<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Pharmacol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Pharmacology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Pharmacol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1663-9812</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1778496</article-id>
<article-id pub-id-type="doi">10.3389/fphar.2026.1778496</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>IR-780 improves urination function and complications in rats with partial bladder outlet obstruction by protecting bladder smooth muscle cell mitochondria from oxidative stress</article-title>
<alt-title alt-title-type="left-running-head">Pi et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphar.2026.1778496">10.3389/fphar.2026.1778496</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Pi</surname>
<given-names>Feng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3334173"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yan</surname>
<given-names>Benhuang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jia</surname>
<given-names>Min</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Yuan</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tang</surname>
<given-names>Shuang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Zhihong</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Fang</surname>
<given-names>Qiang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1094102"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shi</surname>
<given-names>Chunmeng</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1751736"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Weibing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1085177"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Department of Urology, The Third Affiliated Hospital of Chongqing Medical University</institution>, <city>Chongqing</city>, <country country="CN">China</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Department of Urology, The Southwest Hospital of AMU</institution>, <city>Chongqing</city>, <country country="CN">China</country>
</aff>
<aff id="aff3">
<label>3</label>
<institution>State Key Laboratory of Trauma, Burns and Combined Injury, Institute of Rocket Force Medicine, Third Military Medical University</institution>, <city>Chongqing</city>, <country country="CN">China</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: Qiang Fang, <email xlink:href="mailto:650255@hospital.cqmu.edu.cn">650255@hospital.cqmu.edu.cn</email>; Weibing Li, <email xlink:href="mailto:liweibing63@cqmu.edu.cn">liweibing63@cqmu.edu.cn</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-02-27">
<day>27</day>
<month>02</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2026</year>
</pub-date>
<volume>17</volume>
<elocation-id>1778496</elocation-id>
<history>
<date date-type="received">
<day>31</day>
<month>12</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>04</day>
<month>02</month>
<year>2026</year>
</date>
<date date-type="accepted">
<day>12</day>
<month>02</month>
<year>2026</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Pi, Yan, Jia, Liu, Tang, Huang, Fang, Shi and Li.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Pi, Yan, Jia, Liu, Tang, Huang, Fang, Shi and Li</copyright-holder>
<license>
<ali:license_ref start_date="2026-02-27">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>Partial bladder outlet obstruction (pBOO) is the most common cause of lower urinary tract symptoms (LUTS). Prolonged BOO induces bladder remodeling, which can lead to severe bladder dysfunction and refractory LUTS in some patients, even after obstruction resolution. This condition significantly impairs patients&#x2019; quality of life, and no effective treatment is currently available. This study investigated a pBOO rat model using IR-780, a novel near-infrared lipophilic dye with potential targeted antioxidant effects.</p>
</sec>
<sec>
<title>Methods</title>
<p>A partial ligation of the rat bladder neck was performed to establish a pBOO model. After confirming successful modeling, the rats were randomly divided into sham, sham &#x2b; IR-780, pBOO, and pBOO &#x2b; IR-780 groups (eight rats per group). One week post-surgery, rats received intraperitoneal injections of IR-780 (0.667&#xa0;mg/kg) or an equivalent volume of phosphate buffered saline solution twice weekly for 3 weeks. Before evaluating efficacy using the bladder filling manometry method, we examined the distribution of IR-780 in tissues and subcellular compartments <italic>via</italic> confocal fluorescence imaging.</p>
</sec>
<sec>
<title>Results</title>
<p>IR-780 accumulated at high levels in the bladders of rats with pBOO, where it was primarily taken up by bladder smooth muscle cells (BSMCs) and localized within the mitochondria. Bladder pressure measurements revealed that IR-780 significantly improved bladder function in rats with pBOO. IR-780 effectively mitigated pathological changes in bladder smooth muscle tissue and concurrently alleviated pBOO-induced reflux nephropathy. <italic>In vitro</italic> and <italic>in vivo</italic> experiments confirmed that IR-780 significantly reduced apoptosis in BSMCs. Moreover, cryosection staining and transmission electron microscopy results demonstrated that IR-780 markedly decreased reactive oxygen species levels in BSMCs from rats with pBOO, prevented mitochondrial mass and morphological damage, and significantly reduced the levels of mitochondrial apoptosis pathway-related proteins (Bcl-2, Bcl-2-associated X, cytochrome C, and Caspase-9). We found that IR-780 upregulated the expression of nuclear factor erythroid 2-related factor 2 (Nrf2) and its associated antioxidant proteins in the bladder tissue of rats with pBOO.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>IR-780 improved urinary function and complications in rats with pBOO by protecting BSMC mitochondria from oxidative stress, which was potentially mediated through the activation of the Nrf2 pathway.</p>
</sec>
</abstract>
<kwd-group>
<kwd>bladder smoothmuscle cells</kwd>
<kwd>IR-780</kwd>
<kwd>lower urinary tract symptoms</kwd>
<kwd>nuclear factor erythroid 2-related factor 2 pathway</kwd>
<kwd>partial bladder outlet obstruction</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. Supported by National Natural Science Foundation of China Chongqing: CSTB2023NSCQ-MSX0113.</funding-statement>
</funding-group>
<counts>
<fig-count count="10"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="53"/>
<page-count count="19"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Renal Pharmacology</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<label>1</label>
<title>Introduction</title>
<p>Bladder outlet obstruction (BOO) is a common urological condition and a frequent cause of lower urinary tract symptoms (LUTS) (<xref ref-type="bibr" rid="B50">Wu et al., 2024</xref>). Partial BOO (pBOO) has diverse etiologies, including functional factors such as bladder neck obstruction, pelvic floor muscle hyperactivity, and mechanical factors such as urethral stricture, posterior urethral valves, and benign prostatic hyperplasia (<xref ref-type="bibr" rid="B30">Meier and Padmanabhan, 2016</xref>). pBOO leads to urinary dysfunction, detrusor overactivity, vesicoureteral reflux, urinary tract infections, and an overactive bladder, significantly impairing patients&#x2019; quality of life (<xref ref-type="bibr" rid="B9">Clout et al., 2025</xref>; <xref ref-type="bibr" rid="B42">Solomon et al., 2018</xref>; <xref ref-type="bibr" rid="B33">Miyata et al., 2019</xref>). In general, relieving obstruction can alleviate LUTS; however, long-term BOO induces structural and functional changes in the bladder, known as bladder remodeling, which result in persistent severe bladder dysfunction and refractory LUTS in some patients, even after the obstruction is resolved (<xref ref-type="bibr" rid="B2">Barbosa et al., 2017</xref>; <xref ref-type="bibr" rid="B6">Chen et al., 2021</xref>; <xref ref-type="bibr" rid="B21">Hughes et al., 2017</xref>). The precise mechanisms underlying pBOO-induced bladder remodeling remain unclear, and no effective clinical treatments are currently available to alleviate bladder dysfunction and its complications secondary to BOO.</p>
<p>Currently, few effective pharmacological therapies exist for bladder injury secondary to pBOO, which may be attributable to the complex pathophysiological mechanisms underlying this condition (<xref ref-type="bibr" rid="B24">Jiang et al., 2021</xref>; <xref ref-type="bibr" rid="B34">Miyazaki et al., 2020</xref>). Progressive bladder injury caused by pBOO is considered an ordered yet overlapping process, progressing from inflammation to fibrosis (<xref ref-type="bibr" rid="B20">Hughes et al., 2016</xref>). Obstruction causes excessive stretching of the bladder wall, increased pressure, and hypoxia/reperfusion within the bladder, progressively disrupting the bladder&#x2019;s physical structure and function (<xref ref-type="bibr" rid="B32">Metcalfe et al., 2010</xref>). Following pBOO, elevated intravesical pressure stimulates the proliferation of bladder smooth muscle cells (BSMCs) as well as proliferation and swelling of urothelial cells. These changes induce inflammation, activate bladder C-fibers, and attenuate voiding-related reflexes, thereby impairing bladder contraction and relaxation. Concurrently, pressure alterations can modulate the expression of bladder receptors, including nicotinic acetylcholine and purinergic receptors (<xref ref-type="bibr" rid="B5">Chen et al., 2012</xref>; <xref ref-type="bibr" rid="B49">Wazir et al., 2013</xref>), and promote the release of excitatory neurotransmitters such as ATP, leading to increased resistance in the urinary outflow tract and detrusor overactivity (<xref ref-type="bibr" rid="B12">Dunton et al., 2018</xref>). Structurally, in addition to the effects of hypoxia in pBOO (<xref ref-type="bibr" rid="B43">Stephany et al., 2013</xref>), mechanical traction elevates inflammatory mediators such as nuclear factor kappa-B (NF-&#x3ba;B), tumor necrosis factor (TNF)-&#x3b1;, and interleukin (IL)-6 (<xref ref-type="bibr" rid="B11">Drzewiecki et al., 2012</xref>), while ischemia-reperfusion increases oxidative stress in bladder tissue, leading to a surge in reactive oxygen species (ROS) (<xref ref-type="bibr" rid="B33">Miyata et al., 2019</xref>). Furthermore, the role of cellular energy metabolism disorders in abnormal tissue remodeling responses has been extensively demonstrated (<xref ref-type="bibr" rid="B22">Hughes et al., 2019</xref>). The mechanisms described above contribute to the pathophysiology of pBOO and trigger injury repair mechanisms, leading to the recruitment of neutrophils, monocytes, and other innate immune cells to the injury site to clear cellular debris and pathogens. Simultaneously, they coordinate with fibroblasts, endothelial cells, epithelial cells, and related stem cells to synthesize and release matrix metalloproteinases along with various growth factors and cytokines. Under the influence of pro-repair factors like transforming growth factor (TGF-&#x3b2;), these cells stimulate fibroblast migration and proliferation, promoting their activation into myofibroblasts. These cells then massively release extracellular matrix proteins such as collagen and fibronectin to participate in tissue repair (<xref ref-type="bibr" rid="B13">Eming et al., 2017</xref>; <xref ref-type="bibr" rid="B26">Lai et al., 2024</xref>). If the injury persists during the repair process, chronic repair may occur, leading to the loss of compensatory mechanisms and pathological organ fibrosis or scar formation (<xref ref-type="bibr" rid="B51">Wynn and Ramalingam, 2012</xref>). Mechanical pressure, bladder wall hypoxia, oxidative stress, inflammation, cellular metabolic disorders, and fibrosis contribute to the pathogenesis of pBOO. Although surgical decompression can relieve bladder wall pressure, a therapeutic agent capable of targeting different stages of pBOO is still required. Such an agent must not only possess anti-inflammatory and anti-fibrotic properties but also protect the bladder from oxidative stress damage caused by ischemia-reperfusion injury during the early stages of disease onset, which is a critical requirement.</p>
<p>Nuclear factor-erythroid 2-related factor 2 (Nrf2) is well-studied redox-induced transcription factor (<xref ref-type="bibr" rid="B48">Wardyn et al., 2015</xref>) that is normally sequestered in the cytoplasm through interaction with the actin-binding protein Keap 1. Exposure to ROS triggers the release of Nrf2 from Keap 1, allowing it to translocate into the nucleus and stimulate gene transcription (<xref ref-type="bibr" rid="B17">Hassanein et al., 2021</xref>). It primarily increases antioxidant enzymes such as superoxide dismutase (SOD), glutathione peroxidase (GPX), and heme oxygenase-1 (HO-1) (<xref ref-type="bibr" rid="B3">Behl et al., 2021</xref>), thereby protecting the body against oxidative stress. Nrf2 activation mitigates oxidative damage, inflammation, and cell death in the liver and kidneys (<xref ref-type="bibr" rid="B40">Sacks et al., 2018</xref>). Furthermore, recent evidence indicates that activating the Nrf2 signaling pathway can also improve mitochondrial dysfunction in the brains of aged mice (<xref ref-type="bibr" rid="B19">Hong et al., 2025</xref>). Previous studies have demonstrated that activation of the Nrf2 pathway can also effectively inhibit bladder tissue damage, particularly diabetic bladder dysfunction (<xref ref-type="bibr" rid="B45">Wang J. et al., 2021</xref>).</p>
