x000E9;</surname> <given-names>P.</given-names></name> <name><surname>Davidson</surname> <given-names>I.</given-names></name></person-group> (<year>1996</year>). <article-title>A novel family of developmentally regulated mammalian transcription factors containing the TEA/ATTS DNA binding domain</article-title>. <source>J. Biol. Chem.</source> <volume>271</volume>, <fpage>21775</fpage>&#x02013;<lpage>21785</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.271.36.21775</pub-id><pub-id pub-id-type="pmid">8702974</pub-id></citation>
</ref>
<ref id="B14">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kallen</surname> <given-names>A. N.</given-names></name> <name><surname>Zhou</surname> <given-names>X. B.</given-names></name> <name><surname>Xu</surname> <given-names>J.</given-names></name> <name><surname>Qiao</surname> <given-names>C.</given-names></name> <name><surname>Ma</surname> <given-names>J.</given-names></name> <name><surname>Yan</surname> <given-names>L.</given-names></name> <etal/></person-group>. (<year>2013</year>). <article-title>The imprinted H19 lncRNA antagonizes let-7 microRNAs</article-title>. <source>Mol. Cell</source> <volume>52</volume>, <fpage>101</fpage>&#x02013;<lpage>112</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2013.08.027</pub-id><pub-id pub-id-type="pmid">24055342</pub-id></citation>
</ref>
<ref id="B15">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Klattenhoff</surname> <given-names>C. A.</given-names></name> <name><surname>Scheuermann</surname> <given-names>J. C.</given-names></name> <name><surname>Surface</surname> <given-names>L. E.</given-names></name> <name><surname>Bradley</surname> <given-names>R. K.</given-names></name> <name><surname>Fields</surname> <given-names>P. A.</given-names></name> <name><surname>Steinhauser</surname> <given-names>M. L.</given-names></name> <etal/></person-group>. (<year>2013</year>). <article-title>Braveheart, a long noncoding RNA required for cardiovascular lineage commitment</article-title>. <source>Cell</source> <volume>152</volume>, <fpage>570</fpage>&#x02013;<lpage>583</lpage>. <pub-id pub-id-type="doi">10.1016/j.cell.2013.01.003</pub-id><pub-id pub-id-type="pmid">23352431</pub-id></citation>
</ref>
<ref id="B16">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>J. T.</given-names></name> <name><surname>Bartolomei</surname> <given-names>M. S.</given-names></name></person-group> (<year>2013</year>). <article-title>X-inactivation, imprinting, and long noncoding RNAs in health and disease</article-title>. <source>Cell</source> <volume>152</volume>, <fpage>1308</fpage>&#x02013;<lpage>1323</lpage>. <pub-id pub-id-type="doi">10.1016/j.cell.2013.02.016</pub-id><pub-id pub-id-type="pmid">23498939</pub-id></citation>
</ref>
<ref id="B17">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>T.</given-names></name> <name><surname>Wang</surname> <given-names>S.</given-names></name> <name><surname>Wu</surname> <given-names>R.</given-names></name> <name><surname>Zhou</surname> <given-names>X.</given-names></name> <name><surname>Zhu</surname> <given-names>D.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name></person-group> (<year>2012</year>). <article-title>Identification of long non-protein coding RNAs in chicken skeletal muscle using next generation sequencing</article-title>. <source>Genomics</source> <volume>99</volume>, <fpage>292</fpage>&#x02013;<lpage>298</lpage>. <pub-id pub-id-type="doi">10.1016/j.ygeno.2012.02.003</pub-id><pub-id pub-id-type="pmid">22374175</pub-id></citation>
</ref>
<ref id="B18">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>Z. L.</given-names></name> <name><surname>Qin</surname> <given-names>Q-M., Shi, Z. D.</given-names></name> <name><surname>Chen</surname> <given-names>H. N.</given-names></name> <name><surname>Huang</surname> <given-names>Q. S.</given-names></name></person-group> (<year>2012</year>). <article-title>Sex identification with direct whole blood PCR amplification in chicklings and chicken embryos</article-title>. <source>China Anim. Husbandry Vet. Med.</source> <volume>9</volume>, <fpage>74</fpage>&#x02013;<lpage>78</lpage>.</citation>
</ref>
<ref id="B19">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Livak</surname> <given-names>K. J.</given-names></name> <name><surname>Schmittgen</surname> <given-names>T. D.</given-names></name></person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2<sup>&#x02212;&#x00394;&#x00394;C<sub>T</sub></sup> Method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x02013;<lpage>408</lpage>. <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id><pub-id pub-id-type="pmid">11846609</pub-id></citation>
</ref>
