<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Pharmacol.</journal-id>
<journal-title>Frontiers in Pharmacology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Pharmacol.</abbrev-journal-title>
<issn pub-type="epub">1663-9812</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1252174</article-id>
<article-id pub-id-type="doi">10.3389/fphar.2023.1252174</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Pharmacology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Minocycline synergizes with corticosteroids in reducing colitis severity in mice via the modulation of pro-inflammatory molecules</article-title>
<alt-title alt-title-type="left-running-head">Khajah et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphar.2023.1252174">10.3389/fphar.2023.1252174</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Khajah</surname>
<given-names>Maitham A.</given-names>
</name>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1071873/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hawai</surname>
<given-names>Sanaa</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Barakat</surname>
<given-names>Ahmad</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Albaloushi</surname>
<given-names>Aisha</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/2365600/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Alkharji</surname>
<given-names>Maha</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Masocha</surname>
<given-names>Willias</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/389693/overview"/>
</contrib>
</contrib-group>
<aff>
<institution>College of Pharmacy</institution>, <institution>Kuwait University</institution>, <addr-line>Kuwait City</addr-line>, <country>Kuwait</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1565145/overview">Ariane Leite Rozza</ext-link>, S&#xe3;o Paulo State University, Brazil</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2426345/overview">Suncica Buljevic</ext-link>, University of Rijeka, Croatia</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1309627/overview">Le Liu</ext-link>, Southern Medical University, China</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Maitham A. Khajah, <email>maitham.khajah@ku.edu.kw</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>16</day>
<month>11</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1252174</elocation-id>
<history>
<date date-type="received">
<day>03</day>
<month>07</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>31</day>
<month>10</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Khajah, Hawai, Barakat, Albaloushi, Alkharji and Masocha.</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Khajah, Hawai, Barakat, Albaloushi, Alkharji and Masocha</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<bold>Background:</bold> A few studies have highlighted the anti-inflammatory properties of minocycline in reducing colitis severity in mice, but its molecular mechanism is not fully understood. The aim of this study was to determine the anti-inflammatory properties of minocycline and the expression/activity profiles of molecules involved in pro-inflammatory signaling cascades, cytokines, and molecules involved in the apoptotic machinery. The synergistic effect between minocycline and corticosteroids was also evaluated.</p>
<p>
<bold>Methods:</bold> The effects of various treatment approaches were determined in mice using the dextran sulfate sodium (DSS) colitis model at gross and microscopic levels. The expression/activity profiles of various pro- or anti-inflammatory molecules were determined using Western blotting and polymerase chain reaction (PCR).</p>
<p>
<bold>Results:</bold> Minocycline treatment significantly reduced colitis severity using prophylactic and treatment approaches and produced a synergistic effect with budesonide and methylprednisolone in reducing the active state of colitis. This was mediated in part through reduced colonic expression/activity of pro-inflammatory molecules, cytokines, proteins involved in the apoptotic machinery, and increased expression of the anti-inflammatory cytokine IL-10.</p>
<p>
<bold>Conclusion:</bold> Minocycline synergizes with corticosteroids to reduce colitis severity, which could reduce their dose-dependent side effects and treatment cost. The reduction in colitis severity was achieved by modulating the expression/activity profiles of various pro- and anti-inflammatory signaling molecules, cytokines, and molecules involved in the apoptotic machinery.</p>
</abstract>
<kwd-group>
<kwd>colitis</kwd>
<kwd>DSS</kwd>
<kwd>minocycline</kwd>
<kwd>methylprednisolone</kwd>
<kwd>signaling pathway</kwd>
</kwd-group>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Gastrointestinal and Hepatic Pharmacology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>Inflammatory bowel disease (IBD) is a chronic inflammatory condition affecting the gastrointestinal tract (GIT) and may also contribute to the development of various extra-intestinal complications in affected individuals. It primarily comprises two major conditions: Crohn&#x2019;s disease (CD) and ulcerative colitis (UC) (<xref ref-type="bibr" rid="B21">Hanauer, 2006</xref>). The prevalence rates of IBD in Europe and North America range from 8 to 214 per 100,000 for CD and 21 to 246 per 100,000 for UC (<xref ref-type="bibr" rid="B16">Feuerstein et al., 2014</xref>). The incidence has been increasing in newly industrialized countries in Asia, South America, and the Middle East (<xref ref-type="bibr" rid="B46">Ng et al., 2018</xref>). Crohn&#x2019;s disease mainly manifests as a patchy pattern of an inflammatory process affecting the whole GIT, although it is more common in the terminal ileum and the right colon with enhanced production of T helper 1 (T<sub>H</sub>1) cytokines such as interleukin (IL)-12, IL-2, IL-1&#x3b2;, tumor necrosis factor alpha (TNF-&#x3b1;), and interferon gamma (IFN-&#x3b3;) (<xref ref-type="bibr" rid="B9">Boyapati et al., 2015</xref>). With regards to UC, inflammation is superficial with a diffuse pattern affecting mainly the colon, with enhanced production of T<sub>H</sub>2 cytokines such as IL-4, -5, -6, and -13 (<xref ref-type="bibr" rid="B67">Xavier and Podolsky, 2007</xref>). Although there are many therapeutic options currently available for the treatment of IBD, many of them fail to induce and maintain remission in approximately 30% of patients (<xref ref-type="bibr" rid="B61">van Deventer, 2002</xref>) and are associated with significant side effect profiles. Moreover, a significant proportion of patients are either steroid-resistant (20%) or steroid-dependent (30%), while the remaining 50% are neither resistant to nor dependent on steroid treatment (<xref ref-type="bibr" rid="B15">Farrell and Kelleher, 2003</xref>). Biological therapies can be used for the treatment of steroid-refractory patients, but they have many drawbacks, such as restrictions on non-oral routes of administration that require multiple hospital visits, a high cost of treatment, the immunogenicity of the product, which reduces its efficacy in long-term therapy regimens, and serious side effect profiles (<xref ref-type="bibr" rid="B61">van Deventer, 2002</xref>). Therefore, there is a need to find new therapeutic targets and agents that may offer alternatives to treat this chronic inflammatory condition. In a recent study, a combination regimen of one antibiotic with corticosteroids significantly induced disease remission in patients with active UC (<xref ref-type="bibr" rid="B60">Uehara et al., 2010</xref>). The findings of this study suggest that targeting the bacterial components and the immune response at the same time might be a better approach to the management of the disease.</p>
<p>Minocycline is a widely used second-generation, semi-synthetic tetracycline with antibacterial, antiviral, and anti-inflammatory properties (<xref ref-type="bibr" rid="B18">Garrido-Mesa et al., 2013a</xref>). It is considered a relatively safe antibiotic with broad-spectrum properties against many Gram-negative and Gram-positive bacteria like <italic>E. coli</italic>, <italic>P. aeruginosa</italic>, <italic>and B. subtilis</italic>, and <italic>S. aureus</italic>, respectively (<xref ref-type="bibr" rid="B10">Chen et al., 2000</xref>). Its mechanism of action is through the inhibition of protein synthesis by binding to the bacterial 30S ribosomal subunit. Interestingly, minocycline also possesses other biological actions beyond its antibacterial properties, such as anti-inflammatory, anti-apoptotic, and immunosuppressive properties, that are widely useful in various pathological conditions, such as acne vulgaris, rheumatoid arthritis, periodontitis, asthma, Parkinson&#x2019;s disease, neural ischemic damage, and Huntington&#x2019;s disease (<xref ref-type="bibr" rid="B18">Garrido-Mesa et al., 2013a</xref>).</p>
<p>Currently, there are a few studies that have described the role of minocycline in animal models of colitis. However, its molecular mechanism of action has not been fully elucidated as yet. Minocycline treatment reduced colitis severity (by using the treatment but not the prophylactic approach) in mouse models of chemically induced colitis, i.e., the dextran sulfate sodium (DSS) and trinitrobenzene sulfonic acid (TNBS) colitis models (<xref ref-type="bibr" rid="B19">Garrido-Mesa et al., 2013b</xref>). A previous study using the DSS model reported that minocycline (both prophylactic and treatment approaches) significantly reduced colitis severity at macroscopic and histological levels (<xref ref-type="bibr" rid="B24">Huang et al., 2009</xref>). The main aim of the present study was to determine the synergistic effect between minocycline and current clinically available treatment options, i.e., corticosteroids, for colitis. Another aim was to determine the contribution of the various compounds in the inflammatory response by examining the colonic expression/activity profiles of molecules involved in the pro-inflammatory signaling cascades, cytokines, and molecules involved in the apoptotic machinery. Studying the effects of the combination of minocycline with corticosteroids would be of clinical importance since this could improve therapeutic outcomes, reduce the doses of each drug, and thus reduce their dose-dependent side effects. Prednisolone/methylprednisolone and budesonide are widely used corticosteroids in IBD patients and animal models of colitis; therefore, they were used in this study as two agents from this category of drugs. In an animal model of colitis, prednisolone (2&#x2013;5&#xa0;mg/kg) was shown to reduce colitis severity at macroscopic and histological levels (<xref ref-type="bibr" rid="B47">Nirmal et al., 2013</xref>; <xref ref-type="bibr" rid="B44">Myrelid et al., 2015</xref>). Furthermore, treatment with methylprednisolone (0.4&#xa0;mg/day) reduced the colonic inflammatory score and the amount of fecal bacteria in the colon of rats with DSS-induced colitis (<xref ref-type="bibr" rid="B64">Wang et al., 2011</xref>). Budesonide was also shown to reduce colitis severity in mice with DSS- and acetic acid-induced colitis, partly through reducing the expression profile of various mediators/cytokines such as myeloperoxidase, nitric oxide, TNF-&#x3b1;, IL-6, cyclooxygenase-2 (COX-2), and inducible nitric oxide synthase (iNOS) (<xref ref-type="bibr" rid="B1">Ali et al., 2014</xref>; <xref ref-type="bibr" rid="B43">Mishra et al., 2023</xref>; <xref ref-type="bibr" rid="B55">Seoudi et al., 2023</xref>; <xref ref-type="bibr" rid="B68">Xian et al., 2023</xref>; <xref ref-type="bibr" rid="B70">Yang et al., 2023</xref>).</p>
<p>Herein, we showed experimental evidence for the anti-inflammatory properties of minocycline using both the prophylactic and treatment approaches, and its ability to synergize with two corticosteroids, methylprednisolone and budesonide, in an established colitis setting (using the treatment approach). This was mediated in part through reduced colonic expression/activity of pro-inflammatory molecules, cytokines, proteins involved in the apoptotic machinery, and increased expression of the anti-inflammatory cytokine IL-10.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Animals</title>
<p>The animals used in this study were female BALB/c mice (aged 6&#x2013;10&#xa0;weeks old with a mean weight of 20&#xa0;g) that were supplied by the Animal Resource Center of the Health Sciences Center at Kuwait University. The mice were kept under standard conditions, including controlled temperature (25&#xb0;C &#xb1; 1&#xb0;C), a 12-h light&#x2013;dark cycle, and free access to food and drinking water. All experiments were approved by the Animal Care Committee at Kuwait University Health Sciences Center and conformed to their rules and regulations as described previously (protocol approval number: P11613PT01) (<xref ref-type="bibr" rid="B29">Khajah et al., 2016a</xref>).</p>
</sec>
<sec id="s2-2">
<title>Dextran sulfate sodium colitis model</title>
<p>Colitis was induced in mice by mixing DSS polymers with the drinking water (3.5% w/v, Cat &#x23; 160110, MP Biomedicals) given <italic>ad libitum</italic> (<xref ref-type="bibr" rid="B65">Wirtz et al., 2007</xref>; <xref ref-type="bibr" rid="B29">Khajah et al., 2016a</xref>). Control, untreated (UT) mice received tap water. Daily weight changes were determined as a loss of baseline body weight. Colon length and maximal bowel thickness (in millimeters) were also determined (<xref ref-type="bibr" rid="B29">Khajah et al., 2016a</xref>). Two approaches were used in this study: a) prophylactic and b) treatment. For the prophylactic approach, mice received daily intra-peritoneal (i.p) injections of minocycline (10&#x2013;40&#xa0;mg/kg, Cat&#x23; M9511, Sigma) or vehicle (saline) along with DSS administration for 5&#xa0;days. For the treatment approach, mice received daily DSS administration for 4&#xa0;days (to first establish a state of active colitis), followed by daily i.p injections of minocycline (1&#x2013;40&#xa0;mg/kg), budesonide (0.1&#x2013;100&#xa0;&#x3bc;g/kg, Cat &#x23; 01901680540,365, AstraZeneca), methylprednisolone (0.01&#x2013;10&#xa0;mg/kg, Cat &#x23;P6004, Sigma), a combination regimen of minocycline plus either budesonide or methyl prednisolone, or vehicle (saline) for 3&#xa0;days (without DSS administration). After that, mice were sacrificed (on day 5 after the first administration of DSS for the prophylactic approach and on day 7 after the first administration of DSS for the treatment approach), and the severity of colitis was determined by macroscopic (gross) and microscopic (histologic) assessments.</p>