<p>In a previous study, we synthesized IR-780, a novel near-infrared (NIR) lipophilic dye with seven methyl groups, which demonstrates excellent biocompatibility and minimal cellular contamination in the microenvironment. This fluorescent small-molecule dye exhibits tissue-damage-targeting properties, preferentially accumulates in mitochondria, and protects against various injuries by modulating oxidative stress. Its protective effects have been observed in models of acute lung injury and fibrosis, ischemia-reperfused brain microvascular endothelial cells, and cardiomyocytes (<xref ref-type="bibr" rid="B7">Chen et al., 2024</xref>; <xref ref-type="bibr" rid="B29">Luo et al., 2021</xref>; <xref ref-type="bibr" rid="B53">Zhang et al., 2023</xref>). Additionally, we found that IR-780 localized to the bladder urothelium following bladder instillation in a rat model of radiation cystitis. Concurrently, IR-780 ameliorated both acute urinary tract mucosal injury and late-stage bladder dysfunction induced by radiation cystitis (<xref ref-type="bibr" rid="B27">Li et al., 2023</xref>). These results suggest that IR-780 may be a potential imaging and therapeutic agent. However, whether IR-780 can protect bladder function after pBOO remains unclear. The present study investigates the effects of IR-780 on bladder function and pathological changes in rats with pBOO, as well as its potential mechanisms of action.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2-1">
<label>2.1</label>
<title>Animals</title>
<p>Female Sprague-Dawley rats were purchased from the animal facility of the Central Animal Breeding Service Center at Army Medical University (AMU, Third Military Medical University), Chongqing, China. All protocols and animal research procedures were approved by the Ethics Committee and conducted in accordance with the guidelines of the Animal Care and Use Committee of the Third Military Medical University. Rats were housed at room temperature under a 12-h light/dark cycle with free access to food and water.</p>
</sec>
<sec id="s2-2">
<label>2.2</label>
<title>Reagents and materials</title>
<p>The synthesized IR-780 powder was pre-dissolved in dimethyl sulfoxide (DMSO) to a concentration of 10&#xa0;mmol and stored at &#x2212;20&#xa0;&#xb0;C for later use. Prior to each administration, the solution was diluted 50-fold with sterile PBS and thoroughly mixed. All operations described above were performed in the dark.</p>
</sec>
<sec id="s2-3">
<label>2.3</label>
<title>Surgery</title>
<p>Anesthetize 8-week-old female Sprague-Dawley rats with isoflurane under surgical conditions and disinfect the suprapubic region. Lubricate and insert a sterile catheter with an outer diameter of approximately 1&#xa0;mm into the urethra. Make a 1&#xa0;cm incision in the midline of the lower abdomen with a surgical blade, bluntly dissect the muscle layer, expose the bladder neck and bladder, and ligate the bladder neck with 5&#x2013;0 silk suture. After tying the knot, the catheter was removed. Rats in the sham group underwent the same surgical procedure without ligation and served as the control group for comparison.</p>
</sec>
<sec id="s2-4">
<label>2.4</label>
<title>Treatments of rats</title>
<p>The experiment comprised two phases: model validation and formal experimentation. During model validation, rats were divided into two groups: sham (control group, n &#x3d; 6) and pBOO (surgical group, n &#x3d; 6). One week post-surgery, bladder inflammation, structure, and molecular characteristics were assessed to validate modeling success and determine optimal treatment timing. The formal experimental phase randomly assigned rats to four groups: sham (control group, n &#x3d; 8), sham &#x2b; IR-780 (control group &#x2b; IR-780, n &#x3d; 8), pBOO (surgical group, n &#x3d; 8), and pBOO &#x2b; IR-780 (surgical group &#x2b; IR-780, n &#x3d; 8). One week post-surgery, rats received intraperitoneal injections of IR-780 (0.667&#xa0;mg/kg) or an equivalent volume of PBS solution twice weekly for 3 weeks. This dosage was determined based on the results of our laboratory&#x2019;s previously published research (<xref ref-type="bibr" rid="B7">Chen et al., 2024</xref>). Four weeks after pBOO surgery, each group underwent urodynamic testing. Blood samples were collected from the retroorbital sinus to analyze renal function changes. Rats were then humanely euthanized, and their major organs were harvested for <italic>ex vivo</italic> imaging. Finally, bladder inflammation, structure, molecular biology, and histological features were assessed, along with pBOO-induced reflux nephropathy. The experimental workflow is illustrated in <xref ref-type="fig" rid="F1">Figure 1A</xref>. It is worth noting that the model validation phase and the formal experimental phase utilized two completely independent batches of animal samples. No animal was reused across experiments in different phases.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>pBOO modeling successfully validated. <bold>(A)</bold> Schematic diagram of the overall rat experimental protocol. <bold>(B)</bold> Left and middle: Rats: Gross images of the urinary tract 1 week after pBOO modeling. Right <bold>(A)</bold> Bladder (partial) of rats in the pBOO group. Right <bold>(B)</bold> Bladder (partial) of rats in the sham group. <bold>(C)</bold> Bladder mass and bladder mass/body weight ratio in sham-operated and pBOO-modeled rats 1&#xa0;week post-modeling. <bold>(D)</bold> Representative HE-stained and Masson trichrome-stained bladder tissue images from both groups. <bold>(E)</bold> mRNA expression levels of IL-1&#x3b2;, IL-6, and TNF-&#x3b1; in the bladder 1 week after pBOO modeling. Data indicate the mean &#xb1; SD (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001). Biw: Bis in week.</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g001.tif">
<alt-text content-type="machine-generated">Panel A shows a schematic of the experimental timeline and interventions in a mouse model, including IR-780 injection and timing for sample harvest. Panel B includes photographs comparing sham and pBOO mouse bladders, with gross anatomical differences and bladder tissue samples labeled a and b against a ruler for scale. Panel C presents bar graphs comparing bladder weight and bladder weight to body weight ratio between sham and pBOO groups, with significantly higher values in the pBOO group. Panel D displays histological images stained with HE and Masson&#x2019;s trichrome, comparing structural differences between sham and pBOO bladder tissues. Panel E shows bar graphs for mRNA expression of IL-1&#x3B2;, IL-6, and TNF-&#x3B1;, with significantly higher expression in the pBOO group compared to sham.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s2-5">
<label>2.5</label>
<title>
<italic>Ex Vivo</italic> and In vitro NIR imaging of IR-780</title>
<p>Rats were pretreated with IR-780 (0.667&#xa0;mg/kg, i.p.) or PBS 24&#xa0;h prior to near-infrared fluorescence imaging using the Kodak FX Professional Imaging System (New Haven, CT) to detect IR-780 distribution in organs.To examine the distribution of IR-780 in the bladder, bladder tissue was frozen and sectioned into 8&#xa0;&#x3bc;m slices. IR-780 fluorescence signals were detected using Leica LAS AF Lite software (Leica, Wetzlar, Germany).To determine the subcellular localization of IR-780 in BSMCs, primary BSMCs were isolated from normal SD rats and cultured using the adherent culture method. Immunofluorescence staining with anti-&#x3b1;-SMA antibody (1:200, MB9212S, Abmart) was performed to identify the isolated cells as bladder smooth muscle cells. Cultured BSMCs were then seeded in 35&#xa0;mm culture dishes and incubated with 20&#xa0;&#x3bc;M IR-780 for 20&#xa0;min, followed by incubation with 100&#xa0;nmol/L MitoTracker Green (C1048, Beyotime, China) for 30&#xa0;min. Cell nuclei were stained with Hoechst 33,342 (C1022, Beyotime, China) and imaged using a confocal microscope (Leica TCS SP5).</p>
</sec>
<sec id="s2-6">
<label>2.6</label>
<title>Cystometry In vivo</title>
<p>This study employed cystometry under anesthesia to evaluate urinary function in rats. Intraperitoneal injection of 1.2&#xa0;g/kg urethane was used to induce anesthesia and immobilize rats 4 weeks post-surgery. Throughout the bladder pressure measurement process, anesthesia depth was assessed periodically <italic>via</italic> toe pinch reflex testing. Appropriate anesthesia was defined as complete absence of pain withdrawal reflexes while maintaining stable baseline vital signs (e.g., spontaneous respiration, heart rate). Based on reflex monitoring results, urethane was micro-titrated according to a pre-established dosing protocol to maintain stable light anesthesia. A constant-temperature heating pad was used throughout the experiment to maintain stable body temperature.A midline abdominal incision was made to expose the bladder, and a PE-50 catheter was inserted into the apex of the bladder dome. The other end of the catheter was connected <italic>via</italic> a three-way connector.One end of the three-way connector was connected to a pressure transducer (Laborie Medical Technologies Inc., Beijing, China) to record bladder pressure, while the other end was connected to an infusion pump. Sterile room-temperature saline was slowly infused at a constant rate of 18&#xa0;mL/h. Pumping was immediately stopped upon observing urine in the external urethra and resumed once urination ceased. After the bladder pressure curve stabilized, it was automatically recorded by computer for 20&#xa0;min.Immediately after urination, stop the infusion, withdraw the residual fluid from the bladder, and measure its volume to determine the residual urine volume (RV). In addition to residual urine volume, test parameters include urinary frequency within 20&#xa0;min, maximum bladder capacity (MBC, volume of saline pumped prior to first voiding), maximum voiding pressure (MVP, peak pressure during the active voiding phase), voiding efficiency, and bladder compliance [BC, calculated as (MBC/TP - BP)]. Threshold pressure (TP) is defined as the intravesical pressure prior to voiding. Baseline pressure (BP) is defined as the minimum pressure between two voiding events.Measurements were taken on four rats per group. The average of three urination cycles per rat was used to eliminate any variation. This procedure was performed three times per rat.</p>
</sec>
<sec id="s2-7">
<label>2.7</label>
<title>Histological examinations</title>
<p>Each group of rats was euthanized after measuring bladder wet weight. Bladder and kidney tissues were collected and rapidly frozen in liquid nitrogen or immersed in 4% paraformaldehyde. Following fixation and dehydration in 4% paraformaldehyde, tissues were paraffin-embedded, sectioned into 5&#xa0;&#x3bc;m slices on slides, and subsequently subjected to H&#x26;E and Masson&#x2019;s trichrome staining.</p>
<p>For immunofluorescence analysis of tissue sections, paraffin sections are deparaffinized and rehydrated, then treated with 3% hydrogen peroxide at room temperature for approximately 10&#xa0;min to inactivate endogenous peroxidase activity.Then, place the sections in a container with antigen retrieval solution, heat in an autoclave until full pressure is reached for 3&#xa0;min, followed by blocking with 1% goat serum albumin at room temperature for 30&#xa0;min. Incubate overnight at 4&#xa0;&#xb0;C with anti-&#x3b1;-SMA (Abmart, 1:200), then incubate the sections with the corresponding secondary antibody at 37&#xa0;&#xb0;C for 1&#xa0;h. After washing, stain cell nuclei with DAPI (C1006, Beyotime, China). Stained bladder sections were examined under an optical microscope (Olympus Corporation, Tokyo, Japan), and images were captured using a digital camera mounted on the microscope. All images were analyzed using ImageJ software.</p>
</sec>
<sec id="s2-8">
<label>2.8</label>
<title>Quantitative real&#x2010;time PCR (RT&#x2010;PCR)</title>
<p>A small portion of bladder tissue from each group was excised for total RNA extraction using Trizol reagent, followed by reverse transcription with the RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Fisher). Real-time PCR (RT-PCR) was performed using SYBR Green qPCR Master Mix according to the manufacturer&#x2019;s protocol. Primers are listed in <xref ref-type="table" rid="T1">Table 1</xref> (<xref ref-type="sec" rid="s12">Supplementary Material</xref>). Data were normalized to &#x3b2;-actin as an internal control using the &#x394;CT method.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primers for quantitative RT-PCR.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Target</th>
<th align="left">Sequence (5&#x2032;-3&#x2032;)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">IL-1&#x3b2;</td>
<td align="left">Forward:GTGGAGCTTCCAGGATGAGG<break/>Reverse:CACACACTAGCAGGTCGTCA</td>
</tr>
<tr>
<td align="left">IL-6</td>
<td align="left">Forward:CACTTCACAAGTCGGAGGCT<break/>Reverse:TCTGACAGTGCATCATCGCT</td>
</tr>
<tr>
<td align="left">Tnfa</td>
<td align="left">Forward:CAGCAGATGGGCTGTACCTT<break/>Reverse:AAATGGCAAATCGGCTGACG</td>
</tr>
<tr>
<td align="left">Hif1&#x3b1;</td>
<td align="left">Forward:AAGTCAGCAACGTGGAAGGT<break/>Reverse:CGGCTGGTTACTGCTGGTAT</td>
</tr>
<tr>
<td align="left">IL-10</td>
<td align="left">Forward:GCTCAGCACTGCTATGTTGC<break/>Reverse:TTGTCACCCCGGATGGAATG</td>
</tr>
<tr>
<td align="left">TGF-&#x3b2;1</td>
<td align="left">Forward:GACTCTCCACCTGCAAGACC<break/>Reverse:GGACTGGCGAGCCTTAGTTT</td>
</tr>
<tr>
<td align="left">Col1a1</td>
<td align="left">Forward:GTACATCAGCCCAAACCCCA<break/>Reverse:CAGGATCGGAACCTTCGCTT</td>
</tr>
<tr>
<td align="left">Col3</td>