<ref id="B20">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lu</surname> <given-names>H.</given-names></name> <name><surname>Shi</surname> <given-names>X.</given-names></name> <name><surname>Wu</surname> <given-names>G.</given-names></name> <name><surname>Zhu</surname> <given-names>J.</given-names></name> <name><surname>Song</surname> <given-names>C.</given-names></name> <name><surname>Zhang</surname> <given-names>Q.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>FGF13 regulates proliferation and differentiation of skeletal muscle by down-regulating Spry1</article-title>. <source>Cell Prolif.</source> <volume>48</volume>, <fpage>550</fpage>&#x02013;<lpage>560</lpage>. <pub-id pub-id-type="doi">10.1111/cpr.12200</pub-id><pub-id pub-id-type="pmid">26230950</pub-id></citation>
</ref>
<ref id="B21">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Luo</surname> <given-names>W.</given-names></name> <name><surname>Nie</surname> <given-names>Q.</given-names></name> <name><surname>Zhang</surname> <given-names>X.</given-names></name></person-group> (<year>2013</year>). <article-title>MicroRNAs involved in skeletal muscle differentiation</article-title>. <source>J. Genet. Genomics</source> <volume>40</volume>, <fpage>107</fpage>&#x02013;<lpage>116</lpage>. <pub-id pub-id-type="doi">10.1016/j.jgg.2013.02.002</pub-id><pub-id pub-id-type="pmid">23522383</pub-id></citation>
</ref>
<ref id="B22">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Luo</surname> <given-names>Z.</given-names></name> <name><surname>Li</surname> <given-names>Y.</given-names></name> <name><surname>Liu</surname> <given-names>X.</given-names></name> <name><surname>Luo</surname> <given-names>M.</given-names></name> <name><surname>Xu</surname> <given-names>L.</given-names></name> <name><surname>Luo</surname> <given-names>Y.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>Systems biology of myasthenia gravis, integration of aberrant lncRNA and mRNA expression changes</article-title>. <source>BMC Med. Genomics</source> <volume>8</volume>:<fpage>13</fpage>. <pub-id pub-id-type="doi">10.1186/s12920-015-0087-z</pub-id><pub-id pub-id-type="pmid">25889429</pub-id></citation>
</ref>
<ref id="B23">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Morris</surname> <given-names>K. V.</given-names></name> <name><surname>Mattick</surname> <given-names>J. S.</given-names></name></person-group> (<year>2014</year>). <article-title>The rise of regulatory RNA</article-title>. <source>Nat. Rev. Genet.</source> <volume>15</volume>, <fpage>423</fpage>&#x02013;<lpage>437</lpage>. <pub-id pub-id-type="doi">10.1038/nrg3722</pub-id><pub-id pub-id-type="pmid">24776770</pub-id></citation>
</ref>
<ref id="B24">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Muers</surname> <given-names>M.</given-names></name></person-group> (<year>2011</year>). <article-title>RNA: genome-wide views of long non-coding RNAs</article-title>. <source>Nat. Rev. Genet.</source> <volume>12</volume>, <fpage>742</fpage>. <pub-id pub-id-type="doi">10.1038/nrg3088</pub-id><pub-id pub-id-type="pmid">21989130</pub-id></citation>
</ref>
<ref id="B25">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Muntoni</surname> <given-names>F.</given-names></name> <name><surname>Torelli</surname> <given-names>S.</given-names></name> <name><surname>Ferlini</surname> <given-names>A.</given-names></name></person-group> (<year>2003</year>). <article-title>Dystrophin and mutations: one gene, several proteins, multiple phenotypes</article-title>. <source>Lancet Neurol.</source> <volume>2</volume>, <fpage>731</fpage>&#x02013;<lpage>740</lpage>. <pub-id pub-id-type="doi">10.1016/S1474-4422(03)00585-4</pub-id><pub-id pub-id-type="pmid">14636778</pub-id></citation>
</ref>
<ref id="B26">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Novikova</surname> <given-names>I. V.</given-names></name> <name><surname>Hennelly</surname> <given-names>S. P.</given-names></name> <name><surname>Tung</surname> <given-names>C. S.</given-names></name> <name><surname>Sanbonmatsu</surname> <given-names>K. Y.</given-names></name></person-group> (<year>2013</year>). <article-title>Rise of the RNA machines: exploring the structure of long non-coding RNAs</article-title>. <source>J. Mol. Biol.</source> <volume>425</volume>, <fpage>3731</fpage>&#x02013;<lpage>3746</lpage>. <pub-id pub-id-type="doi">10.1016/j.jmb.2013.02.030</pub-id><pub-id pub-id-type="pmid">23467124</pub-id></citation>
</ref>
<ref id="B27">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Rapicavoli</surname> <given-names>N. A.</given-names></name> <name><surname>Poth</surname> <given-names>E. M.</given-names></name> <name><surname>Zhu</surname> <given-names>H.</given-names></name> <name><surname>Blackshaw</surname> <given-names>S.</given-names></name></person-group> (<year>2011</year>). <article-title>The long noncoding RNA <italic>Six3OS</italic> acts in <italic>trans</italic> to regulate retinal development by modulating Six3 activity</article-title>. <source>Neural. Dev.</source> <volume>6</volume>:<fpage>32</fpage>. <pub-id pub-id-type="doi">10.1186/1749-8104-6-32</pub-id><pub-id pub-id-type="pmid">21936910</pub-id></citation>