</sec>
<sec id="s2-3">
<title>Macroscopic assessment of colitis severity</title>
<p>The macroscopic assessment for colitis severity in all treatment groups was performed as previously described (<xref ref-type="bibr" rid="B29">Khajah et al., 2016a</xref>). The macroscopic assessment data are presented in tables as the percentage (%) of mice in each treatment group, showing various features of colitis (edema, erythema, diarrhea, blood in stool, anorectal bleeding, and adhesion).</p>
</sec>
<sec id="s2-4">
<title>Microscopic assessment of colitis severity</title>
<p>For the microscopic assessment of colitis severity, formalin-fixed colon tissues (the whole colon) were processed and (blindly) scored by two observers using a standard semi-quantitative histology scoring system, as previously described (<xref ref-type="bibr" rid="B29">Khajah et al., 2016a</xref>).</p>
</sec>
<sec id="s2-5">
<title>Western blotting</title>
<p>The colonic (descending part) protein expression of phospho/total ERK1/2 (Cat &#x23; 4370 and 9102), p38 MAPK (Cat &#x23; 9216), phospho-AKT (Cat &#x23; 9271), AKT (Cat &#x23; 9272), COX-2 (Cat &#x23; 4842), SRC (Cat &#x23; 5473), BAK (Cat &#x23; 12105), caspase-3 (Cat &#x23; 9662), the granulocyte marker LY6G (Cat &#x23; 87048), E-cadherin (Cat &#x23; 3195), and actin (loading control, Cat &#x23; 8457) (all from Cell Signaling, United States, 1:1000 dilution) were determined from all groups of mice by Western blotting, as described previously (<xref ref-type="bibr" rid="B28">Khajah et al., 2016b</xref>). In brief, colonic tissue was snap-frozen in liquid nitrogen and stored at &#x2212;80&#xb0;C until it was needed for further experiments. The colonic tissue samples were pulverized while frozen and then transferred to lysis buffer (pH 7.6) containing 10&#xa0;mM Tris-base, 140&#xa0;mM NaCl, 10&#xa0;mM Na<sub>4</sub>P<sub>2</sub>O<sub>7</sub>, 1&#xa0;mM NaF, 1&#xa0;mM CaCl<sub>2</sub>, 1&#xa0;mM MgCl<sub>2</sub>, 10% glycerol, 1% NP40 (Tergitol-type NP-40 and nonyl phenoxypolyethoxylethanol), 2&#xa0;mM Na<sub>3</sub>VO<sub>4</sub>, and a protease inhibitor cocktail. The tissues were homogenized using Polytron PT 4000 (Switzerland), and the samples were left to lyse completely by incubating them on an ice-cold shaker for 30&#xa0;min. Subsequently, they were centrifuged at 14,000&#xa0;rpm for 20&#xa0;min at 4&#xb0;C, and the supernatants were collected. Protein concentrations in the supernatants were measured using a Lowry/Bradford protein assay. Aliquots containing equal amounts of protein (10&#xa0;&#xb5;g) were subjected to gel electrophoresis and transferred onto nitrocellulose/PVDF membranes. Membranes were then subjected to BSA (2%&#x2013;4%) for 1&#xa0;h and then incubated with the appropriate antibodies and subsequently with appropriate secondary antibodies conjugated to horseradish peroxidase. Immunoreactive bands were detected with the SuperSignal chemiluminescent substrate (Pierce, United Kingdom) using Kodak autoradiography film (G.R.I., Rayne, United Kingdom).</p>
</sec>
<sec id="s2-6">
<title>Real-time reverse transcription&#x2013;polymerase chain reaction (RT-PCR)</title>
<p>Real-time RT-PCR was used to quantify the mRNA of the cytokines, TNF-&#x3b1;, IL-1&#x3b2;, and IL-10, in the colon and blood. The descending part of the colon was dissected and snap-frozen in liquid nitrogen. On the day of RNA extraction, the descending part of the colon was homogenized in 1.5&#xa0;mL of lysis buffer from the RNeasy<sup>&#xae;</sup> Mini Kit, containing 15&#xa0;&#x3bc;L of &#x3b2;-mercaptoethanol. Blood was extracted from the mice by cardiac puncture and added to the RNAprotect Animal Blood Tube (100&#xa0;&#x3bc;L). The tube with blood was inverted eight to ten times and left standing at 15&#x2013;25&#xb0;C for 2&#xa0;h. The contents were transferred to a 1.5-mL Eppendorf tube. This tube was centrifuged for 3&#xa0;min at 5,000 &#xd7; g at 20&#xb0;C, the supernatant was discarded, and 1&#xa0;mL of RNase-free water was added and vortexed with the pellet; this was centrifuged for 3&#xa0;min at 5,000 &#xd7; g at 20&#xb0;C, and the supernatant was discarded. Buffer RSB (240&#xa0;&#x3bc;L) from the RNeasy<sup>&#xae;</sup> Protect Animal Blood Kit was added to the pellet, vortexed until dissolved, and used for RNA extraction. Total RNA was extracted from homogenized colon samples and prepared into blood samples using the RNeasy<sup>&#xae;</sup> Mini Kit and RNeasy<sup>&#xae;</sup> Protect Animal Blood Kit, respectively, following the manufacturer&#x2019;s protocols, and quantified by spectrometry. The total RNA (500&#xa0;ng) was used to synthesize cDNA, as previously described (<xref ref-type="bibr" rid="B38">Masocha, 2009</xref>). Real-time RT-PCR amplification was performed in triplicate using an ABI Prism<sup>&#xae;</sup> 7500 Sequence Detection System (Applied Biosystems). A measure of 1&#xa0;&#xb5;L of cDNA was added to a 19&#xa0;&#xb5;L reaction mixture containing 1&#xd7; Platinum<sup>&#xae;</sup> SYBR<sup>&#xae;</sup> Green qPCR Supermix-UDG, ROX dye, and forward and reverse primers (125&#x2013;500&#xa0;nM), and amplified as previously described (<xref ref-type="bibr" rid="B38">Masocha, 2009</xref>). The primer sequences that were used (<xref ref-type="table" rid="T1">Table 1</xref>) were extracted from previous publications from other laboratories (<xref ref-type="bibr" rid="B33">Li et al., 2017</xref>) and our laboratory (<xref ref-type="bibr" rid="B49">Parvathy and Masocha, 2013</xref>), checked for specificity by BLAST in the GenBank database, and ordered from Invitrogen by Life Technologies. The housekeeping genes 18S ribosomal RNA (<italic>18s</italic>) and cyclophilin A (<italic>Ppia</italic>) were used to normalize the amount of transcripts in individual animal samples (&#x394;CT; <italic>n</italic> &#x3d; 3 to 5 per group for blood and <italic>n</italic> &#x3d; 7 to 19 for colon). The relative amount of target gene mRNA in the blood and colons was calculated using the previously described 2<sup>&#x2212;&#x394;&#x394;CT</sup> method (<xref ref-type="bibr" rid="B35">Livak and Schmittgen, 2001</xref>).</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primer sequences of genes used in real-time RT-PCR.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Name</th>
<th align="left">Polarity</th>
<th align="left">Sequence 5&#x2032;to 3&#x2032;</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">
<italic>18s</italic>
</td>
<td align="left">Sense</td>
<td align="left">CGGCTACCACATCCAAGGAA</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Anti-sense</td>
<td align="left">GCTGGAATTACCGCGGCT</td>
</tr>
<tr>
<td align="left">
<italic>Ppia</italic>
</td>
<td align="left">Sense</td>
<td align="left">GCTTTTCGCCGCTTGCT</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Anti-sense</td>
<td align="left">CTCGTCATCGGCCGTGAT</td>
</tr>
<tr>
<td align="left">
<italic>Il1b</italic>
</td>
<td align="left">Sense</td>
<td align="left">TGGTGTGTACGTTCCCATT</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Anti-sense</td>
<td align="left">CAGCAGAGGCTTTTTTGTTG</td>
</tr>
<tr>
<td align="left">
<italic>Tnf</italic>
</td>
<td align="left">Sense</td>
<td align="left">GGCTGCCCCGACTACGT</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Anti-sense</td>
<td align="left">GACTTTCTCCTGGTATGAGATAGCAAA</td>
</tr>
<tr>
<td align="left">
<italic>Il10</italic>
</td>
<td align="left">Sense</td>
<td align="left">CAGCCGGGAAGACAATAACTG</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Anti-sense</td>
<td align="left">CCGCAGCTCTAGGAGCATGT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-7">
<title>Statistical analysis</title>
<p>Data were analyzed using GraphPad InStat and Prism software programs (California, United States). Differences between groups were assessed using the Student unpaired <italic>t</italic>-test, Mann&#x2013;Whitney test, one-way ANOVA followed by a Bonferroni <italic>post hoc</italic> test, or Kruskal&#x2013;Wallis test, followed by Dunn&#x2019;s multiple comparisons test, with <italic>p</italic> &#x3c; 0.05 being regarded as significant.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Effect of prophylactic treatment with minocycline on colitis severity</title>
<p>A significant drop in body weight from the baseline level (7%) was observed in mice that received DSS plus vehicle compared to UT healthy mice (that received tap water only) (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F1">Figure 1A</xref>). Treatment with minocycline (10&#x2013;40&#xa0;mg/kg) prevented the DSS-induced weight loss, and the groups treated with minocycline had body weight similar to that of the UT group. A significant decrease in colon length (<xref ref-type="fig" rid="F1">Figure 1B</xref>) and increase in colon thickness (<xref ref-type="fig" rid="F1">Figure 1C</xref>) were observed in mice treated with DSS plus vehicle compared to UT mice (<italic>p</italic> &#x3c; 0.05). Treatment with minocycline (20&#x2013;40&#xa0;mg/kg) prevented the DSS-induced changes in colon length and width, and the groups treated with minocycline had a colon length and width similar to those of UT mice. No signs of inflammation at the gross level were observed in UT healthy mice (<xref ref-type="table" rid="T2">Table 2</xref>). DSS plus vehicle administration resulted in edema (100%), erythema (28%), diarrhea (57%), anorectal bleeding (28%), and adhesions (100%). Minocycline treatment at doses of 30&#x2013;40&#xa0;mg/kg significantly reduced the presence of edema. Treatment with minocycline at doses of 20&#x2013;40&#xa0;mg/kg prevented the development of DSS-induced erythema, diarrhea, anorectal bleeding, and adhesions. Administration of DSS caused a significant increase in the histological score of colitis (<xref ref-type="fig" rid="F1">Figure 1D</xref>) and percentage of ulceration in the whole colon (<xref ref-type="fig" rid="F1">Figure 1E</xref>) compared to UT (<italic>p</italic> &#x3c; 0.05). Treatment with DSS plus minocycline (at all doses, but specifically with 20&#x2013;40&#xa0;mg/kg) resulted in a significantly reduced histological score of colitis and percentage of ulceration compared to treatment with DSS plus vehicle. <xref ref-type="fig" rid="F1">Figure 1F</xref> shows examples of colon sections taken from UT, DSS plus vehicle, and DSS plus minocycline-treated mice. UT mice have normal colon architecture. DSS plus vehicle resulted in significant destruction of mucosal architecture, immune cell infiltration, submucosal edema, and muscle wall thickness. Treatment with DSS plus minocycline prevented the destruction of the mucosal architecture and muscle thickening, and significantly reduced the degree of immune cell infiltration and submucosal edema.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Effect of prophylactic treatment with minocycline on colitis severity at the macroscopic and microscopic levels. <bold>(A)</bold> Percentage of body weight changes in DSS-treated mice receiving vehicle and minocycline-treated mice at various doses compared to untreated (UT) mice. Colon length <bold>(B)</bold>, thickness <bold>(C)</bold>, histological assessment of colitis severity <bold>(D)</bold>, and the percentage of ulceration in the whole colon section <bold>(E)</bold> were determined in mice receiving DSS and either vehicle (solid bars) or various doses of minocycline (hatched bars) and in the UT healthy mice (open bars). Histobars represent means &#xb1; SEM for seven mice in each group. Asterisks denote a significant difference from UT mice with <italic>p</italic> &#x3c; 0.05 (&#x2a;), and &#x23; denotes significant difference from DSS/vehicle-treated mice with <italic>p</italic> &#x3c; 0.05. <bold>(F)</bold> Illustration of colon sections taken from various groups (&#xd7;10 and &#xd7;20 magnifications; bars represent 150&#xa0;&#x3bc;m).</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g001.tif"/>
</fig>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Effect of prophylactic treatment with minocycline on the macroscopic scores of colitis severity.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Parameter (%)</th>
<th align="left">Edema</th>
<th align="left">Erythema</th>
<th align="left">Diarrhea</th>
<th align="left">Blood in stool</th>
<th align="left">Anorectal bleeding</th>
<th align="left">Adhesion</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">UT</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
</tr>
<tr>
<td align="left">Vehicle</td>
<td align="left">100 &#x2a;</td>
<td align="left">28 &#x2a;</td>
<td align="left">57 &#x2a;</td>
<td align="left">0</td>
<td align="left">28 &#x2a;</td>
<td align="left">100 &#x2a;</td>
</tr>
<tr>
<td align="left">10&#xa0;mg/kg</td>
<td align="left">85 &#x2a;</td>
<td align="left">57 &#x2a;</td>
<td align="left">42 &#x2a;</td>
<td align="left">0</td>
<td align="left">33 &#x2a;</td>
<td align="left">42 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="left">20&#xa0;mg/kg</td>
<td align="left">83 &#x2a;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
</tr>
<tr>
<td align="left">30&#xa0;mg/kg</td>
<td align="left">33 &#x2a;&#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
</tr>
<tr>
<td align="left">40&#xa0;mg/kg</td>
