Archived and deidentified lung tissue samples were obtained from the First Affiliated Hospital of Xinxiang Medical University Pathology Tissue Service and were surgical remnants of biopsies or lungs explanted from patients with IPF who underwent pulmonary transplantation. This study was performed according to the principles of the Declaration of Helsinki principles. The study was approved by the ethical committee of the First Affiliated Hospital of Xinxiang Medical University and informed consent was obtained before tissue acquisition when indicated.

All animal care and experiments were conducted in compliance with the requirements of the National Act on the Use of Experimental Animals (China) and were approved by the Institutional Animal Care and Ethics Committee of Xinxiang Medical University (No. EC-022-129). Male 9- to 12-week-old C57BL/6 mice were purchased from the Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were anesthetized with 1% isoflurane and then intratracheally administered 1.5 U/kg BLM (Macklin, Shanghai, China) in 50 μl of sterile saline. Control mice were administered the same volume of sterile saline. To test the therapeutic efficacy of wogonin in BLM-induced established fibrosis, wogonin was intraperitoneally administered at 50 mg/kg/2-day for 2 weeks and the mice were sacrificed on day 21. Equivalent volumes of saline were used as controls in all experiments.

Lung hydroxyproline content was detected using a hydroxyproline colorimetric assay kit from Nanjing Jiancheng Co., Ltd. (Nanjing, China), according to the manufacturer’s instructions, as previously described (Song et al., 2022). Data are expressed as µg of hydroxyproline in the right lung.

The mice were humanely euthanized and tissue samples were rapidly harvested and washed in PBS to remove blood, fixed in 4% paraformaldehyde immediately, dehydrated, embedded in paraffin wax and sectioned (4 μm) for further use. Collagen deposition was stained using Masson’s trichrome kit according to the manufacturer’s instructions (G1346, Solarbio, Beijing, China). Immunostaining for α-SMA (1:200), CDK9 (1:200), p21 (1:200) and p-p53 (1:200) was performed after paraffin removal, rehydration and blocking, following the recommendations of the manufacturer and a protocol previously described (Liu et al., 2020). Sections diluted in PBS were incubated with the primary antibody overnight at 4°C, washed 5 times with PBS. and then incubated with a secondary antibody (Jackson, 1:500) for 1 h at room temperature. The sections were counterstained with hematoxylin. The primary antibody was replaced with a non-immune serum as a negative control. The expression levels of α-SMA, CDK9, p21 and p-p53 were immune-stained with the respective antibodies, and the fractional areas were quantified using Image J software.

The lung epithelial A549 and Mel-12 cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA, United States). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% (v/v) fetal bovine serum (FBS) and penicillin–streptomycin at final concentrations of 100 U/mL and 100 μg/mL, respectively. Cells were cultured at 37°C in a humidified atmosphere containing 5% CO₂. The cells were incubated with BLM (15 mU/ml) to stimulate cell fibrotic differentiation as previously described (Yu et al., 2018), or incubated with H₂O₂ (200 µM ) to stimulate oxidative stress-induced senescence as previously described (Mao et al., 2010). The cells were seeded in 6-well plates at a density of 2 × 105 cells/well. After 70% confluence, cells were incubated with BLM medium which contain 10% FBS for 4 h. For rescue experiments, A549 cells were cultured with wogonin at a concentration of 20 µM, or treated with AZD4573 at a concentration of 1 µM which selectively inhibits CDK9 (S8719, Selleck) (Wang et al., 2019; Ohno et al., 2022) to specifically establish the contribution of the CDK9/p53/p21 pathway. All experiments involving A549 cells were performed on cells from independent batches in triplicates or quadruplicates.

Lentiviruses expressing a shRNA targeting CDK9 (Gene ID: 1025), which a short hairpin sequence targeting against CDK9 (shCDK9) was GGGAGAUCAAGAUCCUUCATT, or a scramble control (shNC): TTCTCCGAACGTGTCACGT, were generated by Shanghai GeneChem Co., Ltd. (Shanghai, China). A549 cells were cultured for 48 h following infection and selected using puromycin (2 μg/mL). Western blot analysis was used to detect the effective knockdown of CDK9.