<td align="left">Forward:ATATGTGTCTGCGACTCGGG<break/>Reverse:GGGCAGTCTAGTGGCTCATC</td>
</tr>
<tr>
<td align="left">Gapdh</td>
<td align="left">Forward:GACATGCCGCCTGGAGAAAC<break/>Reverse:AGCCCAGGATGCCCTTTAGT</td>
</tr>
<tr>
<td align="left">Actb</td>
<td align="left">Forward:TGTCACCAACTGGGACGATA<break/>Reverse:GGGGTGTTGAAGGTCTCAAA</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Col1a1, collagen type I-a1; Col3, collagen type III; Hif1a, hypoxiainducible factor-1a; IL, interleukin; Tnfa, tumor necrosis factor-a; Actb, b-actin.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2-9">
<label>2.9</label>
<title>Western blotting</title>
<p>In brief, extract total protein from each group of bladder tissue/kidney tissue on ice using RIPA buffer containing a mixture of protease and phosphatase inhibitors for 30&#xa0;min. Depending on protein concentration, prepare samples using 5X loading buffer. Load an equal amount of protein from each sample onto a 4%&#x2013;12% Tris-glycine SDS-PAGE gel, run electrophoresis, and transfer to a PVDF membrane. Blot the membrane, incubate overnight at 4&#xa0;&#xb0;C with the designated primary antibody (1:1000 dilution), and incubate for 1&#xa0;h with HRP-conjugated secondary antibody (1:2000 dilution). Visualize and analyze band intensities using an enhanced chemiluminescence detection system (Bio-Rad Laboratories) and ImageJ software.</p>
</sec>
<sec id="s2-10">
<label>2.10</label>
<title>TUNEL staining for detecting apoptosis in bladder tissue</title>
<p>Following the instructions of the detection kit (C1090, Beyotime, China), after dewaxing the sections, add a drop of proteinase K working solution (20&#xa0;&#x3bc;g/L) onto the tissue sections and incubate for 20&#xa0;min. Then, add 50&#xa0;&#x3bc;L of TUNEL mix solution as directed (the negative control group was treated only with 50&#xa0;&#x3bc;L of fluorescein-labeled dUTP solution). Place the slides in a humid chamber and incubate at 37&#xa0;&#xb0;C in the dark for 1&#xa0;h. Finally, add DAPI-containing anti-fluorescence quenching mounting medium and mount the slides. Imaging of stained sections was performed using a fluorescence microscope.</p>
</sec>
<sec id="s2-11">
<label>2.11</label>
<title>
<italic>In situ</italic> detection of mitochondrial and superoxide levels</title>
<p>Fresh bladder tissue from each group was prepared into frozen sections and incubated briefly at 37&#xa0;&#xb0;C in the dark with Mito-Tracker Red, 2&#x2032;,7&#x2032;-dichlorodihydrofluorescein diacetate (DHE, 10&#xa0;&#x3bc;M, Beyotime) and MitoSOX&#x2122; Red (10&#xa0;&#x3bc;M, Invitrogen) for 30&#xa0;min at 37&#xa0;&#xb0;C in the dark. This measured the relative number of active mitochondria in BSMCs, the <italic>in situ</italic> levels of intracellular ROS, and mitochondrial superoxide levels, respectively. Fluorescence intensity was quantified using ImageJ software.</p>
</sec>
<sec id="s2-12">
<label>2.12</label>
<title>Transmission electron microscopy</title>
<p>Each group of fresh bladder smooth muscle tissue was trimmed into 1 &#xd7; 1 &#xd7; 3&#xa0;mm tissue blocks, fixed overnight in 4% glutaraldehyde, fixed with 1% osmium tetroxide, dehydrated in graded ethanol, and embedded in fresh 100% resin. Ultrathin sections cut from the blocks were stained with 3% uranium acetate in saturated alcohol and lead citrate for 8&#xa0;min each, then examined by transmission electron microscopy at 100&#xa0;kV. In all groups, bladder tissue samples for TEM analysis were uniformly obtained from the mid-layer smooth muscle region of the bladder body.</p>
</sec>
<sec id="s2-13">
<label>2.13</label>
<title>Statistical analysis</title>
<p>Each experiment was repeated at least three times. All statistical analyses were performed using SPSS software version 26.0 and GraphPad Prism software version 10.0. Pairwise comparisons were conducted using one-way or two-way analysis of variance (ANOVA) to determine statistical significance. P &#x3c; 0.05 was considered statistically significant.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<label>3</label>
<title>Results</title>
<sec id="s3-1">
<label>3.1</label>
<title>Successful validation of rat modeling</title>
<p>Seven days after surgery, rats in the pBOO group exhibited markedly distended and swollen bladders with slightly dilated ureters (<xref ref-type="fig" rid="F1">Figure 1B</xref>). Upon removal, the bladders in the pBOO groups showed increased weight compared to those in the control groups and displayed macroscopically evident inflammatory changes (<xref ref-type="fig" rid="F1">Figures 1B,C</xref>). Hematoxylin and eosin (HE) staining revealed thickened urothelium and increased inflammatory cell infiltration in the bladders of rats with pBOO. Masson&#x2019;s trichrome staining demonstrated a thickened muscularis propria without significant collagen deposition. The primary histological features at this stage were inflammation and detrusor muscle hypertrophy (<xref ref-type="fig" rid="F1">Figure 1D</xref>). We assessed the levels of proinflammatory cytokines in the bladder and found that pBOO group exhibited significantly elevated mRNA expression of IL-1&#x3b2;, IL-6, and TNF-&#x3b1; following obstruction (<xref ref-type="fig" rid="F1">Figure 1E</xref>). These results confirm that the pBOO model was successfully established and is suitable for subsequent drug intervention studies.</p>
</sec>
<sec id="s3-2">
<label>3.2</label>
<title>Biodistribution and accumulation of IR-780</title>
<p>We obtained key organs from the four rat groups for <italic>in vivo</italic> imaging. As expected, in the longitudinal comparison of organs within the same group, IR-780 demonstrated targeting properties in partially obstructed bladders. We observed significantly stronger NIR fluorescence in the bladder than in other organs such as the heart, liver, spleen, lungs, and intestines (<xref ref-type="fig" rid="F2">Figure 2A</xref>). In a cross-group comparison, the pBOO &#x2b; IR-780 group exhibited markedly higher NIR fluorescence in the bladder than the other three groups (<xref ref-type="fig" rid="F2">Figure 2B</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Biodistribution and Subcellular Localization of IR-780. <bold>(A)</bold> <italic>In vivo</italic> NIR imaging of major rat organs 24&#xa0;h prior to dissection, following 4 weeks of pBOO modeling <italic>via</italic> intraperitoneal injection of IR-780/PBS. <bold>(B)</bold> <italic>In vitro</italic> NIR imaging of bladder tissue from each group (uniform contrast). <bold>(C)</bold> Fluorescence imaging of IR-780 (red) in bladder tissue, scale bar 100&#xa0;&#x3bc;m. <bold>(D)</bold> Mitochondrial targeting of IR-780 in BSMCs determined by co-staining with IR-780 and Mito-Tracker Green. scale bar 75&#xa0;&#x3bc;m.</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g002.tif">
<alt-text content-type="machine-generated">Panel A displays fluorescence imaging of multiple organs in four experimental groups, with key organs color-coded and fluorescence mainly observed in bladders treated with IR-780. Panel B shows excised bladders from each group, with corresponding fluorescence images demonstrating IR-780 accumulation. Panel C presents microscopy images of tissue stained with DAPI and IR-780, showing merged localization. Panel D shows cellular localization of IR-780, Mito Tracker Green, and DAPI, merged to highlight colocalization at the cellular level. A fluorescence intensity scale is included on the right.</alt-text>
</graphic>
</fig>
<p>To determine the distribution of IR-780 within the bladder wall, histological analysis was performed on fresh-frozen bladder sections obtained 1&#xa0;day after the intraperitoneal injection of IR-780. Confocal microscopy revealed that IR-780 was primarily localized within the smooth muscle layer of the bladder (<xref ref-type="fig" rid="F2">Figure 2C</xref>). Therefore, this study focused on exploring the role of IR-780 in BSMCs.</p>
<p>To determine the subcellular localization of IR-780, we isolated and cultured primary BSMCs from 8-week-old Sprague-Dawley rats. The cells were identified by immunofluorescence staining for &#x3b1;-smooth muscle actin (&#x3b1;-SMA), a specific smooth muscle cell marker (<xref ref-type="sec" rid="s12">Supplementary Figure S1</xref>). As previously reported, co-localization of IR-780 with MitoTracker Green confirmed its targeted accumulation within BSMC mitochondria (<xref ref-type="fig" rid="F2">Figure 2D</xref>). Collectively, these findings demonstrate that IR-780 can serve as a target dye for pBOO bladders.</p>
</sec>
<sec id="s3-3">
<label>3.3</label>
<title>IR-780 improves bladder voiding function in pBOO</title>
<p>Four weeks postoperatively, bladder pressure was measured in the rats, and the pressure curves are shown in <xref ref-type="fig" rid="F3">Figure 3A</xref>. Analysis of the bladder pressure-time curves revealed that, compared with rats in the sham group, those in the pBOO group exhibited significantly increased MVP, MBC, RV, and voiding frequency (p &#x3c; 0.0001, p &#x3c; 0.001, p &#x3c; 0.0001, p &#x3c; 0.05), but decreased BC and VE (p &#x3c; 0.001, p &#x3c; 0.01), indicating typical pBOO decompensation. In contrast, the pBOO &#x2b; IR-780 group showed decreased MVP, voiding frequency and increased compliance (p &#x3c; 0.001, p &#x3c; 0.01, p &#x3c; 0.05 compared to pBOO group), and demonstrated certain improvements despite no significant differences in MBC, RV, or VE (<xref ref-type="fig" rid="F3">Figures 3B&#x2013;G</xref>). These data confirm that IR-780 administration exerts a protective effect by alleviating voiding-phase and storage-phase dysfunction in pBOO.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Administration of IR-780 improves bladder dysfunction in pBOO rats (n &#x3d; 4). <bold>(A)</bold> Representative intravesical pressure curves for rats in each group. <bold>(B)</bold> Maximum bladder capacity (MBC). <bold>(C)</bold> Maximum voiding pressure (MVP). <bold>(D)</bold> Residual volume (RV). <bold>(E)</bold> Frequency of urination in 20&#xa0;min. <bold>(F)</bold> Bladder compliance [BC; calculated as MBC/(TP-BP)]. <bold>(G)</bold> Voiding efficiency {VE, calculated as [(MBC&#x2212;RV)/MBC] &#xd7; 100%}. Data indicate the mean &#xb1; SD (ns: p &#x3e; 0.05, &#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001 vs. sham group; &#x23;p &#x3c; 0.05, &#x23;&#x23;p &#x3c; 0.01, &#x23;&#x23;&#x23;p &#x3c; 0.001 vs. pBOO group). Arrows indicate peak voiding.</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g003.tif">
<alt-text content-type="machine-generated">Panel A displays four line graphs comparing bladder pressure over 20 minutes for sham, sham with IR-780, pBOO, and pBOO with IR-780 groups; upward black arrows indicate peak events. Panels B to G present bar graphs measuring micturition and bladder function parameters (MBC, MVP, RV, urination frequency, BCI, VE) for the same four groups, illustrating significant increases in several metrics for the pBOO group, with some attenuation in the pBOO+IR-780 group as marked by asterisks and hash symbols denoting statistical differences.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<label>3.4</label>
<title>Effects of IR-780 on several key cytokines in pBOO rat bladder tissues</title>
<p>The mechanism of pBOO progression involves an ordered overlapping sequence from inflammation to fibrosis (<xref ref-type="bibr" rid="B20">Hughes et al., 2016</xref>). Multiple molecular mechanisms are involved. IL-6 and TNF-&#x3b1;, which are classic proinflammatory cytokines, mediate the activation and regulation of immune responses (<xref ref-type="bibr" rid="B18">He et al., 2021</xref>; <xref ref-type="bibr" rid="B15">Gheinani et al., 2017</xref>). The TGF-&#x3b2;1/Smad 3 pathway is closely associated with organ fibrosis (<xref ref-type="bibr" rid="B31">Meng et al., 2016</xref>), while the hypoxia-inducible factor-1&#x3b1;(HIF-1&#x3b1;) pathway represents an adaptive respond to hypoxic environments (<xref ref-type="bibr" rid="B44">Sun et al., 2023</xref>). Conversely, IL-10 suppresses proinflammatory responses and limits tissue damage caused by excessive inflammation (<xref ref-type="bibr" rid="B38">Ouyang et al., 2011</xref>).</p>
<p>We therefore examined the key molecules associated with pBOO to investigate the effects of IR-780 on several critical cytokines in the bladder tissues of rats with pBOO 4 weeks post-obstruction. In the pBOO group, both IL-1&#x3b2; and TNF-&#x3b1; expression in the bladder were significantly upregulated at the mRNA level (both p &#x3c; 0.05 compared to the sham group). Following IR-780 treatment, IL-1&#x3b2; and TNF-&#x3b1; expression levels reduced (both p &#x3c; 0.05 compared to the pBOO group) (<xref ref-type="fig" rid="F4">Figures 4A,C</xref>). The bladder fibrosis factors TGF-&#x3b2;1, Collagen type I &#x3b1;1 chain (Col1a1), and Collagen type III (Col3) were significantly increased in the pBOO group (p &#x3c; 0.05, p &#x3c; 0.05, p &#x3c; 0.001 compared to the sham group), and IR-780 reduced this expression (p &#x3c; 0.05, p &#x3c; 0.05, p &#x3c; 0.01 compared to the pBOO group) (<xref ref-type="fig" rid="F4">Figures 4F&#x2013;H</xref>). These findings indicate that IR-780 exhibits anti-inflammatory effects and mitigates progressive fibrosis in pBOO-induced bladders.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Expression of collagen and cytokines in rat bladders after 4 weeks (n &#x3d; 8). Quantitative RT-PCR was used to detect IL-1&#x3b2; <bold>(A)</bold>, IL-6 <bold>(B)</bold>, TNF-&#x3b1; <bold>(C)</bold>, hypoxia-inducible factor (HIF)-1&#x3b1; <bold>(D)</bold>, IL-10 <bold>(E)</bold>, transforming growth factor (TGF)-&#x3b2;1 <bold>(F)</bold>, collagen type I-&#x3b1;1 (Col1&#x3b1;1; <bold>(G)</bold>, and collagen type III (Col3; <bold>(H)</bold> groups. Data indicate the mean &#xb1; SD (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, vs. sham group; &#x23;p &#x3c; 0.05, &#x23;&#x23;p &#x3c; 0.01, vs. pBOO group). No statistical significance was found between unmarked groups.</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g004.tif">