<td align="left">33 &#x2a;&#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Colitis severity was assessed in UT mice (received tap water only) and mice treated with DSS for 5&#xa0;days, along with daily i. p administration of minocycline or vehicle (PBS) (<italic>n</italic> &#x3d; 7 per group). &#x2a; denotes a significant difference from UT mice; &#x23; denotes a significant difference from DSS/vehicle-treated mice.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-2">
<title>Effect of treatment with minocycline on the severity of already established colitis</title>
<p>Treatment with minocycline (10&#x2013;40&#xa0;mg/kg) reversed both the DSS-induced drop in body weight (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F2">Figure 2A</xref>) and increase in colon thickness (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F2">Figure 2C</xref>) but had no significant effects on colon length (<xref ref-type="fig" rid="F2">Figure 2B</xref>). Minocycline treatment at doses of 20&#x2013;30&#xa0;mg/kg significantly reduced DSS-induced edema, erythema, diarrhea, blood in stool, anorectal bleeding, and adhesions (<xref ref-type="table" rid="T3">Table 3</xref>). These signs of DSS-induced inflammation were absent in mice treated with minocycline at a dose of 40&#xa0;mg/kg. Minocycline treatment (at all doses) significantly reduced the DSS-induced histological score of colitis by 50%&#x2013;60% (<xref ref-type="fig" rid="F2">Figure 2D</xref>), and a minocycline dose of 40&#xa0;mg/kg reduced the percentage of ulceration by 60% (<xref ref-type="fig" rid="F2">Figure 2E</xref>). <xref ref-type="fig" rid="F2">Figure 2F</xref> shows examples of colon sections taken from different treatment groups. Minocycline treatment (specifically at 30&#x2013;40&#xa0;mg/kg doses) significantly restored mucosal architecture and muscle thickening, with a significant reduction in the degree of immune cell infiltration and submucosal edema.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Effect of therapeutic treatment with minocycline on colitis severity at the macroscopic and microscopic levels. <bold>(A)</bold> Percentage of body weight changes in DSS-treated mice receiving vehicle and minocycline-treated mice at various doses compared to untreated (UT) mice. Colon length <bold>(B)</bold>, thickness <bold>(C)</bold>, histological assessment of colitis severity <bold>(D)</bold>, and the percentage of ulceration in the whole colon section <bold>(E)</bold> were determined in mice receiving DSS and either vehicle (solid bars) or various doses of minocycline (hatched bars) and in the UT healthy mice (open bars). Histobars represent means &#xb1; SEM for seven mice in each group. Asterisks denote a significant difference from UT mice with <italic>p</italic> &#x3c; 0.05 (&#x2a;), and &#x23; denotes a significant difference from DSS/vehicle-treated mice with <italic>p</italic> &#x3c; 0.05. <bold>(F)</bold> Illustration of colon sections taken from various groups (&#xd7;10 and &#xd7;20 magnifications; bars represent 150&#xa0;&#x3bc;m).</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g002.tif"/>
</fig>
<table-wrap id="T3" position="float">
<label>TABLE 3</label>
<caption>
<p>Effect of therapeutic treatment with minocycline on the macroscopic scores of colitis severity.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Parameter (%)</th>
<th align="left">Edema</th>
<th align="left">Erythema</th>
<th align="left">Diarrhea</th>
<th align="left">Blood in stool</th>
<th align="left">Anorectal bleeding</th>
<th align="left">Adhesion</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">UT</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
</tr>
<tr>
<td align="left">Vehicle</td>
<td align="left">100 &#x2a;</td>
<td align="left">71 &#x2a;</td>
<td align="left">71 &#x2a;</td>
<td align="left">50&#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">85 &#x2a;</td>
</tr>
<tr>
<td align="left">10&#xa0;mg/kg</td>
<td align="left">100 &#x2a;</td>
<td align="left">0 &#x23;</td>
<td align="left">71 &#x2a;</td>
<td align="left">0</td>
<td align="left">57 &#x2a;&#x23;</td>
<td align="left">71 &#x2a;</td>
</tr>
<tr>
<td align="left">20&#xa0;mg/kg</td>
<td align="left">66 &#x2a;&#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">50 &#x2a;&#x23;</td>
<td align="left">0</td>
<td align="left">50 &#x2a;&#x23;</td>
<td align="left">66 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="left">30&#xa0;mg/kg</td>
<td align="left">33 &#x2a;&#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">50 &#x2a;&#x23;</td>
<td align="left">0</td>
<td align="left">0 &#x23;</td>
<td align="left">50 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="left">40&#xa0;mg/kg</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Colitis severity was assessed in UT mice and mice treated with DSS for 4&#xa0;days, followed by 3&#xa0;days of daily i. p administration of minocycline or vehicle (PBS) (without DSS treatment) (<italic>n</italic> &#x3d; 7 per group). &#x2a; denotes a significant difference from UT mice; &#x23; denotes a significant difference from DSS/vehicle-treated mice.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-3">
<title>Effect of treatment with budesonide on the severity of already established colitis</title>
<p>Budesonide treatment (at all doses) reversed both the DSS-induced drop in body weight (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F3">Figure 3A</xref>) and decrease in colon length (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F3">Figure 3B</xref>). Treatment with budesonide at doses from 0.5 to 100&#xa0;&#x3bc;g/kg reversed the DSS-induced increase in colon thickness (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F3">Figure 3C</xref>). Budesonide treatment at doses of 0.5&#x2013;1&#xa0;&#x3bc;g/kg significantly decreased DSS-induced edema, erythema, diarrhea, blood in stool, anorectal bleeding, and adhesions (<xref ref-type="table" rid="T4">Table 4</xref>), and these signs of inflammation were absent at budesonide doses of 10&#x2013;100&#xa0;&#x3bc;g/kg. Budesonide treatment significantly reduced the DSS-induced histological score of colitis and percentage of ulceration by approximately 50% at a dose of 0.5&#xa0;&#x3bc;g/kg and by 80%&#x2013;98% at higher doses of 10&#x2013;100&#xa0;&#x3bc;g/kg (<xref ref-type="fig" rid="F3">Figures 3D, E</xref>). <xref ref-type="fig" rid="F3">Figure 3F</xref> shows examples of colon sections taken from different treatment groups. Treatment with budesonide at doses of 1&#x2013;100&#xa0;&#x3bc;g/kg significantly restored all these parameters.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Effect of therapeutic treatment with budesonide on colitis severity at the macroscopic and microscopic levels. <bold>(A)</bold> Percentage of body weight changes in DSS-treated mice receiving vehicle and budesonide-treated mice at various doses compared to untreated (UT) mice. Colon length <bold>(B)</bold>, thickness <bold>(C)</bold>, histological assessment of colitis severity <bold>(D)</bold>, and the percentage of ulceration in the whole colon section <bold>(E)</bold> were determined in mice receiving DSS and either vehicle (solid bars) or various doses of budesonide (hatched bars) and in the UT healthy mice (open bars). Histobars represent means &#xb1; SEM for seven mice in each group. Asterisks denote a significant difference from UT mice with <italic>p</italic> &#x3c; 0.05 (&#x2a;), and &#x23; denotes a significant difference from DSS/vehicle-treated mice with <italic>p</italic> &#x3c; 0.05. <bold>(F)</bold> Illustration of colon sections taken from various groups (&#xd7;10 and &#xd7;20 magnifications; bars represent 150&#xa0;&#x3bc;m). OG, oral gavage.</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g003.tif"/>
</fig>
<table-wrap id="T4" position="float">
<label>TABLE 4</label>
<caption>
<p>Effect of therapeutic treatment with budesonide on the macroscopic scores of colitis severity.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Parameter (%)</th>
<th align="left">Edema</th>
<th align="left">Erythema</th>
<th align="left">Diarrhea</th>
<th align="left">Blood in stool</th>
<th align="left">Anorectal bleeding</th>
<th align="left">Adhesion</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">UT</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
</tr>
<tr>
<td align="left">Vehicle</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
</tr>
<tr>
<td align="left">0.1&#xa0;&#xb5;/kg</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">66 &#x2a;</td>
</tr>
<tr>
<td align="left">0.25&#xa0;&#xb5;/kg</td>
<td align="left">66 &#x2a;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">66 &#x2a;</td>
<td align="left">66 &#x2a;</td>
</tr>
<tr>
<td align="left">0.5&#xa0;&#xb5;/kg</td>
<td align="left">33 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">33 &#x23;</td>
</tr>
<tr>
<td align="left">1&#xa0;&#xb5;/kg</td>
<td align="left">33 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">33 &#x23;</td>
</tr>
<tr>
<td align="left">10&#xa0;&#xb5;/kg</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
</tr>
<tr>
<td align="left">50&#xa0;&#xb5;/kg</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
</tr>
<tr>
<td align="left">100&#xa0;&#xb5;/kg</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Colitis severity was assessed in UT mice and mice treated with DSS for 4&#xa0;days, followed by 3&#xa0;days of daily oral gavage (OG) of budesonide or vehicle (PBS) (without DSS treatment) (<italic>n</italic> &#x3d; 7 per group). &#x2a; denotes a significant difference from UT mice; &#x23; denotes a significant difference from DSS/vehicle-treated mice.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-4">
<title>Effect of treatment with budesonide and minocycline combinations on the severity of already established colitis</title>
<p>Sub-optimal doses of minocycline and budesonide, 10&#xa0;mg/kg minocycline and 0.5&#xa0;&#x3bc;g/kg budesonide, were used to study whether there is a synergistic effect between the two drugs in reducing symptoms of colitis in mice. Treatment with minocycline, budesonide, or their combination reversed the DSS-induced drop in body weight (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F4">Figure 4A</xref>), decrease in colon length (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F4">Figure 4B</xref>), and increase in colon thickness (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F4">Figure 4C</xref>). Treatment with individual drugs significantly reduced the DSS-induced edema, erythema, diarrhea, blood in stool, anorectal bleeding, and adhesions, but most importantly, the combination regimen completely reversed all these DSS-induced symptoms (<xref ref-type="table" rid="T5">Table 5</xref>). Treatment with minocycline or budesonide alone significantly reduced the DSS-induced histological score of colitis and percentage of ulceration, but most importantly, the combination regimen produced a more robust and significant reduction of these parameters than monotherapy (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F4">Figures 4D, E</xref>). <xref ref-type="fig" rid="F4">Figure 4F</xref> shows examples of colon sections taken from different treatment groups. Treatment with individual drugs reduced the various inflammatory parameters, but the combination regimen produced a higher degree of these parameters.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Effect of therapeutic treatment with minocycline, budesonide, or a combination regimen on colitis severity at the macroscopic and microscopic levels. <bold>(A)</bold> Percentage of body weight changes in DSS-treated mice receiving vehicle, minocycline (10&#xa0;mg/kg), and budesonide (0.5&#xa0;&#x3bc;g/kg), or untreated (UT) mice. Colon length <bold>(B)</bold>, thickness <bold>(C)</bold>, histological assessment of colitis severity <bold>(D)</bold>, and the percentage of ulceration in the whole colon section <bold>(E)</bold> were determined in mice receiving DSS and either vehicle (solid bars), monotherapy (hatched bars), or a combination regimen (gray bars), and in the UT healthy mice (open bars). Histobars represent means &#xb1; SEM for five mice in each group. Asterisks denote a significant difference from UT mice with <italic>p</italic> &#x3c; 0.05 (&#x2a;), &#x23; denotes a significant difference from DSS/vehicle-treated mice, and $ denotes a significant difference from monotherapy with <italic>p</italic> &#x3c; 0.05. <bold>(F)</bold> Illustration of colon sections taken from various groups (&#xd7;10 and &#xd7;20 magnifications; bars represent 150&#xa0;&#x3bc;m).</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g004.tif"/>
</fig>
<table-wrap id="T5" position="float">
<label>TABLE 5</label>
<caption>
<p>Effect of therapeutic treatment with minocycline, budesonide, or a combination regimen on the macroscopic scores of colitis severity.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Parameter (%)</th>
<th align="left">Edema</th>
<th align="left">Erythema</th>
<th align="left">Diarrhea</th>
<th align="left">Blood in stool</th>
<th align="left">Anorectal bleeding</th>
<th align="left">Adhesion</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">UT</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
</tr>
<tr>
<td align="left">Vehicle</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">40 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
</tr>
<tr>
<td align="left">Mino 10&#xa0;mg/kg</td>
<td align="left">100 &#x2a;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">40 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="left">Bud 0.5&#xa0;&#xb5;g/kg</td>
<td align="left">40 &#x2a;&#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">20 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="left">Mino &#x2b; Bud</td>
<td align="left">0 &#x23;$</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;$</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Colitis severity was assessed in UT mice and mice treated with DSS for 4&#xa0;days, followed by 3&#xa0;days of daily i. p administration of minocycline, OG of budesonide, a combination regimen or vehicle (PBS) (without DSS treatment) (<italic>n</italic> &#x3d; 5 per group). &#x2a; denotes a significant difference from UT mice, &#x23; denotes a significant difference from DSS/vehicle-treated mice, and $ denotes a significant difference from monotherapy.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-5">