RNA was isolated from cells treated with or without wogonin using TRIzol reagent (Life Technologies). Amplifications were performed in optical-grade 96-well plates using an Applied Biosystems QuantStudio DX machine with Fast SYBR Green Master Mix (Yeasen, Shanghai, China). The normalized fold expressions of the tested gene relative to the β-actin control were calculated based on the 2−ΔΔCt method. Oligonucleotide primers were (forward and reverse):

β-actin: AGGCCAACCGTGAAAAGATG-3′; AGAGCATAGCCCTCGTAGATGG,

α-SMA: GTGAAGAAGAGGACAGCACTG; CCCATTCCCACCATCACC,

fibronectin: TCCACAAGCGTCATGAAGAG; CTCTGAATCCTGGCATTGGT.

Total tissues or cell lysates were obtained in RIPA Lysis Buffer (P0013C, Beyotime, Beijing, China) containing phosphatase inhibitor cocktail A (P108, 1 Beyotime, Beijing, China) and protease inhibitor, PMSF at 1 mM (ST506, Beyotime, Beijing, China). To quantify phosphorylated proteins, cells were washed with PBS, and lysis buffer was immediately added to protect the phosphorylation sites. Equal amounts of lysates or protein extracts were loaded onto sodium dodecyl sulfate-polyacrylamide gels, and then transferred to polyvinylidene fluoride (PVDF) membranes. After blocking with 5% no-fat milk in TBST (150 mM NaCl, 20 mM Tris, 0.05% Tween-20) at room temperature for 1-1.5 h, then the PVDF membranes were incubated with primary antibodies at 4°C overnight, followed by incubation with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies. Protein bands were visualized using an enhanced chemiluminescence detection system on Amersham Imager 600 (GE Healthcare). Antibodies used were: CDK9 (Abcam, 76320); phospho-p53 (Abcam, 33889); fibronectin (Abcam, 2413); γ-H2AX (Abcam, 81299); α-SMA (Abcam, 11003); p21(Abcam, 109199); pRB (Proteintech, 10494-1-AP); Secondary antibodies used were: goat anti-rabbit-HRP (Jackson, 111-005-045), goat anti-mouse-HRP (Jackson, 111-005-062). Densitometric analysis was performed using Image J software (NIH, United States).

The lung sections or cells in 24-well plates were permeabilized with 0.25% TritonX-100 in PBS for 10 min. After blocking with 5% BSA for 1 h at room temperature, sections were incubated with CDK9 antibody (Abcam, 76320), fibronectin (Abcam, 2413) or γ-H2AX (Abcam, 81299) overnight at 4°C. After washing 5 times with PBS, cells were incubated with Alexa Fluor secondary antibodies (A0423, Beyotime, Beijing, China) (1:300 dilution) for 1 h at room temperature in the dark. Cell nuclei were counterstained with DAPI. Fluorescent images were obtained using a Zeiss fluorescence microscope.

Senescent cells were evaluated with an SA-β-galactosidase staining kit (Beyotime, Beijing, China), according to the manufacturer’s instructions. The cells were cultured in 6-well plates, with or without BLM, in triplicates. After senescence induction using BLM and wogonin treatment respectively, the cells were fixed and stained with complete β-gal Stain Solution at 37°C overnight. A549 or Mel-12 cells were visualized under a bright-field microscope at ×10 or ×20 magnification, respectively. SA-β-gal-positive cells were quantified in 4 randomly selected fields per individual sample and using ImageJ software for quantification.

All data in this study were presented as mean ± SEM. Comparisons of groups were performed using Student’s unpaired t-test or one or two-way ANOVA, as appropriate. A post-hoc Tukey’s test was performed to isolate differences. p-values < 0.05 were considered statistically significant. GraphPad Prism 9.0 statistical software was used for all the data analyses involved in this study.