<alt-text content-type="machine-generated">Eight bar charts labeled A through H show relative mRNA expression of IL-1&#x3B2;, IL-6, TNF-&#x3B1;, HIF-1&#x3B1;, IL-10, TGF-&#x3B2;, Col1a1, and Col3 across four groups: sham, sham+R-780, BOO, and BOO+R-780. Charts A, C, F, G, and H indicate statistically significant differences between groups, denoted by asterisks and hash marks, with BOO often having higher expression than other groups. Error bars and individual data points are displayed for each bar.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<label>3.5</label>
<title>IR-780 alleviates damage to bladder tissue structure caused by BOO</title>
<p>In the early stages of BOO, mechanical stress induces the upregulation of &#x3b1;-SMA expression to enhance detrusor contractility, representing compensatory remodeling. However, when obstruction persists long-term, bladder wall fibrosis progressively worsens. Massive smooth muscle cell apoptosis occurs and is replaced by collagen fibers, whereas myofibroblast activation and proliferation enter an exhausted phase, leading to a significant decline in &#x3b1;-SMA synthesis capacity. At this point, the reduced &#x3b1;-SMA levels indicate that the bladder has transitioned from the compensatory phase to the decompensatory phase (<xref ref-type="bibr" rid="B32">Metcalfe et al., 2010</xref>; <xref ref-type="bibr" rid="B41">Salinas et al., 2004</xref>; <xref ref-type="bibr" rid="B52">Yoshida and Yamaguchi, 2014</xref>). After 4 weeks, the bladders in the pBOO group exhibited marked congestion and swelling, with increased weight compared to those in the sham group. However, the bladders in the pBOO &#x2b; IR-780 group showed slightly reduced volume and weight relative to those in the pBOO group (<xref ref-type="fig" rid="F5">Figures 5A,B</xref>). Compared with the control group, the surgical group exhibited thickened urothelium and inflammatory cell infiltration and progressive changes in the muscularis propria. Muscle bundles gradually thickened, then underwent disruption and dissolution, with widening of the interstitial spaces and subsequent structural disorganization. After 3 weeks of IR-780 intervention, the degree of damage to the bladder tissues showed significant improvement (HE staining) (<xref ref-type="fig" rid="F5">Figure 5C</xref>). Masson&#x2019;s trichrome staining revealed significantly increased collagen fiber deposition in the pBOO group compared to that in the sham group (P &#x3c; 0.01). Although collagen deposition remained higher in the pBOO &#x2b; IR-780 group than that in the control group, it significantly reduced in the pBOO &#x2b; IR-780 group compared to the pBOO group. (P &#x3c; 0.01) (<xref ref-type="fig" rid="F5">Figures 5C,D</xref>). Additionally, we detected &#x3b1;-SMA expression in bladder tissues <italic>via</italic> Western blotting and immunofluorescence staining. Decreased &#x3b1;-SMA expression was observed in the pBOO group (vs.control group, p &#x3c; 0.05), whereas the pBOO &#x2b; IR-780 group showed increased &#x3b1;-SMA expression (vs.pBOO group, p &#x3c; 0.05) (<xref ref-type="fig" rid="F5">Figures 5E&#x2013;H</xref>). This confirms the earlier emphasis on BSMCs as the focus of this study and indicates that IR-780 can restore the reduced smooth muscle content induced by pBOO.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>IR-780 ameliorates pBOO-induced bladder histopathological changes. <bold>(A)</bold> Gross pathological images of rat bladders at 4&#xa0;weeks post-pBOO modeling. <bold>(B)</bold> Bladder weight and bladder weight/body weight ratio in rats from each group 4 weeks after pBOO modeling (&#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001). <bold>(C)</bold> Representative HE-stained and Masson trichrome-stained images of bladder tissue from each group, scale bar 100&#xa0;&#x3bc;m. <bold>(D)</bold> Quantitative analysis of collagen fiber levels in Masson staining. <bold>(E,F)</bold> Western blot detection of &#x3b1;-SMA levels in bladder tissue. <bold>(G,H)</bold> Immunofluorescence detection of &#x3b1;-SMA levels in bladder tissue. Data indicate the mean &#xb1; SD (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001 vs. sham group; &#x23;p &#x3c; 0.05, &#x23;&#x23;p &#x3c; 0.01 vs. pBOO group).</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g005.tif">
<alt-text content-type="machine-generated">Panel A shows excised bladders from four mouse groups adjacent to a ruler; panel B presents bar graphs for bladder weight and bladder weight-to-body weight ratio with statistical significance indicated; panel C includes histological HE and Masson stain images for each group; panel D displays a bar graph quantifying Masson staining; panel E shows western blots for &#x3B1;-SMA and GAPDH expression in all groups; panel F provides &#x3B1;-SMA quantification data in a bar graph; panel G presents immunofluorescence images for &#x3B1;-SMA (green) and DAPI (blue); panel H shows a bar graph for fluorescence quantification of &#x3B1;-SMA with statistical details.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-6">
<label>3.6</label>
<title>IR-780 ameliorates pBOO-induced kidney injury</title>
<p>BOO ultimately leads to severe complications such as vesicoureteral reflux, bladder dysfunction, bilateral renal damage, renal failure, bladder cancer, and bladder neck tumors (<xref ref-type="bibr" rid="B8">Cisek, 2017</xref>). Owing to the varying duration and progression of BOO lesions, many patients still develop progressive bladder dysfunction and renal impairment after surgery, which are difficult to treat (<xref ref-type="bibr" rid="B47">Wang et al., 2023</xref>). Therefore, we investigated the effects of IR-780 on pBOO-induced renal injury. Surprisingly, compared to sham rats without ureteral reflux, rats in the pBOO group exhibited markedly dilated ureters and renal pelvises, enlarged kidneys, and increased capsular tension, indicating the presence of vesicoureteral reflux. In contrast, the pBOO &#x2b; IR-780 group showed a milder presentation: although the ureters were dilated, both kidneys exhibited relatively normal coloration with no significant hydronephrosis or perinephric fluid accumulation (<xref ref-type="fig" rid="F6">Figure 6A</xref>). Serum was extracted from rats to measure serum creatinine (CREA), uric acid (UA), and urea levels. Compared to the sham group, the pBOO group exhibited significantly elevated CREA, UA, and UREA levels. However, IR-780-treated rats with pBOO exhibited reduced CREA, UA, and urea levels (p &#x3c; 0.0001, p &#x3c; 0.05, p &#x3c; 0.01, compared to the pBOO group) (<xref ref-type="fig" rid="F6">Figure 6B</xref>). HE and Masson staining revealed normal glomerular morphology without tubular dilatation in the sham group. The pBOO group exhibited glomerular deformation and atrophy, accompanied by tubular injury and marked glomerulosclerosis (<xref ref-type="fig" rid="F6">Figure 6C</xref>). The pBOO group demonstrated the highest expression of &#x3b1;-SMA and vimentin protein using Western blotting (p &#x3c; 0.01 and p &#x3c; 0.001 compared to the sham group). The pBOO &#x2b; IR-780 group &#x3b1;-SMA showed lower expression than the pBOO group but higher expression than the sham and sham &#x2b; IR-780 groups; the pBOO &#x2b; IR-780 group vimentin protein showed lower expression than the pBOO group (p &#x3c; 0.001, p &#x3c; 0.001 compared to the pBOO group), but higher expression than the sham and sham &#x2b; IR-780 groups (p &#x3c; 0.05 compared to the pBOO group) (<xref ref-type="fig" rid="F6">Figures 6D,E</xref>). Immunofluorescence staining validated these findings (<xref ref-type="fig" rid="F6">Figures 6F,G</xref>), suggesting that IR-780 may suppress pBOO-induced renal fibrosis. In summary, IR-780 treatment ameliorated pBOO-induced renal injury, potentially by reducing bladder injury or through direct protective effects on renal tissue.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>IR-780 treatment reduced PBOO-induced renal injury. <bold>(A)</bold> Gross anatomical images of the urinary tract in rats from each group at 4 weeks post-IR-780 or PBS treatment following sham/surgery. <bold>(B)</bold> Biochemical parameter analysis in rats across groups (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;p &#x3c; 0.0001). <bold>(C)</bold> Representative HE-stained and Masson trichrome-stained renal tissue images from each group. <bold>(D,E)</bold> Western blot detection of &#x3b1;-SMA and vimentin protein expression in bladder tissue. <bold>(F,G)</bold> Immunofluorescence detection of &#x3b1;-SMA levels in kindey tissue. Data indicate the mean &#xb1; SD (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, vs. sham group; &#x23;p &#x3c; 0.05, vs. pBOO group).</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g006.tif">
<alt-text content-type="machine-generated">Panel A shows four mouse kidney dissection images from different experimental groups. Panel B contains three bar graphs comparing CREA, UA, and UREA levels across groups, with significant differences indicated by asterisks. Panel C displays stained kidney tissue sections (HE and Masson) for each group, highlighting morphological changes. Panel D presents western blot bands for &#x3B1;-SMA, vimentin, and GAPDH. Panel E provides two comparative bar graphs quantifying western blot results. Panel F shows immunofluorescence images of kidney sections stained for &#x3B1;-SMA (green) and DAPI (blue) in each group. Panel G displays a bar graph quantifying fluorescence levels of &#x3B1;-SMA.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-7">
<label>3.7</label>
<title>IR-780 reduces the apoptosis of BSMCs</title>
<p>TUNEL staining revealed a significant increase in apoptotic cells within the bladder smooth muscle of the pBOO group compared with the sham and pBOO &#x2b; IR-780 groups (all P &#x3c; 0.05). However, apoptosis was markedly reduced in the pBOO &#x2b; IR-780 group (P &#x3c; 0.05 compared to the pBOO group) (<xref ref-type="fig" rid="F7">Figures 7A,B</xref>). Western blotting revealed that the protein levels of cleaved Caspase-3 were significantly elevated in the pBOO group compared to the sham group (P &#x3c; 0.01), whereas they were markedly reduced in the pBOO &#x2b; IR-780 group compared to the pBOO group (P &#x3c; 0.01) (<xref ref-type="fig" rid="F7">Figures 7C,D</xref>). These data indicate that IR-780 effectively ameliorates apoptosis in BSMCs from rats with pBOO. Based on the mitochondrial localization of IR-780 in BSMCs, we further examined proteins associated with the mitochondrial apoptotic pathway to investigate the relationship between IR-780 and apoptosis. Western blot analysis revealed that Bcl-2-associated X, Cytochrome C, and cleaved Caspase-9 significantly increased (p &#x3c; 0.05, p &#x3c; 0.01, p &#x3c; 0.01 compared to the sham group), whereas Bcl-2 protein expression decreased (p &#x3c; 0.01 compared to the sham group). However, IR-780 treatment blocked these changes (<xref ref-type="fig" rid="F7">Figures 7E&#x2013;I</xref>). Collectively, these data indicate that IR-780 inhibits mitochondrial-related apoptosis in the bladder tissues of rats with pBOO.</p>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption>
<p>IR-780 reduced the number of apoptotic BSMCs in pBOO and affected mitochondrial apoptosis-related proteins. <bold>(A)</bold> Representative images of TUNEL staining (red) in bladders from each group. <bold>(B)</bold> Number of apoptotic BSMCs per high-power field. <bold>(C,D)</bold> Western blot detection of apoptotic protein cleaved-caspase three levels. <bold>(E&#x2013;I)</bold> Western blot detection and quantitative analysis of Bcl-2, Bcl-2-associated X, Cytochrome C, and cleaved-caspase 9 protein expression levels in each group. Data indicate the mean &#xb1; SD (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, vs. sham group; &#x23;p &#x3c; 0.05, &#x23;&#x23;p &#x3c; 0.01, vs. pBOO group).</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g007.tif">
<alt-text content-type="machine-generated">Panel A shows TUNEL-stained tissue sections from four groups: sham, sham plus IR-780, pBOO, and pBOO plus IR-780. Panel B is a bar graph quantifying apoptotic cell numbers across groups. Panel C displays western blot bands for cleaved-caspase 3 and GAPDH, with panel D showing the corresponding bar graph for relative cleaved-caspase 3 expression. Panel E shows western blot bands for Bcl-2, BAX, cytochrome C, cleaved-caspase 9, and GAPDH. Panels F, G, H, and I present bar graphs of relative protein expression for Bcl-2, BAX, cytochrome C, and cleaved-caspase 9, respectively, across the four groups. Statistical significance is indicated in the graphs.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-8">
<label>3.8</label>
<title>IR-780 alleviates mitochondrial damage and ROS production in rats with pBOO</title>