<title>Effect of treatment with methyl prednisolone on the severity of already established colitis</title>
<p>Treatment with another corticosteroid, methylprednisolone, at doses of 0.1&#x2013;5&#xa0;mg/kg partially reversed both DSS-induced drop in body weight, while a higher dose of 10&#xa0;mg/kg restored the body weight to levels similar to those of UT mice (<xref ref-type="fig" rid="F5">Figure 5A</xref>). Treatment with methylprednisolone at 10&#xa0;mg/kg reversed both the DSS-induced decrease in colon length (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F5">Figure 5B</xref>) and the increase in colon thickness (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F5">Figure 5C</xref>). Methylprednisolone treatment (at doses of 0.1&#x2013;5&#xa0;mg/kg) significantly decreased the DSS-induced edema, erythema, diarrhea, blood in stool, anorectal bleeding, and adhesions, and these signs of inflammation were absent at a higher methylprednisolone dose of 10&#xa0;mg/kg (<xref ref-type="table" rid="T6">Table 6</xref>). Treatment with methyl prednisolone at doses of 5&#x2013;10&#xa0;mg/kg significantly reduced the DSS-induced histological score of colitis and % of ulceration <xref ref-type="fig" rid="F5">Figure 5D, E</xref>. <xref ref-type="fig" rid="F5">Figure 5F</xref> shows examples of colon sections taken from different treatment groups. The various inflammatory parameters were significantly improved with methylprednisolone treatment, and the higher dose of 10&#xa0;mg/kg eliminated the signs of inflammation.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Effect of therapeutic treatment with methylprednisolone on colitis severity at the macroscopic and microscopic levels. <bold>(A)</bold> Percentage of body weight changes in DSS-treated mice receiving vehicle, and minocycline-treated mice at various doses compared to untreated mice. Colon length <bold>(B)</bold>, thickness <bold>(C)</bold>, histological assessment of colitis severity <bold>(D)</bold>, and the percentage of ulceration in the whole colon section <bold>(E)</bold> were determined in mice receiving DSS and either vehicle (solid bars) or various doses of minocycline (hatched bars) and in the UT healthy mice (open bars). Histobars represent means &#xb1; SEM for four mice in each group. Asterisks denote a significant difference from UT mice with <italic>p</italic> &#x3c; 0.05 (&#x2a;), and &#x23; denotes a significant difference from DSS/vehicle-treated mice with <italic>p</italic> &#x3c; 0.05. <bold>(F)</bold> Illustration of colon sections taken from various groups (&#xd7;10 and &#xd7;20 magnifications; bars represent 150&#xa0;&#x3bc;m).</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g005.tif"/>
</fig>
<table-wrap id="T6" position="float">
<label>TABLE 6</label>
<caption>
<p>Effect of therapeutic treatment with methylprednisolone on the macroscopic scores of colitis severity.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Parameter (%)</th>
<th align="left">Edema</th>
<th align="left">Erythema</th>
<th align="left">Diarrhea</th>
<th align="left">Blood in stool</th>
<th align="left">Anorectal bleeding</th>
<th align="left">Adhesion</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">UT</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
<td align="left">0</td>
</tr>
<tr>
<td align="left">Vehicle</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">40 &#x2a;</td>
<td align="left">100 &#x2a;</td>
<td align="left">100 &#x2a;</td>
</tr>
<tr>
<td align="left">Mino 10&#xa0;mg/kg</td>
<td align="left">100 &#x2a;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">40 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="left">Bud 0.5&#xa0;&#xb5;g/kg</td>
<td align="left">40 &#x2a;&#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">20 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="left">Mino &#x2b; Bud 5 mg/kg</td>
<td align="left">0 &#x23;$</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;</td>
<td align="left">0 &#x23;$</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Colitis severity was assessed in UT mice and mice treated with DSS for 4&#xa0;days, followed by 3&#xa0;days of daily i. p administration of methylprednisolone or vehicle (PBS) (without DSS treatment) (<italic>n</italic> &#x3d; 4 per group). &#x2a; denotes a significant difference from UT mice; &#x23; denotes a significant difference from DSS/vehicle-treated mice.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-6">
<title>Effect of treatment with methylprednisolone and minocycline combinations on the severity of already established colitis</title>
<p>Sub-optimal doses of minocycline and methylprednisolone, 10&#xa0;mg/kg minocycline and 5&#xa0;mg/kg methyl prednisolone, were used to study whether there is a synergistic effect between the two drugs in reducing symptoms of colitis in mice. Treatment with the individual drugs or their combination reversed the DSS-induced drop in body weight (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F6">Figure 6A</xref>), while only the combination reversed the DSS-induced decrease in colon length (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F6">Figure 6B</xref>) and increase in colon thickness (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F6">Figure 6C</xref>). Treatment with individual drugs significantly reduced DSS-induced edema, erythema, diarrhea, blood in stool, anorectal bleeding, and adhesions, but most importantly, the combination regimen completely reversed all these DSS-induced symptoms (<xref ref-type="table" rid="T7">Table 7</xref>). Treatment with minocycline or methylprednisolone alone significantly reduced the DSS-induced histological score of colitis and percentage of ulceration, but most importantly, the combination regimen produced a more robust and significant reduction of these parameters than monotherapy (<italic>p</italic> &#x3c; 0.05; <xref ref-type="fig" rid="F6">Figures 6D, E</xref>). <xref ref-type="fig" rid="F6">Figure 6F</xref> shows examples of colon sections taken from different treatment groups. The various inflammatory parameters were significantly improved with methylprednisolone or minocycline treatment, but the combination regimen completely eliminated these signs of inflammation.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Effect of therapeutic treatment with minocycline, methylprednisolone, or a combination regimen on colitis severity at the macroscopic and microscopic levels. <bold>(A)</bold> Percentage of body weight changes in DSS-treated mice receiving vehicle, minocycline (10&#xa0;mg/kg), methylprednisolone (5&#xa0;mg/kg), and a combination regimen, or untreated (UT) mice. Colon length <bold>(B)</bold>, thickness <bold>(C)</bold>, histological assessment of colitis severity <bold>(D)</bold>, and the percentage of ulceration in the whole colon section <bold>(E)</bold> were determined in mice receiving DSS and either vehicle (solid bars), monotherapy (hatched bars), and a combination regimen (gray bar), or in the UT healthy mice (open bars). Histobars represent means &#xb1; SEM for five mice in each group. Asterisks denote a significant difference from UT mice with <italic>p</italic> &#x3c; 0.05 (&#x2a;), &#x23; denotes a significant difference from DSS/vehicle-treated mice, and $ denotes a significant difference from monotherapy with <italic>p</italic> &#x3c; 0.05. <bold>(F)</bold> Illustration of colon sections taken from various groups (&#xd7;10 and &#xd7;20 magnifications; bars represent 150&#xa0;&#x3bc;m).</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g006.tif"/>
</fig>
<table-wrap id="T7" position="float">
<label>TABLE 7</label>
<caption>
<p>Effect of therapeutic treatment with minocycline, methylprednisolone, or a combination regimen on the macroscopic scores of colitis severity.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">Parameter (%)</th>
<th align="center">Edema</th>
<th align="center">Erythema</th>
<th align="center">Diarrhea</th>
<th align="center">Blood in stool</th>
<th align="center">Anorectal bleeding</th>
<th align="center">Adhesion</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center">UT</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
<td align="center">0</td>
</tr>
<tr>
<td align="center">Vehicle</td>
<td align="center">100 &#x2a;</td>
<td align="center">75 &#x2a;</td>
<td align="center">92 &#x2a;</td>
<td align="center">33 &#x2a;</td>
<td align="center">66 &#x2a;</td>
<td align="center">100 &#x2a;</td>
</tr>
<tr>
<td align="center">0.05 mg/kg i.p</td>
<td align="center">43 &#x2a;&#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">14 &#x23;</td>
<td align="center">57 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="center">0.1 mg/kg i.p</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">14 &#x23;</td>
<td align="center">57 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="center">1 mg/kg i.p</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">57 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="center">3 mg/kg i.p</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">33 &#x2a;&#x23;</td>
</tr>
<tr>
<td align="center">6 mg/kg i.p</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
</tr>
<tr>
<td align="center">3 mg/kg OG</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
</tr>
<tr>
<td align="center">6 mg/kg OG</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
<td align="center">0 &#x23;</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Colitis severity was assessed in UT mice and mice treated with DSS for 4&#xa0;days, followed by 3&#xa0;days of daily i. p administration of minocycline, methylprednisolone, combination regimen, or vehicle (PBS) (without DSS treatment) (<italic>n</italic> &#x3d; 5 per group). &#x2a; denotes a significant difference from UT mice, &#x23; denotes a significant difference from DSS/vehicle-treated mice, and $ denotes a significant difference from monotherapy.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-7">
<title>Effect of treatment with dexamethasone on the severity of already established colitis</title>
<p>Treatment with various doses of dexamethasone (i.p. and oral gavage routes), another corticosteroid, significantly reduced signs of colitis at the gross but not at the histological level (<xref ref-type="sec" rid="s11">Supplementary Figure S1</xref>; <xref ref-type="sec" rid="s11">Supplementary Table S1</xref>). Therefore, we did not use dexamethasone in the combination regimen with minocycline.</p>
</sec>
<sec id="s3-8">
<title>Comparison of the effect of treatment with minocycline plus budesonide combination versus minocycline plus methylprednisolone combination on the severity of already established colitis</title>
<p>The sub-optimal doses and the route of administration for the two corticosteroids in combination with minocycline are different (budesonide &#x3d; 0.5&#xa0;&#x3bc;g/kg oral gavage and methyl prednisolone &#x3d; 5&#xa0;mg/kg intraperitoneal injection). The degree of reduction in the histological score of inflammation in the combination regimen vs. monotherapy was more profound with methyl prednisolone (<xref ref-type="fig" rid="F6">Figure 6D</xref>; approximately 69%) compared to budesonide (<xref ref-type="fig" rid="F4">Figure 4D</xref>; approximately 38%). For this, the combination regimen of minocycline plus methyl prednisolone was used for the subsequent experiments to determine the effects of treatment on the colonic expression/activity profiles of various pro-inflammatory and pro-apoptotic molecules.</p>
</sec>
<sec id="s3-9">
<title>Effect of treatment with minocycline, methylprednisolone, or a combination regimen on the colonic expression/activity of granulocyte markers, pro-inflammatory molecules, and molecules involved in the apoptotic machinery</title>
<p>Next, we used Western blot analysis to determine the possible mechanism by which these drugs reduce DSS-induced inflammation in the colon of mice (<xref ref-type="fig" rid="F7">Figure 7</xref>). Administration of DSS induced a significant increase in phospho-ERK1/2, the pro-inflammatory enzyme COX-2, the granulocyte marker LY6G, BAK, and caspase 3 compared to UT mice, which were all consistently reduced by treatment with the minocycline and methyl prednisolone combination regimen, while the individual drugs had variable effects. There were no differences in the levels of phospho-p38 MAPK, phospho-AKT, phospho-SRC, and E-cadherin in the colon between DSS-treated and UT mice. However, treatment with the combination regimen significantly reduced the phosphorylation of p38 MAPK, AKT, and SRC when compared to UT, vehicle, and monotherapy. The total AKT level was not modulated in all the tested groups. Finally, the combination regimen reduced the expression of E-cadherin when compared to UT, vehicle, and monotherapy.</p>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption>
<p>Effect of therapeutic treatment with minocycline, methylprednisolone, or a combination regimen on the colonic expression/activity of granulocyte markers, pro-inflammatory molecules, and molecules involved in the apoptotic machinery. The colonic expression/phosphorylation levels of various proteins were determined using Western blotting analysis. The blots represent one of three similar experiments. The densitometric analysis of the blots (arbitrary units) is also shown for each molecule. The <italic>y</italic>-axis represents the fold change between the tested groups (UT set as 1).</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g007.tif"/>
</fig>
</sec>
<sec id="s3-10">
<title>Effect of treatment with minocycline and methylprednisolone combination regimens on the blood and colonic gene expression of pro-/anti-inflammatory cytokines</title>