</ref>
<ref id="B28">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Sobolewska</surname> <given-names>A.</given-names></name> <name><surname>Elminowska-Wenda</surname> <given-names>G.</given-names></name> <name><surname>Bogucka</surname> <given-names>J.</given-names></name> <name><surname>Szpinda</surname> <given-names>M.</given-names></name> <name><surname>Walasik</surname> <given-names>K.</given-names></name> <name><surname>Bednarczyk</surname> <given-names>M.</given-names></name> <etal/></person-group>. (<year>2011</year>). <article-title>Myogenesis&#x02013;possibilities of its stimulation in chickens</article-title>. <source>Folia Biol.</source> <volume>59</volume>, <fpage>85</fpage>&#x02013;<lpage>90</lpage>. <pub-id pub-id-type="doi">10.3409/fb59_3-4.85-90</pub-id><pub-id pub-id-type="pmid">22195459</pub-id></citation>
</ref>
<ref id="B29">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Waddell</surname> <given-names>J. N.</given-names></name> <name><surname>Zhang</surname> <given-names>P.</given-names></name> <name><surname>Wen</surname> <given-names>Y.</given-names></name> <name><surname>Gupta</surname> <given-names>S. K.</given-names></name> <name><surname>Yevtodiyenko</surname> <given-names>A.</given-names></name> <name><surname>Schmidt</surname> <given-names>J. V.</given-names></name> <etal/></person-group>. (<year>2010</year>). <article-title>Dlk1 is necessary for proper skeletal muscle development and regeneration</article-title>. <source>PLoS ONE</source> <volume>5</volume>:<fpage>e15055</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0015055</pub-id><pub-id pub-id-type="pmid">21124733</pub-id></citation>
</ref>
<ref id="B30">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>K. C.</given-names></name> <name><surname>Chang</surname> <given-names>H. Y.</given-names></name></person-group> (<year>2011</year>). <article-title>Molecular mechanisms of long noncoding RNAs</article-title>. <source>Mol. Cell</source> <volume>43</volume>, <fpage>904</fpage>&#x02013;<lpage>914</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2011.08.018</pub-id><pub-id pub-id-type="pmid">21925379</pub-id></citation>
</ref>
<ref id="B31">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>Y.</given-names></name> <name><surname>Wang</surname> <given-names>J.</given-names></name> <name><surname>Huang</surname> <given-names>S.</given-names></name> <name><surname>Zhu</surname> <given-names>X.</given-names></name> <name><surname>Liu</surname> <given-names>J.</given-names></name> <name><surname>Yang</surname> <given-names>N.</given-names></name> <etal/></person-group>. (<year>2009</year>). <article-title>Systematic identification and characterization of chicken (<italic>Gallus gallus</italic>) ncRNAs</article-title>. <source>Nucleic Acids Res.</source> <volume>37</volume>, <fpage>6562</fpage>&#x02013;<lpage>6574</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkp704</pub-id><pub-id pub-id-type="pmid">19720738</pub-id></citation>
</ref>
<ref id="B32">
<citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname> <given-names>B.</given-names></name> <name><surname>Li</surname> <given-names>L.</given-names></name> <name><surname>Lei</surname> <given-names>Q.</given-names></name> <name><surname>Guan</surname> <given-names>K. L.</given-names></name></person-group> (<year>2010</year>). <article-title>The Hippo-YAP pathway in organ size control and tumorigenesis: an updated version</article-title>. <source>Genes Dev.</source> <volume>24</volume>, <fpage>862</fpage>&#x02013;<lpage>874</lpage>. <pub-id pub-id-type="doi">10.1101/gad.1909210</pub-id><pub-id pub-id-type="pmid">20439427</pub-id></citation>
</ref>
</ref-list>
<glossary>
<def-list>
<title>Abbreviations</title>
<def-item><term>CNCI</term>
<def><p>Coding-Non-Coding Index</p></def></def-item>
<def-item><term>CPC</term>
<def><p>Coding Potential Calculator</p></def></def-item>
<def-item><term>DEG</term>
<def><p>differentially expressed genes</p></def></def-item>
<def-item><term>FGF</term>
<def><p>fibroblast growth factor</p></def></def-item>
<def-item><term>GO</term>
<def><p>gene ontology</p></def></def-item>
<def-item><term>IPA</term>
<def><p>Ingenuity Pathway Analysis</p></def></def-item>
<def-item><term>IPKB</term>
<def><p>Ingenuity Pathways Knowledge Base</p></def></def-item>
<def-item><term>KEGG</term>
<def><p>Kyoto Encyclopedia of Genes and Genomes</p></def></def-item>
<def-item><term>PhyloCSF</term>
<def><p>Phylogenetic codon substitution frequency</p></def></def-item>
<def-item><term><italic>DMD</italic></term>
<def><p>dystrophin gene (gene that causes Duchenne muscular dystrophy)</p></def></def-item>
<def-item><term>LncRNA</term>
<def><p>long non-coding RNA.</p></def></def-item>
</def-list>
</glossary>
</back>
</article>