<p>Frozen sections of bladder tissues from rats in each group were stained with DHE and MitoSOX to measure the cellular and mitochondrial superoxide levels. Quantitative analysis of DHE and MitoSOX staining revealed significantly elevated levels of cellular and mitochondrial superoxides in the pBOO group (P &#x3c; 0.05 and P &#x3c; 0.001 compared to the sham group), whereas IR-780 treatment suppressed the elevation in cellular and mitochondrial superoxide levels (P &#x3c; 0.05 and P &#x3c; 0.01 compared to the pBOO group) (<xref ref-type="fig" rid="F8">Figures 8A,B,D,F</xref>). This demonstrates that IR-780 possesses certain antioxidant effects. Fluorescent staining with MitoTracker Red was used to assess mitochondrial damage in bladder tissues of each rat group. The results showed that the number of viable mitochondria in the bladder tissues of the pBOO group significantly reduced (P &#x3c; 0.001 compared to the sham group), whereas the number of mitochondria increased after IR-780 treatment (P &#x3c; 0.05 relative to the pBOO group) (<xref ref-type="fig" rid="F8">Figures 8C,F</xref>). Transmission electron microscopy images revealed changes in mitochondrial structure and morphology. Cells in the sham group exhibited a higher number of mitochondria with normal morphology, showing a well-organized arrangement and a clear structure. In contrast, cells in the pBOO group demonstrated a reduced mitochondrial quantity with significantly diminished, fractured, and even dissolved cristae. Numerous mitochondria exhibited calcification and swelling, accompanied by decreased electron density in the mitochondrial matrix and vacuolar degeneration. Compared to the surgery group, the pBOO &#x2b; IR-780 group exhibited a significant increase in mitochondrial quantity and cristae number, with the morphology approaching normal (<xref ref-type="fig" rid="F8">Figure 8G</xref>). These findings indicate that IR-780 exerts a protective effect on mitochondria within BSMCs.</p>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption>
<p>IR-780 mitigates pBOO-induced oxidative stress and mitochondrial damage in BSMCs. <bold>(A,D)</bold> Intracellular ROS in the bladder detected by DHE staining of frozen bladder sections and quantified by fluorescence intensity analysis, scale bar 50&#xa0;&#x3bc;m. <bold>(B,E)</bold> Quantitative analysis of mitochondrial ROS in the bladder detected by MitoSOX staining of frozen bladder sections, with fluorescence intensity, scale bar 50&#xa0;&#x3bc;m. <bold>(C,F)</bold> Quantitative analysis of mitochondrial mass in BSMCs measured by Mito-Tracker Red staining of frozen bladder tissue sections, with fluorescence intensity, scale bar 50&#xa0;&#x3bc;m. <bold>(G)</bold> Representative transmission electron micrographs of mitochondrial morphology and structure in BSMCs. Red arrows indicate mitochondria. Data indicate the mean &#xb1; SD (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, &#x2a;&#x2a;&#x2a;p &#x3c; 0.001, vs. sham group; &#x23;p &#x3c; 0.05, &#x23;&#x23;p &#x3c; 0.01, vs. pBOO group).</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g008.tif">
<alt-text content-type="machine-generated">Panel A, B, and C present fluorescence microscopy images of tissue sections stained with DHE, MitoSOX, and Mito-Tracker Red, respectively, across four groups: sham, sham plus IR-780, pBOO, and pBOO plus IR-780. Panels D, E, and F display bar graphs quantifying relative fluorescence intensities for DHE, MitoSOX, and Mito-Tracker Red, respectively. Panel G shows transmission electron microscopy images of cellular ultrastructure from the same four groups, marked with red arrows.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-9">
<label>3.9</label>
<title>IR-780 participates in the Nrf2 pathway activation</title>
<p>Based on the above results, we further investigated whether the antioxidant effects of IR-780 were mediated by Nrf2 activation. Western blotting analysis of representative proteins in four bladder groups revealed that compared to the sham group, the pBOO group exhibited decreased levels of HO-1, GPX1, and SOD1 (p &#x3c; 0.05, p &#x3c; 0.01 and p &#x3c; 0.05) (<xref ref-type="fig" rid="F9">Figures 9A,B,D&#x2013;F</xref>), and increased Keap1 levels (p &#x3c; 0.05) (<xref ref-type="fig" rid="F9">Figures 9A,C</xref>). However, IR-780 treatment upregulated pBOO-induced Nrf2 protein expression (vs. pBOO group p &#x3c; 0.05) while downregulating Keap1 (p &#x3c; 0.01), reversing the decrease in the antioxidant proteins HO-1, GPX1, and SOD1 (p &#x3c; 0.01, p &#x3c; 0.05, and p &#x3c; 0.05). These results suggest that the protective effect of IR-780 may be related to Nrf2 activation (<xref ref-type="fig" rid="F10">Figure 10</xref>).</p>
<fig id="F9" position="float">
<label>FIGURE 9</label>
<caption>
<p>IR-780 activates Nrf2 and increases antioxidant-related protein levels. <bold>(A&#x2013;F)</bold> Western blot analysis and quantitative analysis of Nrf-2, Keap-1, HO-1, GPX-1, and SOD-1 in bladder tissues from each group. Data indicate the mean &#xb1; SD (&#x2a;p &#x3c; 0.05, &#x2a;&#x2a;p &#x3c; 0.01, vs. sham group; &#x23;p &#x3c; 0.05, &#x23;&#x23;p &#x3c; 0.01, vs. pBOO group).</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g009.tif">
<alt-text content-type="machine-generated">Western blot results (panel A) display protein expression of Nrf-2, Keap-1, HO-1, GPX-1, SOD-1, and GAPDH in four experimental groups: sham, sham plus IR-780, pBOO, and pBOO plus IR-780. Panels B through F present bar graphs of the quantification for each protein, with statistical significance indicated by asterisks or pound signs, showing increased or decreased expression levels among groups.</alt-text>
</graphic>
</fig>
<fig id="F10" position="float">
<label>FIGURE 10</label>
<caption>
<p>A simple diagram of the drug&#x2019;s mechanism of action.</p>
</caption>
<graphic xlink:href="fphar-17-1778496-g010.tif">
<alt-text content-type="machine-generated">Diagram illustrating molecular pathways in BSMC cells: IR-780 targets mitochondria, influencing keap1 and Nrf2, which activates anti-oxidation genes GPX-1, HO-1, and SOD1 through the nuclear ARE pathway to counter oxidative stress from free radicals.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<label>4</label>
<title>Discussion</title>
<p>Bladder dysfunction caused by BOO is becoming an increasing concern among clinicians (<xref ref-type="bibr" rid="B16">Gravas et al., 2018</xref>). By 2018, approximately 1.1 billion people worldwide had experienced LUTS due to benign prostatic hyperplasia, with Asian populations potentially being the most severely affected (<xref ref-type="bibr" rid="B23">Irwin et al., 2011</xref>). However, there is no sufficiently effective clinical treatment for pBOO, as most current therapies are designed solely to alleviate symptoms rather than delay or reverse the progressive fibrotic damage associated with the condition (<xref ref-type="bibr" rid="B26">Lai et al., 2024</xref>). Therefore, there is an urgent need to develop effective drugs to maintain normal bladder function and prevent or slow the progression of pBOO. Owing to BOO, localized pressure increases within the bladder wall caused by traction, which activates the ischemia-reperfusion mechanism (oxidative stress). Oxidative stress damage is considered one of the core mechanisms underlying the pathogenesis and progression of pBOO (<xref ref-type="bibr" rid="B33">Miyata et al., 2019</xref>). In previous studies, we demonstrated that IR-780 exhibits targeted localization to mitochondria and possesses antioxidant properties in cell therapy. In this study, we investigated whether IR-780 could mitigate the progression of bladder dysfunction and its related complications in rats with pBOO.</p>
<p>Rats with BOO may develop bladder dysfunction 4&#xa0;weeks post-surgery, characterized by symptoms of detrusor overactivity&#x2014;such as increased urinary frequency, shortened voiding intervals, and reduced urinary output&#x2014;along with elevated oxidative stress, bladder smooth muscle fibrosis, and hypertrophy (<xref ref-type="bibr" rid="B39">Ozturk et al., 2020</xref>). Therefore, we selected the 4-week mark as the experimental endpoint. To distinguish between the therapeutic and preventive effects of the drug, we initiated treatment 1 week post-surgery and validated the model using rats at the same time point. Through gross dissection, histopathological staining, and detection of inflammatory factor mRNA, we successfully established the pBOO rat model, providing the foundation for subsequent studies.</p>
<p>Before evaluating the efficacy of IR-780 in improving pBOO, we first assessed its distribution across various organs, within different layers of the bladder wall and at the subcellular level. IR-780 exhibited the highest fluorescence intensity in damaged bladder tissues and accumulated in the smooth muscle layer of the bladder wall, with minimal involvement in other layers. Therefore, BSMCs are the primary focus of the present study. Bladder function was altered following BOO. Detrusor smooth muscle hypertrophy compensates for the increased muscle contractility required to overcome increased urethral resistance during urination (<xref ref-type="bibr" rid="B14">Fusco et al., 2018</xref>). Using primary cell isolation techniques, we extracted BSMCs and simultaneously observed the accumulation of IR-780 within BSMC mitochondria, which is consistent with the results of previous studies. Mitochondria serve as the primary endogenous sources of ROS within cells. The energy from the electrons interacts with water to form superoxide radicals, which are then converted by SOD into peroxides and ultimately generate ROS. In other words, mitochondria are the principal generators of ROS (<xref ref-type="bibr" rid="B10">Del Re et al., 2019</xref>). The mechanism of oxidative damage induced by pBOO aligns with the target site of IR-780, leading us to speculate whether this mitochondria-targeted small-molecule drug could be used to treat such diseases. Our preliminary research demonstrates that IR-780 or its derivatives accumulate in damaged bladders and treat urinary dysfunction and complications through their antioxidant and anti-apoptotic effects (<xref ref-type="bibr" rid="B45">Wang J. et al., 2021</xref>; <xref ref-type="bibr" rid="B27">Li et al., 2023</xref>), suggesting that IR-780 may be a potential therapeutic agent for pBOO.</p>
<p>Functional assessments of rats with pBOO revealed significant increases in MVP, MBC, RV, and voiding frequency in rats with pBOO, accompanied by decreases in BC and VE. These findings indicate impaired bladder function and progression to the decompensation phase of pBOO. Conversely, the pBOO &#x2b; IR-780 group exhibited reduced MVP and voiding frequency with enhanced compliance, demonstrating that IR-780 intervention improved urinary function in rats. At the molecular level, RT-PCR analysis of key factors involved in pBOO progression revealed significantly upregulated mRNA expression of inflammatory mediators IL-1&#x3b2; and TNF-&#x3b1;, alongside increased expression of fibrotic factors TGF-&#x3b2;1, Col1a1, and Col3. IR-780 treatment reduced this expression pattern. Therefore, we conducted further investigations into inflammatory and fibrotic damage. At the histological level, pathological staining and Western blot experiments revealed that IR-780 improved fibrosis in rat bladder smooth muscles. These results demonstrate that IR-780 ameliorates bladder dysfunction and fibrotic progression induced by pBOO. Furthermore, we observed that IR-780 treatment enhanced resistance to apoptosis in bladder smooth muscle tissue. This aligns with the reduced smooth muscle content and decompensation observed in the bladder walls of rats with pBOO, in which apoptosis was associated with mitochondrial dysfunction.</p>
<p>Notably, this study unexpectedly found that IR-780 ameliorates pBOO-induced renal injury, manifested by reduced CREA, UA, and UREA levels, along with lessened renal histopathological damage. Based on the core findings of this study and relevant literature reports, we hypothesize that its renal protective effects may be mediated through a dual &#x201c;direct-indirect&#x201d; pathway. On one hand, as a key discovery of this study, IR-780 significantly alleviates pBOO-induced oxidative stress and inflammatory infiltration in the bladder wall, thereby improving bladder outlet obstruction. Once bladder outlet obstruction is relieved, the mechanical pressure load on the upstream kidneys from the lower urinary tract is significantly reduced, alleviating renal interstitial congestion, edema, and tubular injury. This represents the indirect pathway through which IR-780 exerts renal protection and constitutes a clearly identifiable potential regulatory mechanism in this study. On the other hand, we cannot exclude the direct protective effects of IR-780 on renal tissue: IR-780 can be distributed throughout the body <italic>via</italic> the blood circulation to various tissues and organs. Previous studies have confirmed that in organ injury models such as the lungs and heart, it exerts antioxidant and anti-inflammatory protective effects by directly scavenging reactive oxygen species, inhibiting the expression of inflammatory factors (such as TNF-&#x3b1; and IL-6), and reducing apoptosis (<xref ref-type="bibr" rid="B7">Chen et al., 2024</xref>; <xref ref-type="bibr" rid="B29">Luo et al., 2021</xref>). Based on this, it is speculated that IR-780 may directly act on renal tissue in a similar manner to mitigate pBOO-induced renal parenchymal injury. Future research will focus on this scientific question, further validating IR-780s direct regulatory effects on renal tissue. This will clarify whether it functions by modulating kidney-specific oxidative stress and inflammation-related signaling pathways (such as the Nrf2/HO-1 and NF-&#x3ba;B pathways), thereby fully elucidating the molecular mechanisms underlying IR-780s renal protective effects.</p>