<p>A pilot study showed that the relative expression of the genes for the cytokines (<italic>Il1b</italic>, <italic>Tnf</italic>, and <italic>Il10</italic>) in the colon exhibited a trend to increase at day 3 after DSS/vehicle treatment, returning to UT levels by day 7 (<xref ref-type="sec" rid="s11">Supplementary Figure S2</xref>).</p>
<p>DSS/vehicle treatment did not alter the expression of the genes of the cytokines <italic>Il1b</italic> and <italic>Tnf</italic> in the blood at days 3 and 7 after the first administration of DSS compared to the UT group (<xref ref-type="fig" rid="F8">Figures 8A, B</xref>). <italic>Il10</italic> transcripts were lowly expressed in the blood of both control untreated (three out of the five samples undetected) or DSS/vehicle-treated mice (four out of the five samples undetected), and therefore, relative gene expression could not be calculated, while its transcripts were detected in all samples of the colon.</p>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption>
<p>Effect of therapeutic treatment with the minocycline and methylprednisolone combination (MMP) regimen on the blood and colonic gene expression of pro- and anti-inflammatory cytokines The relative mRNA expression of the cytokines <italic>Il1b</italic> and <italic>Tnf</italic> in the blood both at <bold>(A)</bold> day 3 and <bold>(B)</bold> day 7 in untreated, DSS/vehicle (V)-treated, and DSS/minocycline plus methyl prednisolone (Mino &#x2b; MP)-treated mice. Histobars represent the median plus the interquartile range of 3&#x2013;5 mice in each group. The relative mRNA expression of the cytokines <italic>Il1b</italic>, <italic>Tnf</italic>, and <italic>Il10</italic> in the colon both at <bold>(C)</bold> days 3 and <bold>(D)</bold> 7 in UT, V-treated, and Mino &#x2b; MP-treated mice. Histobars represent the median plus the interquartile range of 7&#x2013;19 mice in each group. &#x2a; denotes a significant difference from UT mice (<italic>p</italic> &#x3c; 0.05); &#x23;&#x23; denotes a significant difference from DSS/vehicle-treated mice (<italic>p</italic> &#x3c; 0.01).</p>
</caption>
<graphic xlink:href="fphar-14-1252174-g008.tif"/>
</fig>
<p>There was a significant increase in <italic>Il1b</italic> transcript levels in the colon of DSS/vehicle-treated mice compared to UT mice on day 3, while there were no differences in the expression of <italic>Tnf</italic> and <italic>Il10</italic> transcripts between the DSS/vehicle-treated mice and the UT mice (<xref ref-type="fig" rid="F8">Figure 8C</xref>). Treatment with the combination regimen of minocycline and methylprednisolone had no significant effects on the DSS-induced changes in <italic>Il1b</italic> transcript expression but increased the <italic>Tnf</italic> and <italic>Il10</italic> transcript levels on day 3 (<xref ref-type="fig" rid="F8">Figure 8C</xref>). On day 7, there were no differences in the levels of the transcripts of <italic>Il1b</italic>, <italic>Tnf</italic>, and <italic>Il10</italic> between the DSS/vehicle-treated mice and UT mice (<xref ref-type="fig" rid="F8">Figure 8D</xref>). Treatment with minocycline and methylprednisolone had no significant effects on the DSS-induced changes in <italic>Il1b</italic> and <italic>Tnf</italic> transcript expression but increased the <italic>Il10</italic> transcript levels on day 7 (<xref ref-type="fig" rid="F8">Figure 8D</xref>).</p>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>In the current study, minocycline treatment was effective in reducing colitis severity in mice and produced a synergistic effect with budesonide and methylprednisolone in alleviating active colitis. Lower doses of budesonide or methyl prednisolone, when used in combination with minocycline, produced similar anti-inflammatory effects as higher doses of budesonide or methyl prednisolone when used alone. This is of clinical importance in terms of targeting more than one arm of the pathological features of IBD, the complex inflammatory response and the bacterial components, as well as in terms of reducing the dose-dependent side effect profile of corticosteroids and the total cost of the treatment.</p>
<p>Currently, there are few studies that have described the role of minocycline in animal models of colitis. In one report, minocycline treatment significantly reduced colitis severity in the TNBS model by reducing the colonic expression levels of molecules involved in the inflammatory process such as TNF-&#x3b1;, IL-1&#x3b2;, iNOS, IL-17, IL-6, monocyte chemotactic protein-1 (MCP-1), cytokine-induced neutrophil chemoattractant-1 (CINC-1), and intercellular adhesion molecule 1 (ICAM-1) (<xref ref-type="bibr" rid="B19">Garrido-Mesa et al., 2013b</xref>). Minocycline treatment also resulted in increased colonic glutathione, mucin-2 (MUC-2), and trefoil factor-3 (TFF-3) levels. Another report showed that minocycline reduced the colonic expression levels of TNF-&#x3b1;, IL-1&#x3b2;, IL-6, matrix metalloproteinase (MMP)-2, -3, -9, and -13, and the serum level of nitric oxide (<xref ref-type="bibr" rid="B24">Huang et al., 2009</xref>). In addition, a combination regimen of minocycline and the probiotic <italic>Escherichia coli</italic> Nissle 1917 (5 &#xd7; 10<sup>8</sup> CFU/day; p. o, using the DSS model) resulted in synergistic anti-inflammatory effects. This was in part due to the reduction in the expression of IL-1&#x3b2;, TNF-&#x3b1;, IL-2, MIP-2, MCP-1, ICAM-1, iNOS, and MMP-9 (<xref ref-type="bibr" rid="B17">Garrido-Mesa et al., 2011</xref>). Furthermore, the combination regimen restored intestine integrity by upregulating the expression levels of MUC-3 and the TJ protein zonula occludens-1 (ZO-1). In the current study, both prophylactic and therapeutic treatment with minocycline significantly reduced colitis severity at both gross and histological levels (<xref ref-type="fig" rid="F1">Figures 1</xref>, <xref ref-type="fig" rid="F2">2</xref>; <xref ref-type="table" rid="T2">Table 2</xref>, <xref ref-type="table" rid="T3">3</xref>).</p>
<p>Dysregulation in the apoptotic machinery has been linked to IBD pathogenesis. Enhanced apoptotic colonic epithelial cells have been observed to have active UC (<xref ref-type="bibr" rid="B8">Boughton-Smith et al., 1993</xref>; <xref ref-type="bibr" rid="B40">Middleton et al., 1993</xref>; <xref ref-type="bibr" rid="B36">Lundberg et al., 1994</xref>). The colonic levels of various caspases were found to be increased in various animal models of colitis. For example, caspase-3 (<xref ref-type="bibr" rid="B2">Anselmi et al., 2015</xref>; <xref ref-type="bibr" rid="B57">Tang et al., 2015</xref>; <xref ref-type="bibr" rid="B50">Qian et al., 2016</xref>), -7 (<xref ref-type="bibr" rid="B2">Anselmi et al., 2015</xref>), and -12 (<xref ref-type="bibr" rid="B12">Crespo et al., 2012</xref>), and the cleaved forms of caspase-1 (<xref ref-type="bibr" rid="B34">Liu et al., 2016</xref>; <xref ref-type="bibr" rid="B37">Marquez-Flores et al., 2016</xref>), -12, and -7 (<xref ref-type="bibr" rid="B3">Arumugam et al., 2015</xref>) significantly increased post-colitis induction. Our data that demonstrated enhanced BAK and caspase-3 expression in the descending colon of mice subjected to DSS agree with these studies.</p>
<p>Neutrophils play an important role in IBD pathogenesis through enhanced recruitment and/or delayed apoptosis at the inflammatory site (<xref ref-type="bibr" rid="B22">Hirota et al., 2011</xref>), which leads to enhanced oxidative stress activity, leading to tissue damage (<xref ref-type="bibr" rid="B69">Yamada and Grisham, 1991</xref>; <xref ref-type="bibr" rid="B20">Gayle et al., 2000</xref>). Thus, depleting circulating neutrophils (<xref ref-type="bibr" rid="B45">Natsui et al., 1997</xref>; <xref ref-type="bibr" rid="B51">Qualls et al., 2006</xref>) or the administration of antioxidants significantly reduced colitis severity (<xref ref-type="bibr" rid="B69">Yamada and Grisham, 1991</xref>). In the current study, there was increased colonic expression of the granulocyte marker LY6G in DSS-treated mice, which was significantly decreased with minocycline and methylprednisolone treatment (<xref ref-type="fig" rid="F7">Figure 7</xref>). However, more detailed cellular studies are required to fully understand the molecular mechanisms of the disease and the drugs used to treat it.</p>
<p>The contribution of various pro-inflammatory signaling molecules such as COX-2, SRC, and ERK1/2 in IBD pathogenesis is well defined. For example, enhanced colonic activity of the MAPK pathway has been observed in IBD patients (<xref ref-type="bibr" rid="B23">Hommes et al., 2002</xref>; <xref ref-type="bibr" rid="B25">Jin et al., 2015</xref>), and the pro-apoptotic effects of pro-inflammatory cytokines such as TNF-&#x3b1; were mediated through enhanced MEK/ERK activation (<xref ref-type="bibr" rid="B6">Bai et al., 2015</xref>). In addition, enhanced COX-2 and SRC activity was observed in DSS-treated mice, which contributed to colitis pathogenesis (<xref ref-type="bibr" rid="B59">Tolstanova et al., 1999</xref>; <xref ref-type="bibr" rid="B54">Seok Yang et al., 2012</xref>). We observed enhanced expression/activity profiles of these signaling molecules in the colonic tissues of DSS-treated mice, which were reduced by minocycline and methylprednisolone treatment at different degrees (<xref ref-type="fig" rid="F7">Figure 7</xref>). Furthermore, T<sub>H</sub>-1-mediated cytokines such as IL-1&#x3b2; and TNF-&#x3b1; contribute to colitis pathogenesis and are important therapeutic targets for IBD management (<xref ref-type="bibr" rid="B56">Stevens et al., 1992</xref>; <xref ref-type="bibr" rid="B52">Reinecker et al., 1993</xref>; <xref ref-type="bibr" rid="B14">Els&#xe4;sser-et al., 1994</xref>; <xref ref-type="bibr" rid="B66">Woywodt et al., 1994</xref>; <xref ref-type="bibr" rid="B13">Dionne et al., 1997</xref>). These cytokines enhance the release of other cytokines and chemokines, and reactive oxygen species contribute to the severity of colitis (<xref ref-type="bibr" rid="B48">Papadakis and Targan, 2000</xref>). In the current study, the transcript levels of the pro-inflammatory cytokine <italic>Il1b</italic> were significantly increased in the colon of the colitis model at day 3 and returned to normal levels by day 7 (<xref ref-type="fig" rid="F8">Figure 8</xref>). There were no changes in the expression of the transcript levels of the cytokines in the blood, suggesting a more localized inflammation reaction in the colon of the mice. More interestingly, both the prophylactic and therapeutic treatment with minocycline and methylprednisolone had no significant effect on the levels of the transcripts of the pro-inflammatory cytokine <italic>Il1b</italic> but increased the transcript levels of the anti-inflammatory cytokine <italic>Il10</italic>, suggesting that in terms of cytokines, the treatment favored resolution of inflammation by increasing the levels of the anti-inflammatory cytokine.</p>
<p>Various corticosteroids are currently used for the induction (and sometimes for maintenance) of disease activity. Their usage is limited due to their various dose-dependent side effects, such as an increase in blood glucose levels and an increased risk of osteoporosis and infections (<xref ref-type="bibr" rid="B42">Mishra et al., 2020</xref>). In this study, using a low dose of either budesonide (<xref ref-type="fig" rid="F4">Figure 4</xref>) or methyl prednisolone (<xref ref-type="fig" rid="F6">Figure 6</xref>) in combination with a low dose of minocycline (10&#xa0;mg/kg) reduced colitis severity dramatically more than either drug alone. These results are of clinical importance as they target more than one arm of the inflammatory process and reduce the effective dose of steroids to half, thus reducing the chance of side effects.</p>
<p>In conclusion, we confirmed that minocycline is effective in reducing colitis severity in mice and synergizes with corticosteroids (cutting their doses by half) to reduce their dose-dependent side effects and treatment cost. This was achieved by modulating the expression/activity profiles of various pro- and anti-inflammatory signaling molecules, cytokines, and molecules involved in the apoptotic machinery.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="sec" rid="s11">Supplementary Material</xref>; further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6">
<title>Ethics statement</title>
<p>The animal study was approved by the Animal Care Committee at Kuwait University Health Sciences Center and conformed to their rules and regulations as described previously (protocol approval number: P11613PT01). The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s7">
<title>Author contributions</title>
<p>MK and WM: conceived and designed the experiments. SH, MK, WM, AB, AA, and MA: performed the experiments. MK and WM: analyzed the data. MK and WM: contributed reagents/materials/analysis tools. MK: wrote the paper. WM: edited the paper. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8">
<title>Funding</title>
<p>This work was supported by Kuwait University Research Sector grant PT02/20.</p>
</sec>
<ack>
<p>The authors would like to thank the animal facility in the Health Science Center for providing the animals for this study.</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s10">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fphar.2023.1252174/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fphar.2023.1252174/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table1.docx" id="SM1" mimetype="application/docx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image2.TIF" id="SM2" mimetype="application/TIF" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.TIF" id="SM3" mimetype="application/TIF" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ali</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Weigmann</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Neurath</surname>
<given-names>M. F.</given-names>
</name>
<name>
<surname>Collnot</surname>
<given-names>E. M.</given-names>
</name>
<name>
<surname>Windbergs</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lehr</surname>