Firstly, to investigate the effects of wogonin on PF in vivo, a well-established mouse model of PF was utilized which mice were administrated with BLM at a concentration of 1.5 U/kg via the oropharyngeal route to induce PF (Yu et al., 2018). Wogonin was given i.p. at the concentration of 50 mg/kg/2-day for 2 weeks starting on the day 8 after BLM treatment. Equivalent volume of saline was used for the control mice (Figure 1A). Lung hydroxyproline as a surrogate of collagen deposition (Song et al., 2022), was significantly decreased in wogonin-treated group compared with the BLM group (Figure 1B). Collagen deposition was examined with Masson’s trichrome staining and demonstrated that the wogonin group had a significant lower lung fibrosis deposition compared to those in the BLM group (Figures 1C,D). Furthermore, immunohistochemical analysis showed the reduced expression of alpha smooth muscle actin (α-SMA) in mice treated with wogonin (Figures 1E,F). These results indicate that wogonin could efficiently protect against BLM-induced PF in mice.

Before detecting the effect of wogonin on fibrosis at cellular level in vitro, we examined whether wogonin was toxic to lung epithelial A549 cells. The results of CCK8 assay demonstrated that wogonin at the concentrations of 1–20 μM had no significant effects on cell viability (Figure 2A). Therefore, the further experiments of wogonin were conducted at the concentration of 20 μM. Next, to investigate the effect of wogonin on BLM-induced fibrotic markers in vitro, A549 cells were cultured and stimulated with 15 mU/mL BLM at 37°C for 4 hs (Yu et al., 2018). The BLM-medium was then replaced with wogonin for 24 h. Western blot analysis showed that treatment of BLM resulted in significant increases in the protein levels of two fibrotic markers: fibronectin (Fib) and α-SMA, the effect was markedly attenuated by wogonin (Figures 2B–D). RT-qPCR similarly revealed that wogonin treatment inhibited the expression of fibronectin and α-SMA compared with BLM groups, indicating the capacity of wogonin to inhibit the fibrotic phenotype of epithelial cells in vitro (Figures 2E,F).

It has been reported that the activation of cellular senescence signalling promotes lung fibrosis formation in mice (Kuwano et al., 1996; Liu and Liu, 2020). Thus, we next explored whether the senescence pathway was involved in PF and whether wogonin could suppress it. SA-β-gal activity, a widely used marker of senescent cells, was markedly increased in BLM-stimulated A549 cells in vitro (Debacq-Chainiaux et al., 2009). Importantly, BLM-induced activation of SA-β-gal was significantly diminished by wogonin treatment (positive area %; 26.7 ± 1.3 vs. 17.7 ± 0.8) (Figures 3A,B). Western blot analysis demonstrated that BLM increased p53 phosphorylation (p-p53) with concomitant upregulation of p21 and pRB, whereas wogonin treatment significantly suppressed the levels of p-p53, p21, and pRB (Figures 3C–F). These results suggest that wogonin attenuated BLM-induced fibrotic markers in epithelial A549 cells by inhibiting cellular senescence through p53/p21 signalling, at least in part, by decreasing p53 phosphorylation.

Oxidative stress critically contributes to pulmonary fibrosis (Otoupalova et al., 2005). H₂O₂ is widely used as a well-established inducer of DNA damage and cell senescence. Thus, we treated A549 cells with H₂O₂ at the concentration of 200 μM with or without wogonin, then examined senescence as well as expressions of DNA damage related markers. As expected, H₂O₂ induced A549 cell senescence as revealed by the increased expression of SA-β-gal, the effect was significantly attenuated by wogonin treatment (positive area %; 30.97 ± 1.79 vs. 22.17 ± 1.22) (Figures 4A,D). DNA damage plays an important role in triggering senescence (Zhao et al., 2023). In order to verify the level of DNA damage, we applied immunofluorescence to detect the expression of DNA damage marker γ-H2AX in A549 cells after H₂O₂ stimulation with or without wogonin. We found that H₂O₂ increased γ-H2AX expression in nucleus while wogonin significantly decreased γ-H2AX expression (Figures 4B,E). The attenuation of γ-H2AX by wogonin was further confirmed by immunohistochemical analysis in vivo in mice treated with BLM (Figures 4C,F). Moreover, the beneficial effects of wogonin against DNA damage, cellular senescence and fibrosis in vitro was replicated by the use of another mouse lung epithelial cell line Mel-12. CCK8 assay demonstrated that wogonin at the concentrations of 1–20 μM had no significant effects on cell viability in Mel-12 cells (Supplementary Figure S1A). SA-β-gal activity was significantly attenuated by the treatment with wogonin in Mel-12 compared with BLM alone (Supplementary Figure S1B,D). Immunofluorescence also showed the expression of γ-H2AX was significantly decreased in wogonin group compared with BLM group (Supplementary Figure S1C,E). These results support that wogonin attenuated BLM-induced cell senescence via the inhibition of DNA damage.