<p>Prolonged and chronic cyclic ischemia/reperfusion generates ROS. Elevated ROS levels induce oxidative stress in the bladder and play a significant role in bladder dysfunction through alterations in cellular and molecular characteristics, including vascular and nerve density, as well as fibrosis induction (<xref ref-type="bibr" rid="B25">Kalorin et al., 2008</xref>; <xref ref-type="bibr" rid="B37">Nomiya et al., 2012</xref>). ROS and pBOO are associated with bladder dysfunction, as they directly damage detrusor muscle mitochondria, thereby inhibiting energy production and impairing detrusor contractility (<xref ref-type="bibr" rid="B1">Baird and Yamamoto, 2020</xref>). Bratslavsky et al. demonstrated that in rat models, ROS-mediated reperfusion events inflicted greater damage than isolated ischemic events (<xref ref-type="bibr" rid="B4">Bratslavsky et al., 2003</xref>). Based on this evidence, ROS are considered the primary pathogenic factor responsible for bladder dysfunction caused by pBOO (<xref ref-type="bibr" rid="B33">Miyata et al., 2019</xref>). Therefore, we focused our research on mitochondria and oxidative stress. In this study, we found that the levels of total intracellular and cell-derived ROS in the bladder tissues of rats with pBOO were significantly higher than those in control rats, and these levels were maintained after IR-780 treatment. Furthermore, MitoTracker Red fluorescence detection and transmission electron microscopy revealed markedly reduced mitochondrial number and activity, along with mitochondrial structural disruption, in BSMCs of rats with pBOO. These data indicate that bladder tissue damage in rats with pBOO may result from persistent oxidative stress, and IR-780 ameliorated these changes.</p>
<p>Nrf2/Keap1 is the most important transcriptional mechanism regulating antioxidant genes and maintaining cellular redox homeostasis (<xref ref-type="bibr" rid="B35">Motohashi and Yamamoto, 2004</xref>). The Nrf2 pathway improves bladder dysfunction in cyclophosphamide-induced cystitis by suppressing oxidative stress (<xref ref-type="bibr" rid="B36">Ni et al., 2021</xref>). Liu et al. used sulforaphane to activate the Nrf2&#x2013;antioxidant response element (Nrf2&#x2013;ARE) pathway and improve bladder dysfunction in a rat model of pBOO (<xref ref-type="bibr" rid="B28">Liu et al., 2016</xref>). In the present study, our data indicate that IR-780 intervention upregulated Nrf2 protein expression. In the pBOO &#x2b; IR-780 group, the expression of antioxidant proteins HO-1, GPX1, and SOD1 also significantly increased; this upregulation can mitigate or counteract oxidative stress-induced damage to BSMCs and their mitochondria. In summary, IR-780 reduces oxidative stress levels in bladder smooth muscle tissue by activating the intracellular Nrf2/Keap-1 signaling pathway and promoting the expression of a series of endogenous antioxidant proteins. This may represent a potential mechanism underlying its protective effects against oxidative stress damage in BSMCs and their mitochondria, as well as the improvement of urinary function in rat with pBOO.</p>
<p>This study has certain limitations: First, there is no standard definition for the time point at which pBOO progresses from the compensatory phase to the decompensatory phase. Through preliminary experiments, we found that rats exhibited urodynamic changes indicative of the decompensatory phase at 4 weeks post-surgery. Therefore, we set 4 weeks post-surgery as the endpoint for this study. Second, this study employed only a surgically induced rat pBOO model. While this model serves as a classic tool for elucidating the pathophysiological mechanisms of pBOO, it simulates only the single causative factor of mechanical obstruction. This contrasts with the complexity of human female urinary tract anatomy and pBOO etiology (e.g., urethral stricture, pelvic organ prolapse, detrusor -urethral sphincter dyssynergia). Third, this study lacks validation using human cells and clinical samples. It did not conduct <italic>in vitro</italic> intervention experiments with human bladder smooth muscle cells or renal tubular epithelial cells, nor did it incorporate tissue specimens or serum samples from clinical pBOO patients for correlation analysis.Additionally, it has been reported that IR-780 can induce mitochondrial ROS by directly inhibiting the functional &#x3b1;-subunit of succinate dehydrogenase (SDH, mitochondrial complex II) and the activity of SDH2 (<xref ref-type="bibr" rid="B46">Wang Z. et al., 2021</xref>); however, this was not addressed and requires further verification in subsequent studies. The direct mechanism by which IR-780 ameliorates pBOO-related renal injury has not yet been experimentally verified, representing a key area requiring further investigation in this study.</p>
<p>In summary, This study confirms that IR-780 exhibits mitochondrial targeting properties in bladder smooth muscle cells. By activating the Nrf2/Keap1 pathway, it initiates the cell&#x2019;s endogenous antioxidant defense system and promotes the expression of antioxidant proteins. This mechanism protects BSMCs and their mitochondria, ultimately improving urinary dysfunction and related complications in rats with pBOO. These findings suggest its potential as a targeted therapy for bladder dysfunction in pBOO. From a clinical translation perspective, determining the optimal administration timing is a critical prerequisite for guiding precise clinical dosing. Subsequent studies will specifically design multi-time-window dosing comparison experiments. By integrating multidimensional indicators such as urodynamic testing, histopathological scoring, and molecular biomarker detection, these studies will systematically evaluate the efficacy differences across varying administration timings. This approach aims to identify the optimal time window for IR-780 intervention in pBOO, providing more precise reference guidelines for its clinical application.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="sec" rid="s12">Supplementary Material</xref>, further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>The animal study was approved by Chongqing Western Biomedical Technology Co., Ltd. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>FP: Data curation, Visualization, Validation, Formal Analysis, Writing &#x2013; original draft, Conceptualization, Writing &#x2013; review and editing, Methodology. BY: Validation, Writing &#x2013; review and editing. MJ: Writing &#x2013; review and editing. YL: Validation, Writing &#x2013; review and editing. ST: Validation, Writing &#x2013; review and editing. ZH: Validation, Writing &#x2013; review and editing. QF: Writing &#x2013; review and editing, Conceptualization. CS: Writing &#x2013; review and editing, Supervision, Funding acquisition. WL: Funding acquisition, Supervision, Writing &#x2013; review and editing.</p>
</sec>
<ack>
<title>Acknowledgements</title>
<p>I would like to express my sincere gratitude to Director WL and his team for their invaluable support in experiments and funding. My thanks also go to Director Chunmeng Shi for providing the research platform. Additionally, I am grateful to Taylor &#x26; Francis for offering manuscript polishing services.</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec sec-type="supplementary-material" id="s12">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fphar.2026.1778496/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fphar.2026.1778496/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Image1.tif" id="SM1" mimetype="application/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table1.doc" id="SM2" mimetype="application/doc" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baird</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The molecular mechanisms regulating the KEAP1-NRF2 pathway</article-title>. <source>Mol. Cell. Biol.</source> <volume>40</volume>, <fpage>e00099</fpage>&#x2013;<lpage>e00200</lpage>. <pub-id pub-id-type="doi">10.1128/MCB.00099-20</pub-id>
<pub-id pub-id-type="pmid">32284348</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barbosa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Reis</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Nunes</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>Y. A.</given-names>
</name>
<name>
<surname>Leite</surname>
<given-names>K. R.</given-names>
</name>
<name>
<surname>Nahas</surname>
<given-names>W. C.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>The obstructed bladder: expression of collagen, matrix metalloproteinases, muscarinic receptors, and angiogenic and neurotrophic factors in patients with benign prostatic hyperplasia</article-title>. <source>Urology</source> <volume>106</volume>, <fpage>167</fpage>&#x2013;<lpage>172</lpage>. <pub-id pub-id-type="doi">10.1016/j.urology.2017.05.010</pub-id>
<pub-id pub-id-type="pmid">28506859</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Behl</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kaur</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Sehgal</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Sharma</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Grover</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Unfolding Nrf2 in diabetes mellitus</article-title>. <source>Mol. Biology Reports</source> <volume>48</volume> (<issue>1</issue>), <fpage>927</fpage>&#x2013;<lpage>939</lpage>. <pub-id pub-id-type="doi">10.1007/s11033-020-06081-3</pub-id>
<pub-id pub-id-type="pmid">33389540</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bratslavsky</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Kogan</surname>
<given-names>B. A.</given-names>
</name>
<name>
<surname>Matsumoto</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Aslan</surname>
<given-names>A. R.</given-names>
</name>
<name>
<surname>Levin</surname>
<given-names>R. M.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Reperfusion injury of the rat bladder is worse than ischemia</article-title>. <source>J. Urology</source> <volume>170</volume> (<issue>5</issue>), <fpage>2086</fpage>&#x2013;<lpage>2090</lpage>. <pub-id pub-id-type="doi">10.1097/01.ju.0000092144.48045.13</pub-id>
<pub-id pub-id-type="pmid">14532859</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>T. Q.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K. J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Simulated bladder pressure stimulates human bladder smooth muscle cell proliferation <italic>via</italic> the PI3K/SGK1 signaling pathway</article-title>. <source>J. Urology</source> <volume>188</volume> (<issue>2</issue>), <fpage>661</fpage>&#x2013;<lpage>667</lpage>. <pub-id pub-id-type="doi">10.1016/j.juro.2012.03.112</pub-id>
<pub-id pub-id-type="pmid">22704443</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Lv</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Metformin ameliorates bladder dysfunction in a rat model of partial bladder outlet obstruction</article-title>. <source>Am. Journal Physiology Ren. Physiology</source> <volume>320</volume> (<issue>5</issue>), <fpage>F838</fpage>&#x2013;<lpage>f858</lpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00625.2020</pub-id>
<pub-id pub-id-type="pmid">33645317</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Pharmaceutical manipulation of mitochondrial F0F1-ATP synthase enables imaging and protection of myocardial ischemia/reperfusion injury through stress-induced selective enrichment</article-title>. <source>Adv. Science Weinheim, Baden-Wurttemberg, Ger.</source> <volume>11</volume> (<issue>9</issue>), <fpage>e2307880</fpage>. <pub-id pub-id-type="doi">10.1002/advs.202307880</pub-id>
<pub-id pub-id-type="pmid">38093654</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cisek</surname>
<given-names>L. J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Holding water: congenital anomalies of the kidney and urinary tract, CKD, and the ongoing role of excellence in plumbing</article-title>. <source>Adv. Chronic Kidney Disease</source> <volume>24</volume> (<issue>6</issue>), <fpage>357</fpage>&#x2013;<lpage>363</lpage>. <pub-id pub-id-type="doi">10.1053/j.ackd.2017.09.012</pub-id>
<pub-id pub-id-type="pmid">29229166</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clout</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lewis</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Cochrane</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>G. J.</given-names>
</name>
<name>
<surname>Abrams</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Blair</surname>
<given-names>P. S.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Urodynamics tests for the diagnosis and management of Male bladder outlet obstruction: long-term follow-up of the UPSTREAM non-inferiority RCT</article-title>. <source>Health Technol. Assess.</source> <volume>29</volume> (<issue>26</issue>), <fpage>1</fpage>&#x2013;<lpage>57</lpage>. <pub-id pub-id-type="doi">10.3310/SLPT4675</pub-id>
<pub-id pub-id-type="pmid">40619891</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Del Re</surname>
<given-names>D. P.</given-names>
</name>
<name>
<surname>Amgalan</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Linkermann</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Kitsis</surname>
<given-names>R. N.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Fundamental mechanisms of regulated cell death and implications for heart disease</article-title>. <source>Physiol. Reviews</source> <volume>99</volume> (<issue>4</issue>), <fpage>1765</fpage>&#x2013;<lpage>1817</lpage>. <pub-id pub-id-type="doi">10.1152/physrev.00022.2018</pub-id>