<given-names>C. M.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Budesonide loaded nanoparticles with pH-sensitive coating for improved mucosal targeting in mouse models of inflammatory bowel diseases</article-title>. <source>J. Control Release</source> <volume>183</volume>, <fpage>167</fpage>&#x2013;<lpage>177</lpage>. <pub-id pub-id-type="doi">10.1016/j.jconrel.2014.03.039</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anselmi</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Huynh</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Duraffourd</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Jaramillo</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Vegezzi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Saccani</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Activation of mu opioid receptors modulates inflammation in acute experimental colitis</article-title>. <source>Neurogastroenterol. Motil.</source> <volume>27</volume>, <fpage>509</fpage>&#x2013;<lpage>523</lpage>. <pub-id pub-id-type="doi">10.1111/nmo.12521</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arumugam</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sreedhar</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Thandavarayan</surname>
<given-names>R. A.</given-names>
</name>
<name>
<surname>Giridharan</surname>
<given-names>V. V.</given-names>
</name>
<name>
<surname>Karuppagounder</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Pitchaimani</surname>
<given-names>V.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Telmisartan treatment targets inflammatory cytokines to suppress the pathogenesis of acute colitis induced by dextran sulphate sodium</article-title>. <source>Cytokine</source> <volume>74</volume>, <fpage>305</fpage>&#x2013;<lpage>312</lpage>. <pub-id pub-id-type="doi">10.1016/j.cyto.2015.03.017</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arvin</surname>
<given-names>K. L.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>B. H.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>S. Z.</given-names>
</name>
<name>
<surname>Paul</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Holtzman</surname>
<given-names>D. M.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Minocycline markedly protects the neonatal brain against hypoxic-ischemic injury</article-title>. <source>Ann. Neurol.</source> <volume>52</volume>, <fpage>54</fpage>&#x2013;<lpage>61</lpage>. <pub-id pub-id-type="doi">10.1002/ana.10242</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Azimi</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Nasiri</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Chirani</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>Pouriran</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Dabiri</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>The role of bacteria in the inflammatory bowel disease development: a narrative review</article-title>. <source>Apmis</source> <volume>126</volume>, <fpage>275</fpage>&#x2013;<lpage>283</lpage>. <pub-id pub-id-type="doi">10.1111/apm.12814</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bai</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>G. F.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>L. J.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>W. W.</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>Q. Q.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J. D.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>SGK1 inhibits cellular apoptosis and promotes proliferation via the MEK/ERK/p53 pathway in colitis</article-title>. <source>World J. Gastroenterol.</source> <volume>21</volume>, <fpage>6180</fpage>&#x2013;<lpage>6193</lpage>. <pub-id pub-id-type="doi">10.3748/wjg.v21.i20.6180</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bastos</surname>
<given-names>L. F.</given-names>
</name>
<name>
<surname>Prazeres</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Godin</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Menezes</surname>
<given-names>R. R.</given-names>
</name>
<name>
<surname>Soares</surname>
<given-names>D. G.</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>W. C.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Sex-independent suppression of experimental inflammatory pain by minocycline in two mouse strains</article-title>. <source>Neurosci. Lett.</source> <volume>553</volume>, <fpage>110</fpage>&#x2013;<lpage>114</lpage>. <pub-id pub-id-type="doi">10.1016/j.neulet.2013.08.026</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boughton-Smith</surname>
<given-names>N. K.</given-names>
</name>
<name>
<surname>Evans</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Hawkey</surname>
<given-names>C. J.</given-names>
</name>
<name>
<surname>Cole</surname>
<given-names>A. T.</given-names>
</name>
<name>
<surname>Balsitis</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Whittle</surname>
<given-names>B. J.</given-names>
</name>
<etal/>
</person-group> (<year>1993</year>). <article-title>Nitric oxide synthase activity in ulcerative colitis and Crohn&#x27;s disease</article-title>. <source>Lancet</source> <volume>342</volume>, <fpage>338</fpage>&#x2013;<lpage>340</lpage>. <pub-id pub-id-type="doi">10.1016/0140-6736(93)91476-3</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boyapati</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Satsangi</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>G. T.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Pathogenesis of Crohn&#x27;s disease</article-title>. <source>F1000Prime Rep.</source> <volume>7</volume> (<issue>1000</issue>), <fpage>44</fpage>. <pub-id pub-id-type="doi">10.12703/P7-44</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ona</surname>
<given-names>V. O.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ferrante</surname>
<given-names>R. J.</given-names>
</name>
<name>
<surname>Fink</surname>
<given-names>K. B.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2000</year>). <article-title>Minocycline inhibits caspase-1 and caspase-3 expression and delays mortality in a transgenic mouse model of Huntington disease</article-title>. <source>Nat. Med.</source> <volume>6</volume>, <fpage>797</fpage>&#x2013;<lpage>801</lpage>. <pub-id pub-id-type="doi">10.1038/77528</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cho</surname>
<given-names>I. H.</given-names>
</name>
<name>
<surname>Chung</surname>
<given-names>Y. M.</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>C. K.</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2006</year>). <article-title>Systemic administration of minocycline inhibits formalin-induced inflammatory pain in rat</article-title>. <source>Brain Res.</source> <volume>9</volume>, <fpage>208</fpage>&#x2013;<lpage>214</lpage>. <pub-id pub-id-type="doi">10.1016/j.brainres.2005.12.039</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crespo</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>San-Miguel</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Prause</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Marroni</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Cuevas</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Gonzalez-Gallego</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Glutamine treatment attenuates endoplasmic reticulum stress and apoptosis in TNBS-induced colitis</article-title>. <source>PLoS One</source> <volume>7</volume>, <fpage>e50407</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0050407</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dionne</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Hiscott</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>D&#x27;Agata</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Duhaime</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Seidman</surname>
<given-names>E. G.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Quantitative PCR analysis of TNF-alpha and IL-1 beta mRNA levels in pediatric IBD mucosal biopsies</article-title>. <source>Dig. Dis. Sci.</source> <volume>42</volume>, <fpage>1557</fpage>&#x2013;<lpage>1566</lpage>. <pub-id pub-id-type="doi">10.1023/a:1018895500721</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Els&#xe4;sser-Beile</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>von Kleist</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gerlach</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gallati</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>M&#xf6;nting</surname>
<given-names>J. S.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>Cytokine production in whole blood cell cultures of patients with Crohn&#x27;s disease and ulcerative colitis</article-title>. <source>J. Clin. Lab. Anal.</source> <volume>8</volume>, <fpage>447</fpage>&#x2013;<lpage>451</lpage>. <pub-id pub-id-type="doi">10.1002/jcla.1860080618</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Farrell</surname>
<given-names>R. J.</given-names>
</name>
<name>
<surname>Kelleher</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Glucocorticoid resistance in inflammatory bowel disease</article-title>. <source>J. Endocrinol.</source> <volume>178</volume>, <fpage>339</fpage>&#x2013;<lpage>346</lpage>. <pub-id pub-id-type="doi">10.1677/joe.0.1780339</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feuerstein</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Cheifetz</surname>
<given-names>A. S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Ulcerative colitis: epidemiology, diagnosis, and management</article-title>. <source>Mayo Clin. Proc.</source> <volume>89</volume>, <fpage>1553</fpage>&#x2013;<lpage>1563</lpage>. <pub-id pub-id-type="doi">10.1016/j.mayocp.2014.07.002</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garrido-Mesa</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Utrilla</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Comalada</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zorrilla</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Garrido-Mesa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zarzuelo</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>The association of minocycline and the probiotic <italic>Escherichia coli</italic> Nissle 1917 results in an additive beneficial effect in a DSS model of reactivated colitis in mice</article-title>. <source>Biochem. Pharmacol.</source> <volume>82</volume>, <fpage>1891</fpage>&#x2013;<lpage>1900</lpage>. <pub-id pub-id-type="doi">10.1016/j.bcp.2011.09.004</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garrido-Mesa</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Zarzuelo</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>G&#xe1;lvez</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2013a</year>). <article-title>Minocycline: far beyond an antibiotic</article-title>. <source>Br. J. Pharmacol.</source> <volume>169</volume>, <fpage>337</fpage>&#x2013;<lpage>352</lpage>. <pub-id pub-id-type="doi">10.1111/bph.12139</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garrido-Mesa</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Zarzuelo</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>G&#xe1;lvez</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2013b</year>). <article-title>Minocycline: far beyond an antibiotic</article-title>. <source>Br. J. Pharmacol.</source> <volume>169</volume>, <fpage>337</fpage>&#x2013;<lpage>352</lpage>. <pub-id pub-id-type="doi">10.1111/bph.12139</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gayle</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Blikslager</surname>
<given-names>A. T.</given-names>
</name>
<name>
<surname>Jones</surname>
<given-names>S. L.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Role of neutrophils in intestinal mucosal injury</article-title>. <source>J. Am. Vet. Med. Assoc.</source> <volume>217</volume>, <fpage>498</fpage>&#x2013;<lpage>500</lpage>. <pub-id pub-id-type="doi">10.2460/javma.2000.217.498</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hanauer</surname>
<given-names>S. B.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Inflammatory bowel disease: epidemiology, pathogenesis, and therapeutic opportunities</article-title>. <source>Inflamm. Bowel Dis.</source> <volume>12</volume>, <fpage>S3</fpage>&#x2013;<lpage>S9</lpage>. <pub-id pub-id-type="doi">10.1097/01.mib.0000195385.19268.68</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hirota</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Ng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Lueng</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Khajah</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Parhar</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>NLRP3 inflammasome plays a key role in the regulation of intestinal homeostasis</article-title>. <source>Inflamm. Bowel Dis.</source> <volume>17</volume>, <fpage>1359</fpage>&#x2013;<lpage>1372</lpage>. <pub-id pub-id-type="doi">10.1002/ibd.21478</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hommes</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>van den Blink</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Plasse</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Bartelsman</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Macpherson</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2002</year>). <article-title>Inhibition of stress-activated MAP kinases induces clinical improvement in moderate to severe Crohn&#x27;s disease</article-title>. <source>Gastroenterology</source> <volume>122</volume>, <fpage>7</fpage>&#x2013;<lpage>14</lpage>. <pub-id pub-id-type="doi">10.1053/gast.2002.30770</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>T. Y.</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>H. C.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y. L.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>C. K.</given-names>
</name>
<name>
<surname>Hsieh</surname>