It was reported that CDK9 is an upstream activator to phosphorylate p53 (Radhakrishnan and Gartel, 2006), and wogonin is a selective inhibitor of CDK9 (Wang et al., 2019). In order to verify whether wogonin protects BLM-induced fibrosis through the inhibition of CDK9, CDK9 was knocked down in A549 cells with a short hairpin RNA (shRNA) specifically targeting its mRNA. Western blot analysis confirmed successful knockdown with a clear decrease in the protein levels of CDK9 compared to that in cells transfected with the control vector (Figure 5A; Supplementary Figure S2). Moreover, CDK9 knockdown significantly abrogated the increase of fibronectin and α-SMA compared to that in cells induced with BLM. Intriguingly, knockdown of CDK9 significantly decreased p53 phosphorylation, with or without BLM stimulation (Figure 5A; Supplementary Figure S2, suggesting that CDK9 might regulate p53 phosphorylation to a significant level. Furthermore, in contrast to the scrambled control group, knockdown of CDK9 significantly decreased p21 and pRB expression (Figure 5A; Supplementary Figure S2). Increased SA-β-gal activity staining was observed in BLM-induced cells compared to the control group but was suppressed after CDK9 knockdown (Figures 5B,C). AZD4573, a selective CDK9 inhibitor, was used to further confirm the role of CDK9 in wogonin-mediated protection. A549 cells were cultured and stimulated with 15 mU/mL BLM for 4 h (Yu et al., 2018). The BLM-medium was then replaced with AZD4573 for 24 h. SA-β-gal activity staining was obviously reduced in cells treated with AZD4573 compared to the BLM group (Figures 5D,E). Western blot analysis showed that treatment of AZD4573 resulted in significant decreases in the protein levels of CDK9 and senescence markers p-p53 and p21 (Figure 5F). Thus, wogonin exhibited anti-fibrotic capacity by inhibiting CDK9-mediated p53/p21 signalling, and overall, CDK9 knockdown/inhibition and wogonin treatment had comparable effects.

We further explored the potential mechanism by which wogonin attenuates cellular senescence in BLM-induced PF in vivo. Immunohistochemical analysis showed that CDK9, p-p53 and p21 were upregulated in the lungs of BLM-induced PF groups, whereas wogonin treatment considerably diminished the elevations of CDK9, p-p53 and p21 (Figures 6A,C). Western blot analysis further demonstrated that BLM significantly elevated CDK9, along with enhanced expression of p-p53, p21, and Fib, indicating the activation of CDK9/p53 signalling pathway in lung lysates of BLM-induced PF mice (Figures 6B,D). Importantly, wogonin significantly decreased the expression of CDK9 and the levels of p-p53 and p21, supporting that wogonin suppressed BLM-induced lung fibrosis by inhibiting CDK9/p53-mediated senescence in vivo.

In line with the upregulation of CDK9 proteins by Western blots (Figures 6B,D), the expression of CDK9 was significantly higher evaluated by immunostaining in the BLM model of lung fibrosis in mice (Figures 6A,C). Finally, to verify the increased expression of CDK9 in human lung tissues with IPF, we used immunofluorescence to detect the expression of CDK9 and fibronectin in lung samples from normal and IPF lung tissue sections. Indeed, the expressions of CDK9 and fibronectin were significantly upregulated in human fibrotic lung tissues (Figures 7A–C).