<pub-id pub-id-type="pmid">31364924</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Drzewiecki</surname>
<given-names>B. A.</given-names>
</name>
<name>
<surname>Anumanthan</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Penn</surname>
<given-names>H. A.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Thomas</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Adams</surname>
<given-names>M. C.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Modulation of the hypoxic response following partial bladder outlet obstruction</article-title>. <source>J. Urology</source> <volume>188</volume> (<issue>4 Suppl. l</issue>), <fpage>1549</fpage>&#x2013;<lpage>1554</lpage>. <pub-id pub-id-type="doi">10.1016/j.juro.2012.02.037</pub-id>
<pub-id pub-id-type="pmid">22910264</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dunton</surname>
<given-names>C. L.</given-names>
</name>
<name>
<surname>Purves</surname>
<given-names>J. T.</given-names>
</name>
<name>
<surname>Hughes</surname>
<given-names>F. M.</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Jin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nagatomi</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Elevated hydrostatic pressure stimulates ATP release which mediates activation of the NLRP3 inflammasome <italic>via</italic> P2X(4) in rat urothelial cells</article-title>. <source>Int. Urology Nephrology</source> <volume>50</volume> (<issue>9</issue>), <fpage>1607</fpage>&#x2013;<lpage>1617</lpage>. <pub-id pub-id-type="doi">10.1007/s11255-018-1948-0</pub-id>
<pub-id pub-id-type="pmid">30099658</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eming</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Wynn</surname>
<given-names>T. A.</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Inflammation and metabolism in tissue repair and regeneration</article-title>. <source>Sci. (New York, NY)</source> <volume>356</volume> (<issue>6342</issue>), <fpage>1026</fpage>&#x2013;<lpage>1030</lpage>. <pub-id pub-id-type="doi">10.1126/science.aam7928</pub-id>
<pub-id pub-id-type="pmid">28596335</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fusco</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Creta</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>De Nunzio</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Iacovelli</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Mangiapia</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Li Marzi</surname>
<given-names>V.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Progressive bladder remodeling due to bladder outlet obstruction: a systematic review of morphological and molecular evidences in humans</article-title>. <source>BMC Urology</source> <volume>18</volume> (<issue>1</issue>), <fpage>15</fpage>. <pub-id pub-id-type="doi">10.1186/s12894-018-0329-4</pub-id>
<pub-id pub-id-type="pmid">29519236</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gheinani</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Kiss</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Moltzahn</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Keller</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Bruggmann</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Rehrauer</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Characterization of miRNA-regulated networks, hubs of signaling, and biomarkers in obstruction-induced bladder dysfunction</article-title>. <source>JCI Insight</source> <volume>2</volume> (<issue>2</issue>), <fpage>e89560</fpage>. <pub-id pub-id-type="doi">10.1172/jci.insight.89560</pub-id>
<pub-id pub-id-type="pmid">28138557</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gravas</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kyriazis</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Klausner</surname>
<given-names>A. P.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Lower urinary tract symptoms including bladder outlet obstruction: what&#x27;s new in diagnostics?</article-title> <source>Eur. Urology Focus</source> <volume>4</volume> (<issue>1</issue>), <fpage>14</fpage>&#x2013;<lpage>16</lpage>. <pub-id pub-id-type="doi">10.1016/j.euf.2018.04.004</pub-id>
<pub-id pub-id-type="pmid">29665998</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hassanein</surname>
<given-names>E. H. M.</given-names>
</name>
<name>
<surname>Ahmed</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Sayed</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Rashwan</surname>
<given-names>E. K.</given-names>
</name>
<name>
<surname>Abd El-Ghafar</surname>
<given-names>O. A. M.</given-names>
</name>
<name>
<surname>Mahmoud</surname>
<given-names>A. M.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Edaravone mitigates hemorrhagic cystitis by modulating Nrf2, TLR-4/NF-&#x3ba;B, and JAK1/STAT3 signaling in cyclophosphamide-intoxicated rats</article-title>. <source>J. Biochemical Molecular Toxicology</source> <volume>35</volume> (<issue>11</issue>), <fpage>e22889</fpage>. <pub-id pub-id-type="doi">10.1002/jbt.22889</pub-id>
<pub-id pub-id-type="pmid">34390071</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Ai</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>The role of interleukin-6/interleukin-6 receptor signaling in the mechanical stress-induced extracellular matrix remodeling of bladder smooth muscle</article-title>. <source>Arch. Biochem. Biophys.</source> <volume>702</volume>, <fpage>108674</fpage>. <pub-id pub-id-type="doi">10.1016/j.abb.2020.108674</pub-id>
<pub-id pub-id-type="pmid">33189652</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hong</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Unsaponifiable matter from walnut oil ameliorate memory deficits and mitochondrial dysfunction in aging mice <italic>via</italic> activating Nrf2 signaling pathway</article-title>. <source>Food Sci. Hum. Wellness</source> <volume>14</volume> (<issue>3</issue>), <fpage>9250093</fpage>. <pub-id pub-id-type="doi">10.26599/fshw.2024.9250093</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hughes</surname>
<given-names>F. M.</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Hill</surname>
<given-names>H. M.</given-names>
</name>
<name>
<surname>Wood</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Edmondson</surname>
<given-names>A. T.</given-names>
</name>
<name>
<surname>Dumas</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Foo</surname>
<given-names>W. C.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>The NLRP3 inflammasome mediates inflammation produced by bladder outlet obstruction</article-title>. <source>J. Urology</source> <volume>195</volume> (<issue>5</issue>), <fpage>1598</fpage>&#x2013;<lpage>1605</lpage>. <pub-id pub-id-type="doi">10.1016/j.juro.2015.12.068</pub-id>
<pub-id pub-id-type="pmid">26707508</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hughes</surname>
<given-names>F. M.</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Sexton</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Govada</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Purves</surname>
<given-names>J. T.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Bladder fibrosis during outlet obstruction is triggered through the NLRP3 inflammasome and the production of IL-1&#x3b2;</article-title>. <source>Am. Journal Physiology Ren. Physiology</source> <volume>313</volume> (<issue>3</issue>), <fpage>F603</fpage>&#x2013;<lpage>f610</lpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00128.2017</pub-id>
<pub-id pub-id-type="pmid">28592436</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hughes</surname>
<given-names>F. M.</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Sexton</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Ledig</surname>
<given-names>P. D.</given-names>
</name>
<name>
<surname>Yun</surname>
<given-names>C. E.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Purves</surname>
<given-names>J. T.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Bladder decompensation and reduction in nerve density in a rat model of chronic bladder outlet obstruction are attenuated with the NLRP3 inhibitor glyburide</article-title>. <source>Am. Journal Physiology Ren. Physiology</source> <volume>316</volume> (<issue>1</issue>), <fpage>F113</fpage>&#x2013;<lpage>f120</lpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00400.2018</pub-id>
<pub-id pub-id-type="pmid">30353742</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Irwin</surname>
<given-names>D. E.</given-names>
</name>
<name>
<surname>Kopp</surname>
<given-names>Z. S.</given-names>
</name>
<name>
<surname>Agatep</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Milsom</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Abrams</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Worldwide prevalence estimates of lower urinary tract symptoms, overactive bladder, urinary incontinence and bladder outlet obstruction</article-title>. <source>BJU International</source> <volume>108</volume> (<issue>7</issue>), <fpage>1132</fpage>&#x2013;<lpage>1138</lpage>. <pub-id pub-id-type="doi">10.1111/j.1464-410X.2010.09993.x</pub-id>
<pub-id pub-id-type="pmid">21231991</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Jhang</surname>
<given-names>J. F.</given-names>
</name>
<name>
<surname>Hsu</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>H. C.</given-names>
</name>
<name>
<surname>Kuo</surname>
<given-names>H. C.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Potential urine biomarkers in bladder outlet obstruction-related detrusor underactivity</article-title>. <source>Tzu Chi Med. J.</source> <volume>34</volume> (<issue>4</issue>), <fpage>388</fpage>&#x2013;<lpage>393</lpage>. <pub-id pub-id-type="doi">10.4103/tcmj.tcmj_298_20</pub-id>
<pub-id pub-id-type="pmid">36578642</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kalorin</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Mannikarottu</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Neumann</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Leggett</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Weisbrot</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2008</year>). <article-title>Protein oxidation as a novel biomarker of bladder decompensation</article-title>. <source>BJU International</source> <volume>102</volume> (<issue>4</issue>), <fpage>495</fpage>&#x2013;<lpage>499</lpage>. <pub-id pub-id-type="doi">10.1111/j.1464-410X.2008.07567.x</pub-id>
<pub-id pub-id-type="pmid">18341622</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lai</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>&#x3b2;-Adrenoceptor signaling activation improves bladder fibrosis by inhibiting extracellular matrix deposition of bladder outlet obstruction</article-title>. <source>Front. Biosci. Landmark Ed.</source> <volume>29</volume> (<issue>9</issue>), <fpage>336</fpage>. <pub-id pub-id-type="doi">10.31083/j.fbl2909336</pub-id>
<pub-id pub-id-type="pmid">39344310</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yue</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Intravesical IR-780 instillation prevents radiation cystitis by protecting urothelial integrity</article-title>. <source>Neurourol. Urodynamics</source> <volume>42</volume> (<issue>1</issue>), <fpage>40</fpage>&#x2013;<lpage>48</lpage>. <pub-id pub-id-type="doi">10.1002/nau.25056</pub-id>
<pub-id pub-id-type="pmid">36208109</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Sulforaphane ameliorates bladder dysfunction through activation of the Nrf2-ARE pathway in a rat model of partial bladder outlet obstruction</article-title>. <source>Oxidative Medicine Cellular Longevity</source> <volume>2016</volume>, <fpage>7598294</fpage>. <pub-id pub-id-type="doi">10.1155/2016/7598294</pub-id>
<pub-id pub-id-type="pmid">27433291</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Mitigation of radiation-induced pulmonary fibrosis by small-molecule dye IR-780</article-title>. <source>Free Radical Biology &#x26; Medicine</source> <volume>164</volume>, <fpage>417</fpage>&#x2013;<lpage>428</lpage>. <pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2020.12.435</pub-id>
<pub-id pub-id-type="pmid">33418112</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meier</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Padmanabhan</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Female bladder outlet obstruction: an update on diagnosis and management</article-title>. <source>Curr. Opin. Urol.</source> <volume>26</volume>, <fpage>334</fpage>&#x2013;<lpage>341</lpage>. <pub-id pub-id-type="doi">10.1097/MOU.0000000000000303</pub-id>
<pub-id pub-id-type="pmid">27214578</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meng</surname>
<given-names>X. M.</given-names>
</name>
<name>
<surname>Nikolic-Paterson</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>H. Y.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>TGF-&#x3b2;: the master regulator of fibrosis</article-title>. <source>Nat. Reviews Nephrol.</source> <volume>12</volume> (<issue>6</issue>), <fpage>325</fpage>&#x2013;<lpage>338</lpage>. <pub-id pub-id-type="doi">10.1038/nrneph.2016.48</pub-id>
<pub-id pub-id-type="pmid">27108839</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Metcalfe</surname>
<given-names>P. D.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jiao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Hori</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Moore</surname>
<given-names>R. B.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Bladder outlet obstruction: progression from inflammation to fibrosis</article-title>. <source>BJU International</source> <volume>106</volume> (<issue>11</issue>), <fpage>1686</fpage>&#x2013;<lpage>1694</lpage>. <pub-id pub-id-type="doi">10.1111/j.1464-410X.2010.09445.x</pub-id>