<given-names>T. Y.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>W. K.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>Minocycline attenuates experimental colitis in mice by blocking expression of inducible nitric oxide synthase and matrix metalloproteinases</article-title>. <source>Toxicol. Appl. Pharmacol.</source> <volume>237</volume>, <fpage>69</fpage>&#x2013;<lpage>82</lpage>. <pub-id pub-id-type="doi">10.1016/j.taap.2009.02.026</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>Z. M.</given-names>
</name>
<name>
<surname>Shang</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Chao</surname>
<given-names>Q. L.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y. R.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Anti-inflammatory and anti-oxidative activities of paeonol and its metabolites through blocking MAPK/ERK/p38 signaling pathway</article-title>. <source>Inflammation</source> <volume>39</volume>, <fpage>434</fpage>&#x2013;<lpage>446</lpage>. <pub-id pub-id-type="doi">10.1007/s10753-015-0265-3</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kannampalli</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Pochiraju</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bruckert</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shaker</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Banerjee</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Sengupta</surname>
<given-names>J. N.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Analgesic effect of minocycline in rat model of inflammation-induced visceral pain</article-title>. <source>Eur. J. Pharmacol.</source> <volume>727</volume>, <fpage>87</fpage>&#x2013;<lpage>98</lpage>. <pub-id pub-id-type="doi">10.1016/j.ejphar.2014.01.026</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kelly</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Sutton</surname>
<given-names>T. A.</given-names>
</name>
<name>
<surname>Weathered</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Ray</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Caldwell</surname>
<given-names>E. J.</given-names>
</name>
<name>
<surname>Plotkin</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Minocycline inhibits apoptosis and inflammation in a rat model of ischemic renal injury</article-title>. <source>Am. J. Physiol. Ren. Physiol.</source> <volume>287</volume>, <fpage>F760</fpage>&#x2013;<lpage>F766</lpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00050.2004</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khajah</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Ananthalakshmi</surname>
<given-names>K. V.</given-names>
</name>
<name>
<surname>Edafiogho</surname>
<given-names>I.</given-names>
</name>
</person-group> (<year>2016b</year>). <article-title>Anti-inflammatory properties of the enaminone E121 in the dextran sulfate sodium (DSS) colitis model</article-title>. <source>PLoS One</source> <volume>11</volume>, <fpage>e0168567</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0168567</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khajah</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Fateel</surname>
<given-names>M. M.</given-names>
</name>
<name>
<surname>Ananthalakshmi</surname>
<given-names>K. V.</given-names>
</name>
<name>
<surname>Luqmani</surname>
<given-names>Y. A.</given-names>
</name>
</person-group> (<year>2016a</year>). <article-title>Anti-inflammatory action of angiotensin 1-7 in experimental colitis</article-title>. <source>PLoS One</source> <volume>11</volume>, <fpage>e0150861</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0150861</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kholmukhamedov</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Czerny</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Schwartz</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhong</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Lemasters</surname>
<given-names>J. J.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Minocycline and doxycycline, but not tetracycline, mitigate liver and kidney injury after hemorrhagic shock/resuscitation</article-title>. <source>Shock</source> <volume>42</volume>, <fpage>256</fpage>&#x2013;<lpage>263</lpage>. <pub-id pub-id-type="doi">10.1097/SHK.0000000000000213</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Kong</surname>
<given-names>P. J.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>B. S.</given-names>
</name>
<name>
<surname>Sheen</surname>
<given-names>D. H.</given-names>
</name>
<name>
<surname>Nam</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Chun</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Inhibitory action of minocycline on lipopolysaccharide-induced release of nitric oxide and prostaglandin E2 in BV2 microglial cells</article-title>. <source>Arch. Pharm. Res.</source> <volume>27</volume>, <fpage>314</fpage>&#x2013;<lpage>318</lpage>. <pub-id pub-id-type="doi">10.1007/BF02980066</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kloppenburg</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Breedveld</surname>
<given-names>F. C.</given-names>
</name>
<name>
<surname>Terwiel</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Mallee</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Dijkmans</surname>
<given-names>B. A.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>Minocycline in active rheumatoid arthritis. A double-blind, placebo-controlled trial</article-title>. <source>Arthritis Rheum.</source> <volume>37</volume>, <fpage>629</fpage>&#x2013;<lpage>636</lpage>. <pub-id pub-id-type="doi">10.1002/art.1780370505</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Diao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Xing</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Identification of suitable reference genes for real-time quantitative PCR analysis of hydrogen peroxide-treated human umbilical vein endothelial cells</article-title>. <source>BMC Mol. Biol.</source> <volume>18</volume>, <fpage>10</fpage>. <pub-id pub-id-type="doi">10.1186/s12867-017-0086-z</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Tao</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Dimethyl fumarate ameliorates dextran sulfate sodium-induced murine experimental colitis by activating Nrf2 and suppressing NLRP3 inflammasome activation</article-title>. <source>Biochem. Pharmacol.</source> <volume>2952</volume>, <fpage>30075</fpage>&#x2013;<lpage>30082</lpage>. <pub-id pub-id-type="doi">10.1016/j.bcp.2016.05.002</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname>
<given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lundberg</surname>
<given-names>J. O.</given-names>
</name>
<name>
<surname>Hellstrom</surname>
<given-names>P. M.</given-names>
</name>
<name>
<surname>Lundberg</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Alving</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>Greatly increased luminal nitric oxide in ulcerative colitis</article-title>. <source>Lancet</source> <volume>344</volume>, <fpage>1673</fpage>&#x2013;<lpage>1674</lpage>. <pub-id pub-id-type="doi">10.1016/s0140-6736(94)90460-x</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marquez-Flores</surname>
<given-names>Y. K.</given-names>
</name>
<name>
<surname>Villegas</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Cardeno</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rosillo</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Alarcon-de-la-Lastra</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Apigenin supplementation protects the development of dextran sulfate sodium-induced murine experimental colitis by inhibiting canonical and non-canonical inflammasome signaling pathways</article-title>. <source>J. Nutr. Biochem.</source> <volume>30</volume>, <fpage>143</fpage>&#x2013;<lpage>152</lpage>. <pub-id pub-id-type="doi">10.1016/j.jnutbio.2015.12.002</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Masocha</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Systemic lipopolysaccharide (LPS)-induced microglial activation results in different temporal reduction of CD200 and CD200 receptor gene expression in the brain</article-title>. <source>J. Neuroimmunol.</source> <volume>214</volume>, <fpage>78</fpage>&#x2013;<lpage>82</lpage>. <pub-id pub-id-type="doi">10.1016/j.jneuroim.2009.06.022</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mei</surname>
<given-names>X. P.</given-names>
</name>
<name>
<surname>Sakuma</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Kotani</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Depressing interleukin-1&#x3b2; contributed to the synergistic effects of tramadol and minocycline on spinal nerve ligation-induced neuropathic pain</article-title>. <source>Neurosignals</source> <volume>22</volume>, <fpage>30</fpage>&#x2013;<lpage>42</lpage>. <pub-id pub-id-type="doi">10.1159/000355071</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Middleton</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Shorthouse</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hunter</surname>
<given-names>J. O.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>Increased nitric oxide synthesis in ulcerative colitis</article-title>. <source>Lancet</source> <volume>341</volume>, <fpage>465</fpage>&#x2013;<lpage>466</lpage>. <pub-id pub-id-type="doi">10.1016/0140-6736(93)90211-x</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mika</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Rojewska</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Makuch</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Przewlocka</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Minocycline reduces the injury-induced expression of prodynorphin and pronociceptin in the dorsal root ganglion in a rat model of neuropathic pain</article-title>. <source>Neuroscience</source> <volume>165</volume>, <fpage>1420</fpage>&#x2013;<lpage>1428</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuroscience.2009.11.064</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mishra</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Dhawan</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Srivastava</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>Singh</surname>
<given-names>A. B.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Inflammatory bowel disease: therapeutic limitations and prospective of the stem cell therapy</article-title>. <source>World J. Stem Cells</source> <volume>12</volume>, <fpage>1050</fpage>&#x2013;<lpage>1066</lpage>. <pub-id pub-id-type="doi">10.4252/wjsc.v12.i10.1050</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mishra</surname>
<given-names>R. K.</given-names>
</name>
<name>
<surname>Ahmad</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kanika</surname>
</name>
<name>
<surname>Kumar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Vyawahare</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Sakla</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Caffeic acid-conjugated budesonide-loaded nanomicelle attenuates inflammation in experimental colitis</article-title>. <source>Mol. Pharm.</source> <volume>20</volume>, <fpage>172</fpage>&#x2013;<lpage>182</lpage>. <pub-id pub-id-type="doi">10.1021/acs.molpharmaceut.2c00558</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Myrelid</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Salim</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Darby</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Almer</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Melgar</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Andersson</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Effects of anti-inflammatory therapy on bursting pressure of colonic anastomosis in murine dextran sulfate sodium induced colitis</article-title>. <source>Scand. J. Gastroenterol.</source> <volume>50</volume>, <fpage>991</fpage>&#x2013;<lpage>1001</lpage>. <pub-id pub-id-type="doi">10.3109/00365521.2014.964760</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Natsui</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kawasaki</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Takizawa</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Hayashi</surname>
<given-names>S. I.</given-names>
</name>
<name>
<surname>Matsuda</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Sugimura</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>1997</year>). <article-title>Selective depletion of neutrophils by a monoclonal antibody, RP-3, suppresses dextran sulphate sodium-induced colitis in rats</article-title>. <source>J. Gastroenterol. Hepatol.</source> <volume>12</volume>, <fpage>801</fpage>&#x2013;<lpage>808</lpage>. <pub-id pub-id-type="doi">10.1111/j.1440-1746.1997.tb00375.x</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ng</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>H. Y.</given-names>
</name>
<name>
<surname>Hamidi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Underwood</surname>
<given-names>F. E.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Benchimol</surname>
<given-names>E. I.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: a systematic review of population-based studies</article-title>. <source>Lancet</source> <volume>390</volume>, <fpage>2769</fpage>&#x2013;<lpage>2778</lpage>. <pub-id pub-id-type="doi">10.1016/S0140-6736(17)32448-0</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nirmal</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Ingale</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Pattan</surname>
<given-names>S. R.</given-names>
</name>
<name>
<surname>Bhawar</surname>
<given-names>S. B.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Amaranthus roxburghianus root extract in combination with piperine as a potential treatment of ulcerative colitis in mice</article-title>. <source>J. Integr. Med.</source> <volume>11</volume>, <fpage>206</fpage>&#x2013;<lpage>212</lpage>. <pub-id pub-id-type="doi">10.3736/jintegrmed2013022</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Papadakis</surname>
<given-names>K. A.</given-names>
</name>
<name>
<surname>Targan</surname>
<given-names>S. R.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Role of cytokines in the pathogenesis of inflammatory bowel disease</article-title>. <source>Annu. Rev. Med.</source> <volume>51</volume>, <fpage>289</fpage>&#x2013;<lpage>298</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.med.51.1.289</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parvathy</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Masocha</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Matrix metalloproteinase inhibitor COL-3 prevents the development of paclitaxel-induced hyperalgesia in mice</article-title>. <source>Med. Princ. Pract.</source> <volume>22</volume>, <fpage>35</fpage>&#x2013;<lpage>41</lpage>. <pub-id pub-id-type="doi">10.1159/000341710</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qian</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Miao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Sam68 modulates apoptosis of intestinal epithelial cells via mediating NF-&#x3ba;B activation in ulcerative colitis</article-title>. <source>Mol. Immunol.</source> <volume>75</volume>, <fpage>48</fpage>&#x2013;<lpage>59</lpage>. <pub-id pub-id-type="doi">10.1016/j.molimm.2016.05.011</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qualls</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Kaplan</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>van Rooijen</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Cohen</surname>
<given-names>D. A.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Suppression of experimental colitis by intestinal mononuclear phagocytes</article-title>. <source>J. Leukoc. Biol.</source> <volume>80</volume>, <fpage>802</fpage>&#x2013;<lpage>815</lpage>. <pub-id pub-id-type="doi">10.1189/jlb.1205734</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reinecker</surname>
<given-names>H. C.</given-names>
</name>
<name>
<surname>Steffen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Witthoeft</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Pflueger</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Schreiber</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>MacDermott</surname>
<given-names>R. P.</given-names>
</name>
<etal/>
</person-group> (<year>1993</year>). <article-title>Enhanced secretion of tumour necrosis factor-alpha, IL-6, and IL-1 beta by isolated lamina propria mononuclear cells from patients with ulcerative colitis and Crohn&#x27;s disease</article-title>. <source>Clin. Exp. Immunol.</source> <volume>94</volume>, <fpage>174</fpage>&#x2013;<lpage>181</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2249.1993.tb05997.x</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sanchez Mejia</surname>
<given-names>R. O.</given-names>
</name>
<name>
<surname>Ona</surname>
<given-names>V. O.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Friedlander</surname>
<given-names>R. M.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Minocycline reduces traumatic brain injury-mediated caspase-1 activation, tissue damage, and neurological dysfunction</article-title>. <source>Neurosurgery</source> <volume>48</volume>, <fpage>1393</fpage>&#x2013;<lpage>1399</lpage>. <pub-id pub-id-type="doi">10.1097/00006123-200106000-00051</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seok Yang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Woong Kim</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hye Kim</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Hee Rhee</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Src/NF-&#x3ba;B-targeted inhibition of LPS-induced macrophage activation and dextran sodium sulphate-induced colitis by Archidendron clypearia methanol extract</article-title>. <source>J. Ethnopharmacol.</source> <volume>142</volume>, <fpage>287</fpage>&#x2013;<lpage>293</lpage>. <pub-id pub-id-type="doi">10.1016/j.jep.2012.04.026</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seoudi</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Allam</surname>
<given-names>E. A.</given-names>
</name>
<name>
<surname>El-Kamel</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Elkafrawy</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>El-Moslemany</surname>
<given-names>R. M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Targeted delivery of budesonide in acetic acid induced colitis: impact on miR-21 and E-cadherin expression</article-title>. <source>Drug Deliv. Transl. Res.</source> <volume>13</volume>, <fpage>2930</fpage>&#x2013;<lpage>2947</lpage>. <pub-id pub-id-type="doi">10.1007/s13346-023-01363-2</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stevens</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Walz</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Singaram</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Lipman</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Zanker</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Muggia</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>1992</year>). <article-title>Tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6 expression in inflammatory bowel disease</article-title>. <source>Dig. Dis. Sci.</source> <volume>37</volume>, <fpage>818</fpage>&#x2013;<lpage>826</lpage>. <pub-id pub-id-type="doi">10.1007/BF01300378</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ni</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Pyruvate kinase M2 regulates apoptosis of intestinal epithelial cells in Crohn&#x27;s disease</article-title>. <source>Dig. Dis. Sci.</source> <volume>60</volume>, <fpage>393</fpage>&#x2013;<lpage>404</lpage>. <pub-id pub-id-type="doi">10.1007/s10620-014-3189-0</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Teng</surname>
<given-names>Y. D.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Onario</surname>
<given-names>R. C.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Desilets</surname>
<given-names>F. C.</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Minocycline inhibits contusion-triggered mitochondrial cytochrome c release and mitigates functional deficits after spinal cord injury</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>101</volume>, <fpage>3071</fpage>&#x2013;<lpage>3076</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0306239101</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tolstanova</surname>
<given-names>H. M.</given-names>
</name>
<name>
<surname>Khomenko</surname>
<given-names>T. A.</given-names>
</name>
<name>
<surname>Ostapchenko</surname>
<given-names>L. I.</given-names>
</name>
<name>
<surname>Szabo</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sandor</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>The role of Src-tyrosine kinases in increasing vascular permeability during experimental ulcerative colitis</article-title>. <source>Ukr. Biokhim Zh</source> <volume>82</volume>, <fpage>117</fpage>&#x2013;<lpage>122</lpage>.</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Uehara</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kato</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ohkusa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Sugitani</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ishii</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Nemoto</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Efficacy of antibiotic combination therapy in patients with active ulcerative colitis, including refractory or steroid-dependent cases</article-title>. <source>J. Gastroenterol. Hepatol.</source> <volume>25</volume>, <fpage>S62</fpage>&#x2013;<lpage>S66</lpage>. <pub-id pub-id-type="doi">10.1111/j.1440-1746.2010.06231.x</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van Deventer</surname>
<given-names>S. J.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Small therapeutic molecules for the treatment of inflammatory bowel disease</article-title>. <source>Gut</source> <volume>50</volume>, <fpage>III47</fpage>&#x2013;<lpage>53</lpage>. <pub-id pub-id-type="doi">10.1136/gut.50.suppl_3.iii47</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verri</surname>
<given-names>W. A.</given-names>
<suffix>Jr.</suffix>
</name>
<name>
<surname>Cunha</surname>
<given-names>T. M.</given-names>
</name>
<name>
<surname>Parada</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Poole</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cunha</surname>
<given-names>F. Q.</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>S. H.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Hypernociceptive role of cytokines and chemokines: targets for analgesic drug development?</article-title> <source>Pharmacol. Ther.</source> <volume>112</volume>, <fpage>116</fpage>&#x2013;<lpage>138</lpage>. <pub-id pub-id-type="doi">10.1016/j.pharmthera.2006.04.001</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>C. X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Shuaib</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Effects of minocycline alone and in combination with mild hypothermia in embolic stroke</article-title>. <source>Brain Res.</source> <volume>963</volume>, <fpage>327</fpage>&#x2013;<lpage>329</lpage>. <pub-id pub-id-type="doi">10.1016/s0006-8993(02)04045-3</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>H. Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>Y. Z.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H. F.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Effect of enteral nutrition on dextran sulfate sodium-induced colitis in rats</article-title>. <source>J. Dig. Dis.</source> <volume>12</volume>, <fpage>453</fpage>&#x2013;<lpage>458</lpage>. <pub-id pub-id-type="doi">10.1111/j.1751-2980.2011.00518.x</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wirtz</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Neufert</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Weigmann</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Neurath</surname>
<given-names>M. F.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Chemically induced mouse models of intestinal inflammation</article-title>. <source>Nat. Protoc.</source> <volume>2</volume>, <fpage>541</fpage>&#x2013;<lpage>546</lpage>. <pub-id pub-id-type="doi">10.1038/nprot.2007.41</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Woywodt</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Neustock</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Kruse</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Schwarting</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ludwig</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Stange</surname>
<given-names>E. F.</given-names>
</name>
<etal/>
</person-group> (<year>1994</year>). <article-title>Cytokine expression in intestinal mucosal biopsies. <italic>in situ</italic> hybridisation of the mRNA for interleukin-1 beta, interleukin-6 and tumour necrosis factor-alpha in inflammatory bowel disease</article-title>. <source>Eur. Cytokine Netw.</source> <volume>5</volume>, <fpage>387</fpage>&#x2013;<lpage>395</lpage>.</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xavier</surname>
<given-names>R. J.</given-names>
</name>
<name>
<surname>Podolsky</surname>
<given-names>D. K.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Unravelling the pathogenesis of inflammatory bowel disease</article-title>. <source>Nature</source> <volume>448</volume>, <fpage>427</fpage>&#x2013;<lpage>434</lpage>. <pub-id pub-id-type="doi">10.1038/nature06005</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xian</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Oral liposomal delivery of an activatable budesonide prodrug reduces colitis in experimental mice</article-title>. <source>Drug Deliv.</source> <volume>30</volume>, <fpage>2183821</fpage>. <pub-id pub-id-type="doi">10.1080/10717544.2023.2183821</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamada</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Grisham</surname>
<given-names>M. B.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Role of neutrophil-derived oxidants in the pathogenesis of intestinal inflammation</article-title>. <source>Klin. Wochenschr</source> <volume>69</volume>, <fpage>988</fpage>&#x2013;<lpage>994</lpage>. <pub-id pub-id-type="doi">10.1007/BF01645144</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Teng</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Budesonide-liposomes inclusion complex in thermosensitive gel alleviates DSS-induced ulcerative colitis in mice</article-title>. <source>Drug Dev. Ind. Pharm.</source> <volume>49</volume>, <fpage>341</fpage>&#x2013;<lpage>347</lpage>. <pub-id pub-id-type="doi">10.1080/03639045.2023.2212789</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z. Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Hua</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2016a</year>). <article-title>Activation of corticotropin-releasing factor neurons and microglia in paraventricular nucleus precipitates visceral hypersensitivity induced by colorectal distension in rats</article-title>. <source>Brain Behav. Immun.</source> <volume>55</volume>, <fpage>93</fpage>&#x2013;<lpage>104</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbi.2015.12.022</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>B. X.</given-names>
</name>
<name>
<surname>Hua</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>B. M.</given-names>
</name>
<name>
<surname>Carbonaro</surname>
<given-names>T. M.</given-names>
</name>
<etal/>
</person-group> (<year>2016b</year>). <article-title>Hippocampal microglial activation and glucocorticoid receptor down-regulation precipitate visceral hypersensitivity induced by colorectal distension in rats</article-title>. <source>Neuropharmacology</source> <volume>102</volume>, <fpage>295</fpage>&#x2013;<lpage>303</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuropharm.2015.11.028</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>