<pub-id pub-id-type="pmid">20590549</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miyata</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Matsuo</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Mitsunari</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Asai</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ohba</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sakai</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>A review of oxidative stress and urinary dysfunction caused by bladder outlet obstruction and treatments using antioxidants</article-title>. <source>Antioxidants Basel, Switz.</source> <volume>8</volume> (<issue>5</issue>). <pub-id pub-id-type="doi">10.3390/antiox8050132</pub-id>
<pub-id pub-id-type="pmid">31096597</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miyazaki</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Katsura</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Hamada</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Suzutani</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Blueberry prevents the bladder dysfunction in bladder outlet obstruction rats by attenuating oxidative stress and suppressing bladder remodeling</article-title>. <source>Nutrients</source> <volume>12</volume> (<issue>5</issue>). <pub-id pub-id-type="doi">10.3390/nu12051285</pub-id>
<pub-id pub-id-type="pmid">32369959</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Motohashi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Nrf2-Keap1 defines a physiologically important stress response mechanism</article-title>. <source>Trends Molecular Medicine</source> <volume>10</volume> (<issue>11</issue>), <fpage>549</fpage>&#x2013;<lpage>557</lpage>. <pub-id pub-id-type="doi">10.1016/j.molmed.2004.09.003</pub-id>
<pub-id pub-id-type="pmid">15519281</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ni</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Shu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tamrat</surname>
<given-names>N. E.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Nrf2 pathway ameliorates bladder dysfunction in cyclophosphamide-induced cystitis <italic>via</italic> suppression of oxidative stress</article-title>. <source>Oxidative Medicine Cellular Longevity</source> <volume>2021</volume>, <fpage>4009308</fpage>. <pub-id pub-id-type="doi">10.1155/2021/4009308</pub-id>
<pub-id pub-id-type="pmid">34306306</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nomiya</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sagawa</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Yazaki</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Takahashi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Kushida</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Haga</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Increased bladder activity is associated with elevated oxidative stress markers and proinflammatory cytokines in a rat model of atherosclerosis-induced chronic bladder ischemia</article-title>. <source>Neurourol. Urodynamics</source> <volume>31</volume> (<issue>1</issue>), <fpage>185</fpage>&#x2013;<lpage>189</lpage>. <pub-id pub-id-type="doi">10.1002/nau.21191</pub-id>
<pub-id pub-id-type="pmid">21953769</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ouyang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Rutz</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Crellin</surname>
<given-names>N. K.</given-names>
</name>
<name>
<surname>Valdez</surname>
<given-names>P. A.</given-names>
</name>
<name>
<surname>Hymowitz</surname>
<given-names>S. G.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Regulation and functions of the IL-10 family of cytokines in inflammation and disease</article-title>. <source>Annu. Review Immunology</source> <volume>29</volume>, <fpage>71</fpage>&#x2013;<lpage>109</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-immunol-031210-101312</pub-id>
<pub-id pub-id-type="pmid">21166540</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ozturk</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Cetinkaya</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Duzcu</surname>
<given-names>S. E.</given-names>
</name>
<name>
<surname>Yis</surname>
<given-names>O. M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Expression of NGF, MCP-1, uroplakin III, and NOS in bladder urothelium after partial urethral obstruction in rats</article-title>. <source>J. Pediatric Urology</source> <volume>16</volume> (<issue>6</issue>), <fpage>806.e801</fpage>&#x2013;<lpage>806.e814</lpage>. <pub-id pub-id-type="doi">10.1016/j.jpurol.2020.09.013</pub-id>
<pub-id pub-id-type="pmid">32994092</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sacks</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Baxter</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Campbell</surname>
<given-names>B. C. V.</given-names>
</name>
<name>
<surname>Carpenter</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Cognard</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Dippel</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Multisociety consensus quality improvement revised consensus statement for endovascular therapy of acute ischemic stroke</article-title>. <source>Int. Journal Stroke Official Journal Int. Stroke Soc.</source> <volume>13</volume> (<issue>6</issue>), <fpage>612</fpage>&#x2013;<lpage>632</lpage>. <pub-id pub-id-type="doi">10.1177/1747493018778713</pub-id>
<pub-id pub-id-type="pmid">29786478</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salinas</surname>
<given-names>C. J.</given-names>
</name>
<name>
<surname>Virseda Chamorro</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Mart&#xed;n Vega</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Hern&#xe1;ndez Lao</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Herrero Payo</surname>
<given-names>J. A.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Experimental study of the expression of the bladder wall proteins in bladder outlet obstruction in the rabbit</article-title>. <source>Actas Urologicas Espanolas</source> <volume>28</volume> (<issue>5</issue>), <fpage>341</fpage>&#x2013;<lpage>349</lpage>. <pub-id pub-id-type="doi">10.1016/s0210-4806(04)73088-0</pub-id>
<pub-id pub-id-type="pmid">15264676</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Solomon</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Yasmin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Duffy</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rashid</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Akinluyi</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Greenwell</surname>
<given-names>T. J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Developing and validating a new nomogram for diagnosing bladder outlet obstruction in women</article-title>. <source>Neurourol. Urodynamics</source> <volume>37</volume> (<issue>1</issue>), <fpage>368</fpage>&#x2013;<lpage>378</lpage>. <pub-id pub-id-type="doi">10.1002/nau.23307</pub-id>
<pub-id pub-id-type="pmid">28666055</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stephany</surname>
<given-names>H. A.</given-names>
</name>
<name>
<surname>Strand</surname>
<given-names>D. W.</given-names>
</name>
<name>
<surname>Ching</surname>
<given-names>C. B.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Milne</surname>
<given-names>G. L.</given-names>
</name>
<name>
<surname>Cajaiba</surname>
<given-names>M. M.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Chronic cyclic bladder over distention up-regulates hypoxia dependent pathways</article-title>. <source>J. Urology</source> <volume>190</volume> (<issue>4 Suppl. l</issue>), <fpage>1603</fpage>&#x2013;<lpage>1609</lpage>. <pub-id pub-id-type="doi">10.1016/j.juro.2013.02.026</pub-id>
<pub-id pub-id-type="pmid">23429070</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Berberine inhibits breast carcinoma proliferation and metastasis under hypoxic microenvironment involving gut microbiota and endogenous metabolites</article-title>. <source>Pharmacol. Research</source> <volume>193</volume>, <fpage>106817</fpage>. <pub-id pub-id-type="doi">10.1016/j.phrs.2023.106817</pub-id>
<pub-id pub-id-type="pmid">37315824</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Yue</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Long</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2021a</year>). <article-title>IR-61 improves voiding function <italic>via</italic> mitochondrial protection in diabetic rats</article-title>. <source>Front. Pharmacology</source> <volume>12</volume>, <fpage>608637</fpage>. <pub-id pub-id-type="doi">10.3389/fphar.2021.608637</pub-id>
<pub-id pub-id-type="pmid">33935703</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2021b</year>). <article-title>Pharmaceutical targeting of succinate dehydrogenase in fibroblasts controls bleomycin-induced lung fibrosis</article-title>. <source>Redox Biol.</source> <volume>46</volume>, <fpage>102082</fpage>. <pub-id pub-id-type="doi">10.1016/j.redox.2021.102082</pub-id>
<pub-id pub-id-type="pmid">34343908</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>HucMSC exosomes attenuate partial bladder outlet obstruction-induced renal injury and cell proliferation <italic>via</italic> the Wnt/&#x3b2;-catenin pathway</article-title>. <source>Eur. Journal Pharmacology</source> <volume>952</volume>, <fpage>175523</fpage>. <pub-id pub-id-type="doi">10.1016/j.ejphar.2023.175523</pub-id>
<pub-id pub-id-type="pmid">36736526</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wardyn</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Ponsford</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Sanderson</surname>
<given-names>C. M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Dissecting molecular cross-talk between Nrf2 and NF-&#x3ba;B response pathways</article-title>. <source>Biochem. Soc. Transactions</source> <volume>43</volume> (<issue>4</issue>), <fpage>621</fpage>&#x2013;<lpage>626</lpage>. <pub-id pub-id-type="doi">10.1042/BST20150014</pub-id>
<pub-id pub-id-type="pmid">26551702</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wazir</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>D. Y.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yue</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K. J.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>The purinergic component of human bladder smooth muscle cells&#x27; proliferation and contraction under physiological stretch</article-title>. <source>Biochem. Biophysical Research Communications</source> <volume>437</volume> (<issue>2</issue>), <fpage>256</fpage>&#x2013;<lpage>260</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2013.06.059</pub-id>
<pub-id pub-id-type="pmid">23811273</pub-id>
</mixed-citation>
</ref>
<ref id="B50">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>C. J.</given-names>
</name>
<name>
<surname>Hsiao</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>P. C.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>T. C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Sheu</surname>
<given-names>B. C.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Prevalence and predictors of detrusor underactivity and bladder outlet obstruction in women with lower urinary tract symptoms</article-title>. <source>Sci. Rep.</source> <volume>14</volume> (<issue>1</issue>), <fpage>25141</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-024-76242-y</pub-id>
<pub-id pub-id-type="pmid">39448651</pub-id>
</mixed-citation>
</ref>
<ref id="B51">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wynn</surname>
<given-names>T. A.</given-names>
</name>
<name>
<surname>Ramalingam</surname>
<given-names>T. R.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Mechanisms of fibrosis: therapeutic translation for fibrotic disease</article-title>. <source>Nat. Medicine</source> <volume>18</volume> (<issue>7</issue>), <fpage>1028</fpage>&#x2013;<lpage>1040</lpage>. <pub-id pub-id-type="doi">10.1038/nm.2807</pub-id>
<pub-id pub-id-type="pmid">22772564</pub-id>
</mixed-citation>
</ref>
<ref id="B52">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yoshida</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yamaguchi</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Detrusor underactivity: the current concept of the pathophysiology</article-title>. <source>Low. Urin Tract. Symptoms</source> <volume>6</volume> (<issue>3</issue>), <fpage>131</fpage>&#x2013;<lpage>137</lpage>. <pub-id pub-id-type="doi">10.1111/luts.12070</pub-id>
<pub-id pub-id-type="pmid">26663593</pub-id>
</mixed-citation>
</ref>
<ref id="B53">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Mitochondrial-targeting fluorescent small molecule IR-780 alleviates radiation-induced brain injury</article-title>. <source>Brain Research</source> <volume>1805</volume>, <fpage>148285</fpage>. <pub-id pub-id-type="doi">10.1016/j.brainres.2023.148285</pub-id>
<pub-id pub-id-type="pmid">36801209</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/798305/overview">Krishna M Boini</ext-link>, University of Houston, United States</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1585794/overview">Wenlong Sun</ext-link>, Shandong University of Technology, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2378951/overview">Naciye Yaktubay D&#xf6;nda&#x15f;</ext-link>, Faculty of Medicine, Cukurova University, T&#xfc;rkiye</p>
</fn>
</fn-group>
</back>
</article>